Starting /dee2/code/volunteer_pipeline.sh SRR7171865 current disk space = 3088559538176 free memory = 1409453324 SRR7171865 SRAfilesize 3804db7abe508833ff5549ab356fa9f0 SRR7171865.sra SRR7171865.sra file validated SRR7171865 is paired end SRR7171865 is conventional basespace SRR7171865 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171865_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.13675 32.0 18.0 33.0 18.0 33.0 2 27.85325 30.0 25.0 33.0 18.0 33.0 3 30.51125 31.0 29.0 33.0 27.0 33.0 4 31.979 33.0 31.0 33.0 29.0 33.0 5 32.333 33.0 32.0 33.0 31.0 34.0 6 36.34425 38.0 36.0 38.0 34.0 38.0 7 37.3815 38.0 38.0 38.0 36.0 38.0 8 37.40925 38.0 38.0 38.0 36.0 38.0 9 37.5105 38.0 38.0 38.0 37.0 38.0 10-14 37.5635 38.0 38.0 38.0 37.8 38.0 15-19 37.5612 38.0 38.0 38.0 38.0 38.0 20-24 37.5522 38.0 38.0 38.0 37.6 38.0 25-29 37.5411 38.0 38.0 38.0 37.8 38.0 30-34 37.523199999999996 38.0 38.0 38.0 37.4 38.0 35-39 37.49455 38.0 38.0 38.0 37.0 38.0 40-44 37.4352 38.0 38.0 38.0 37.0 38.0 45-49 37.4111 38.0 38.0 38.0 37.0 38.0 50-54 37.34850000000001 38.0 38.0 38.0 37.0 38.0 55-59 37.22185 38.0 38.0 38.0 36.4 38.0 60-64 37.18415 38.0 38.0 38.0 36.0 38.0 65-69 37.1223 38.0 38.0 38.0 36.0 38.0 70-74 37.07455 38.0 38.0 38.0 36.0 38.0 75-79 37.02034999999999 38.0 38.0 38.0 36.0 38.0 80-84 36.91195 38.0 38.0 38.0 35.6 38.0 85-89 36.8702 38.0 38.0 38.0 35.0 38.0 90-94 36.7322 38.0 38.0 38.0 35.0 38.0 95-99 36.6684 38.0 38.0 38.0 34.8 38.0 100-104 36.544200000000004 38.0 38.0 38.0 34.0 38.0 105-109 36.40105 38.0 37.8 38.0 34.0 38.0 110-114 36.27245 38.0 37.6 38.0 33.8 38.0 115-119 36.07355 38.0 37.0 38.0 33.0 38.0 120-124 35.9227 38.0 37.0 38.0 32.8 38.0 125-129 35.82775 38.0 36.6 38.0 32.2 38.0 130-134 35.50825 38.0 36.0 38.0 31.0 38.0 135-139 35.179050000000004 38.0 35.8 38.0 29.4 38.0 140-144 34.77265 38.0 35.0 38.0 27.8 38.0 145-149 34.18055 38.0 35.0 38.0 25.2 38.0 150-151 30.824875 36.5 31.0 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 1.0 15 2.0 16 1.0 17 1.0 18 3.0 19 2.0 20 2.0 21 4.0 22 3.0 23 2.0 24 5.0 25 10.0 26 11.0 27 20.0 28 20.0 29 29.0 30 38.0 31 46.0 32 62.0 33 87.0 34 158.0 35 292.0 36 803.0 37 2395.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.97848386289717 14.460845634225668 11.933950462847136 35.62672004003002 2 20.0 17.2 35.225 27.575 3 18.75 23.575 25.45 32.225 4 21.475 31.3 22.875 24.349999999999998 5 22.6 32.675 25.275 19.45 6 17.825 33.975 26.900000000000002 21.3 7 14.000000000000002 23.375 43.475 19.15 8 16.950000000000003 23.400000000000002 30.425 29.225 9 18.2 24.075 31.7 26.025 10-14 19.66 29.37 27.310000000000002 23.66 15-19 19.45 28.785 27.800000000000004 23.965 20-24 19.67 28.715000000000003 27.944999999999997 23.669999999999998 25-29 19.945 28.560000000000002 27.900000000000002 23.595 30-34 20.05 28.71 27.58 23.66 35-39 19.7 28.915000000000003 27.74 23.645 40-44 19.085 28.835 27.88 24.2 45-49 20.44 28.265 27.825 23.47 50-54 19.725 28.194999999999997 28.299999999999997 23.78 55-59 20.29 28.499999999999996 27.445000000000004 23.765 60-64 19.900000000000002 28.439999999999998 27.800000000000004 23.86 65-69 20.13 28.125 28.13 23.615 70-74 20.495 27.77 28.005000000000003 23.73 75-79 19.965 28.095 27.900000000000002 24.04 80-84 20.135 27.37 27.76 24.735 85-89 20.330000000000002 28.52 27.315 23.835 90-94 20.325 28.24 27.644999999999996 23.79 95-99 20.330000000000002 27.305 28.33 24.035 100-104 20.53 27.985 27.54 23.945 105-109 20.59 27.805000000000003 27.255000000000003 24.349999999999998 110-114 20.54 28.185 27.884999999999998 23.39 115-119 20.87 27.834999999999997 27.700000000000003 23.595 120-124 20.04 28.225 27.99 23.745 125-129 21.125 27.985 27.255000000000003 23.635 130-134 20.96 27.98 27.255000000000003 23.805 135-139 20.76 28.105000000000004 27.334999999999997 23.799999999999997 140-144 21.240000000000002 27.93 27.084999999999997 23.745 145-149 21.095 27.715 27.715 23.474999999999998 150-151 20.837500000000002 28.1625 26.775 24.224999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.5 18 1.0 19 1.0 20 1.0 21 0.5 22 1.0 23 3.0 24 7.0 25 5.5 26 6.0 27 10.5 28 12.0 29 14.5 30 23.0 31 27.5 32 31.0 33 43.0 34 57.5 35 62.5 36 74.5 37 94.0 38 126.5 39 174.0 40 192.0 41 208.5 42 248.5 43 269.5 44 270.0 45 267.5 46 255.0 47 245.5 48 233.0 49 204.5 50 169.0 51 134.5 52 111.0 53 89.0 54 69.5 55 65.0 56 49.0 57 27.0 58 20.0 59 17.5 60 17.0 61 13.5 62 9.5 63 8.5 64 9.0 65 6.5 66 3.0 67 3.5 68 2.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79954898521673 99.575 2 0.17539463793535454 0.35000000000000003 3 0.025056376847907794 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1125 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.16249999999999998 0.0 0.0 0.0 0.0 102-103 0.2625 0.0 0.0 0.0 0.0 104-105 0.3375 0.0 0.0 0.0 0.0 106-107 0.4 0.0 0.0 0.0 0.0 108-109 0.5249999999999999 0.0 0.0 0.0 0.0 110-111 0.5874999999999999 0.0 0.0 0.0 0.0 112-113 0.7250000000000001 0.0 0.0 0.0 0.0 114-115 0.825 0.0 0.0 0.0 0.0 116-117 0.9 0.0 0.0 0.0 0.0 118-119 0.975 0.0 0.0 0.0 0.0 120-121 1.2000000000000002 0.0 0.0 0.0 0.0 122-123 1.275 0.0 0.0 0.0 0.0 124-125 1.5375 0.0 0.0 0.0 0.0 126-127 1.775 0.0 0.0 0.0 0.0 128-129 1.8625 0.0 0.0 0.0 0.0 130-131 2.1125 0.0 0.0 0.0 0.0 132-133 2.4625 0.0 0.0 0.0 0.0 134-135 2.8 0.0 0.0 0.0 0.0 136-137 3.125 0.0 0.0 0.0 0.0 138-139 3.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGTCCTC 10 0.006830828 145.0 5 TTTTAAT 10 0.006830828 145.0 6 >>END_MODULE SRR7171865 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171865_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0895 33.0 33.0 34.0 32.0 34.0 2 33.21125 34.0 33.0 34.0 33.0 34.0 3 33.27325 34.0 33.0 34.0 33.0 34.0 4 33.241 34.0 33.0 34.0 33.0 34.0 5 33.1925 34.0 33.0 34.0 33.0 34.0 6 37.39575 38.0 38.0 38.0 38.0 38.0 7 37.494 38.0 38.0 38.0 38.0 38.0 8 37.39125 38.0 38.0 38.0 37.0 38.0 9 37.411 38.0 38.0 38.0 38.0 38.0 10-14 37.406349999999996 38.0 38.0 38.0 37.4 38.0 15-19 37.30905 38.0 38.0 38.0 37.0 38.0 20-24 37.3027 38.0 38.0 38.0 37.0 38.0 25-29 37.275400000000005 38.0 38.0 38.0 37.0 38.0 30-34 37.276349999999994 38.0 38.0 38.0 37.0 38.0 35-39 37.1356 38.0 38.0 38.0 37.0 38.0 40-44 36.94665 38.0 38.0 38.0 36.6 38.0 45-49 37.11355 38.0 38.0 38.0 36.8 38.0 50-54 37.14960000000001 38.0 38.0 38.0 37.0 38.0 55-59 37.08305 38.0 38.0 38.0 36.4 38.0 60-64 37.06915 38.0 38.0 38.0 36.0 38.0 65-69 37.022850000000005 38.0 38.0 38.0 36.0 38.0 70-74 36.935050000000004 38.0 38.0 38.0 36.0 38.0 75-79 36.8967 38.0 38.0 38.0 36.0 38.0 80-84 36.79505 38.0 38.0 38.0 35.2 38.0 85-89 36.710150000000006 38.0 38.0 38.0 35.0 38.0 90-94 36.631299999999996 38.0 38.0 38.0 35.0 38.0 95-99 36.520950000000006 38.0 38.0 38.0 34.6 38.0 100-104 36.425850000000004 38.0 38.0 38.0 34.0 38.0 105-109 36.248000000000005 38.0 38.0 38.0 34.0 38.0 110-114 36.07905 38.0 37.4 38.0 33.6 38.0 115-119 35.98085 38.0 37.0 38.0 33.0 38.0 120-124 35.77415 38.0 37.0 38.0 32.2 38.0 125-129 35.5159 38.0 36.0 38.0 31.0 38.0 130-134 35.2164 38.0 36.0 38.0 30.0 38.0 135-139 34.97955 38.0 35.6 38.0 29.2 38.0 140-144 34.48995 38.0 35.0 38.0 26.8 38.0 145-149 34.00515 38.0 35.0 38.0 24.4 38.0 150-151 30.829625 36.5 30.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 2.0 4 2.0 5 2.0 6 1.0 7 2.0 8 5.0 9 0.0 10 0.0 11 0.0 12 4.0 13 0.0 14 0.0 15 3.0 16 0.0 17 3.0 18 5.0 19 2.0 20 6.0 21 5.0 22 4.0 23 4.0 24 7.0 25 10.0 26 14.0 27 20.0 28 21.0 29 25.0 30 33.0 31 43.0 32 64.0 33 72.0 34 154.0 35 280.0 36 655.0 37 2549.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.5 16.825000000000003 15.075 27.6 2 23.175 25.474999999999998 33.6 17.75 3 22.625 26.75 29.625 21.0 4 24.375 34.699999999999996 21.475 19.45 5 24.275 37.125 21.45 17.150000000000002 6 19.05 37.8 23.599999999999998 19.55 7 18.2 18.175 40.925 22.7 8 21.05 23.025000000000002 27.700000000000003 28.225 9 23.1 25.025 28.425 23.45 10-14 23.425 29.07 25.83 21.675 15-19 22.835 28.77 27.639999999999997 20.755000000000003 20-24 23.155 28.765 26.72 21.36 25-29 23.674999999999997 28.265 26.87 21.19 30-34 23.465 28.46 27.33 20.745 35-39 23.702552273980846 28.31569974427117 26.876598305169736 21.105149676578247 40-44 23.767605633802816 28.279678068410462 27.11267605633803 20.840040241448694 45-49 23.745 27.855 27.139999999999997 21.26 50-54 23.705000000000002 27.61 27.589999999999996 21.095 55-59 23.565 27.650000000000002 27.12 21.665 60-64 23.31 28.055000000000003 27.639999999999997 20.995 65-69 23.845 28.310000000000002 27.375 20.47 70-74 23.535 27.965 27.295 21.205 75-79 23.549999999999997 28.26 27.029999999999998 21.16 80-84 23.705000000000002 27.860000000000003 27.250000000000004 21.185000000000002 85-89 23.799999999999997 28.12 27.02 21.060000000000002 90-94 23.955000000000002 28.38 27.355 20.31 95-99 24.07 28.105000000000004 26.979999999999997 20.845 100-104 24.255 28.025 27.139999999999997 20.580000000000002 105-109 23.745 27.915 27.72 20.62 110-114 23.580000000000002 28.21 27.215 20.995 115-119 23.86 27.51 27.85 20.78 120-124 24.26 27.465 27.405 20.87 125-129 24.445 27.765 27.38 20.41 130-134 23.880000000000003 28.165000000000003 27.12 20.835 135-139 24.48 27.525 27.22 20.775 140-144 23.93 28.235 27.46 20.375 145-149 24.57 27.705000000000002 27.51 20.215 150-151 24.875 27.500000000000004 26.8 20.825 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.5 20 2.0 21 2.5 22 2.5 23 2.0 24 2.0 25 2.5 26 2.5 27 4.0 28 6.5 29 8.0 30 9.5 31 13.0 32 19.5 33 25.0 34 36.5 35 47.0 36 58.0 37 89.5 38 114.0 39 133.5 40 182.5 41 230.0 42 258.0 43 281.5 44 286.0 45 294.5 46 293.5 47 270.0 48 241.5 49 209.5 50 181.5 51 146.0 52 121.0 53 102.5 54 76.0 55 56.5 56 43.0 57 31.0 58 21.5 59 20.0 60 19.5 61 12.0 62 9.0 63 7.5 64 4.5 65 5.5 66 4.5 67 2.0 68 2.5 69 1.5 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.28500000000000003 40-44 0.6 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74924774322969 99.45 2 0.22567703109327986 0.44999999999999996 3 0.0 0.0 4 0.025075225677031094 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1125 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.16249999999999998 0.0 0.0 0.0 0.0 102-103 0.2625 0.0 0.0 0.0 0.0 104-105 0.3375 0.0 0.0 0.0 0.0 106-107 0.4 0.0 0.0 0.0 0.0 108-109 0.5249999999999999 0.0 0.0 0.0 0.0 110-111 0.5874999999999999 0.0 0.0 0.0 0.0 112-113 0.7250000000000001 0.0 0.0 0.0 0.0 114-115 0.825 0.0 0.0 0.0 0.0 116-117 0.9 0.0 0.0 0.0 0.0 118-119 0.975 0.0 0.0 0.0 0.0 120-121 1.2000000000000002 0.0 0.0 0.0 0.0 122-123 1.275 0.0 0.0 0.0 0.0 124-125 1.5125000000000002 0.0 0.0 0.0 0.0 126-127 1.75 0.0 0.0 0.0 0.0 128-129 1.825 0.0 0.0 0.0 0.0 130-131 2.0625 0.0 0.0 0.0 0.0 132-133 2.4125 0.0 0.0 0.0 0.0 134-135 2.7249999999999996 0.0 0.0 0.0 0.0 136-137 3.075 0.0 0.0 0.0 0.0 138-139 3.2750000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGATGTT 10 0.0068537686 144.8375 4 AAAAAAA 20 0.005967722 28.9675 90-94 >>END_MODULE Read 487142 spots for SRR7171865.sra Written 487142 spots for SRR7171865.sra Read 487142 spots for SRR7171865.sra Written 487142 spots for SRR7171865.sra Read 487142 spots for SRR7171865.sra Written 487142 spots for SRR7171865.sra Read 487142 spots for SRR7171865.sra Written 487142 spots for SRR7171865.sra Read 487157 spots for SRR7171865.sra Written 487157 spots for SRR7171865.sra Read 487142 spots for SRR7171865.sra Written 487142 spots for SRR7171865.sra Read 487142 spots for SRR7171865.sra Written 487142 spots for SRR7171865.sra Read 487142 spots for SRR7171865.sra Written 487142 spots for SRR7171865.sra Read 487142 spots for SRR7171865.sra Written 487142 spots for SRR7171865.sra Read 487142 spots for SRR7171865.sra Written 487142 spots for SRR7171865.sra Read 487142 spots for SRR7171865.sra Written 487142 spots for SRR7171865.sra Read 487142 spots for SRR7171865.sra Written 487142 spots for SRR7171865.sra Read 487142 spots for SRR7171865.sra Written 487142 spots for SRR7171865.sra Read 487142 spots for SRR7171865.sra Written 487142 spots for SRR7171865.sra Read 487142 spots for SRR7171865.sra Written 487142 spots for SRR7171865.sra Read 487142 spots for SRR7171865.sra Written 487142 spots for SRR7171865.sra Read 487142 spots for SRR7171865.sra Written 487142 spots for SRR7171865.sra Read 487142 spots for SRR7171865.sra Written 487142 spots for SRR7171865.sra Read 487142 spots for SRR7171865.sra Written 487142 spots for SRR7171865.sra Read 487142 spots for SRR7171865.sra Written 487142 spots for SRR7171865.sra SRR ids: ['SRR7171865.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2fn45srq SRR7171865.sra spots: 9742855 blocks: [[1, 487142], [487143, 974284], [974285, 1461426], [1461427, 1948568], [1948569, 2435710], [2435711, 2922852], [2922853, 3409994], [3409995, 3897136], [3897137, 4384278], [4384279, 4871420], [4871421, 5358562], [5358563, 5845704], [5845705, 6332846], [6332847, 6819988], [6819989, 7307130], [7307131, 7794272], [7794273, 8281414], [8281415, 8768556], [8768557, 9255698], [9255699, 9742855]] SRR7171865 file size 3280335 SRR7171865 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171865 SRR7171865_1.fastq SRR7171865_2.fastq Input file: SRR7171865_1.fastq Paired file: SRR7171865_2.fastq trimmed: SRR7171865-trimmed-pair1.fastq, SRR7171865-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 21:52:35 2025 >> started Thu Feb 13 21:52:46 2025 >> done (10.725s) 9742855 read pairs processed; of these: 13560 ( 0.14%) short read pairs filtered out after trimming by size control 11082 ( 0.11%) empty read pairs filtered out after trimming by size control 9718213 (99.75%) read pairs available; of these: 3914083 (40.28%) trimmed read pairs available after processing 5804130 (59.72%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 3 0.00% 21 3 0.00% 22 5 0.00% 23 3 0.00% 24 4 0.00% 25 0 0.00% 26 5 0.00% 27 4 0.00% 28 6 0.00% 29 10 0.00% 30 5 0.00% 31 4 0.00% 32 1 0.00% 33 6 0.00% 34 2 0.00% 35 3 0.00% 36 4 0.00% 37 6 0.00% 38 7 0.00% 39 6 0.00% 40 6 0.00% 41 5 0.00% 42 7 0.00% 43 8 0.00% 44 12 0.00% 45 7 0.00% 46 7 0.00% 47 18 0.00% 48 18 0.00% 49 17 0.00% 50 22 0.00% 51 20 0.00% 52 27 0.00% 53 28 0.00% 54 27 0.00% 55 22 0.00% 56 28 0.00% 57 31 0.00% 58 54 0.00% 59 49 0.00% 60 45 0.00% 61 49 0.00% 62 54 0.00% 63 68 0.00% 64 75 0.00% 65 86 0.00% 66 86 0.00% 67 109 0.00% 68 95 0.00% 69 107 0.00% 70 133 0.00% 71 139 0.00% 72 187 0.00% 73 194 0.00% 74 216 0.00% 75 292 0.00% 76 466 0.00% 77 346 0.00% 78 359 0.00% 79 388 0.00% 80 465 0.00% 81 517 0.01% 82 536 0.01% 83 703 0.01% 84 1295 0.01% 85 1721 0.02% 86 1783 0.02% 87 2145 0.02% 88 2051 0.02% 89 2063 0.02% 90 2197 0.02% 91 2173 0.02% 92 2310 0.02% 93 2431 0.03% 94 2535 0.03% 95 2828 0.03% 96 2815 0.03% 97 3025 0.03% 98 3225 0.03% 99 3458 0.04% 100 3576 0.04% 101 3906 0.04% 102 4024 0.04% 103 4312 0.04% 104 4642 0.05% 105 5012 0.05% 106 5210 0.05% 107 5649 0.06% 108 5889 0.06% 109 6123 0.06% 110 6460 0.07% 111 6928 0.07% 112 7178 0.07% 113 7772 0.08% 114 8100 0.08% 115 8471 0.09% 116 9139 0.09% 117 9478 0.10% 118 10117 0.10% 119 10360 0.11% 120 10697 0.11% 121 11455 0.12% 122 11874 0.12% 123 12275 0.13% 124 12962 0.13% 125 13709 0.14% 126 14275 0.15% 127 15060 0.15% 128 15861 0.16% 129 16717 0.17% 130 17583 0.18% 131 18484 0.19% 132 19404 0.20% 133 20764 0.21% 134 21720 0.22% 135 23572 0.24% 136 25150 0.26% 137 27104 0.28% 138 28869 0.30% 139 31474 0.32% 140 34339 0.35% 141 38512 0.40% 142 43335 0.45% 143 49434 0.51% 144 58189 0.60% 145 70463 0.73% 146 89876 0.92% 147 125963 1.30% 148 199632 2.05% 149 419996 4.32% 150 2238718 23.04% 151 5804130 59.72% 9718213 reads passed initial QC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=5.39 fanout-score-rank=21 prefix-density=0.59 prefix-fanout=3.2 sequence=TTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGT criterion=fanout-score sequence-density=0.09 sequence-density-rank=24 fanout-score=326.11 fanout-score-rank=1 prefix-density=1.00 prefix-fanout=27.8 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=2.20 fanout-score-rank=37 prefix-density=0.39 prefix-fanout=2.1 sequence=GGCAGTGGCTGCAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=250.48 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=10.6 sequence=TTTCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAG SRR7171865 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 21:53:36 Started mapping on | Feb 13 21:53:36 Finished on | Feb 13 21:55:07 Mapping speed, Million of reads per hour | 384.46 Number of input reads | 9718213 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 8938610 Uniquely mapped reads % | 91.98% Average mapped length | 296.80 Number of splices: Total | 8837523 Number of splices: Annotated (sjdb) | 8665670 Number of splices: GT/AG | 8689541 Number of splices: GC/AG | 113697 Number of splices: AT/AC | 7432 Number of splices: Non-canonical | 26853 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.04% Deletion average length | 2.75 Insertion rate per base | 0.02% Insertion average length | 2.60 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 256385 % of reads mapped to multiple loci | 2.64% Number of reads mapped to too many loci | 30836 % of reads mapped to too many loci | 0.32% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.98% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 535836 535836 535836 N_multimapping 256385 256385 256385 N_noFeature 210286 8859101 240156 N_ambiguous 99277 478 49417 UnstrandedReadsAssigned:8629047 PositiveStrandReadsAssigned:79031 NegativeStrandReadsAssigned:8649037 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7171865 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171865-trimmed-pair1.fastq SRR7171865-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,718,213 reads, 8,573,677 reads pseudoaligned [quant] estimated average fragment length: 255.289 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,048 rounds 52401 SRR7171865.ke.tsv 34699 SRR7171865.se.tsv 87100 total ==> SRR7171865.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1763.71 506 28.5495 Potri.005G024800.1.v4.1 1035 780.711 204 26.0025 Potri.004G059700.1.v4.1 961 706.732 21 2.95693 Potri.007G009000.2.v4.1 1416 1161.71 0 0 Potri.003G141000.2.v4.1 2943 2688.71 214 7.92037 Potri.016G087400.1.v4.1 270 67.1264 685 1015.48 Potri.015G069301.1.v4.1 564 312.871 0 0 Potri.010G195200.1.v4.1 1773 1518.71 191 12.5151 Potri.012G127500.1.v4.1 977 722.722 5988 824.493 ==> SRR7171865.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 26 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 247 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 174 SRR7171865 completed mapping pipeline successfully