Starting /dee2/code/volunteer_pipeline.sh SRR7171867 current disk space = 3088594112512 free memory = 1580192660 SRR7171867 SRAfilesize 844d831b5ebc237b9b7f36676cdde353 SRR7171867.sra SRR7171867.sra file validated SRR7171867 is paired end SRR7171867 is conventional basespace SRR7171867 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171867_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.698 33.0 33.0 34.0 32.0 34.0 2 33.06025 34.0 33.0 34.0 31.0 34.0 3 32.34725 33.0 32.0 33.0 31.0 34.0 4 32.60525 33.0 33.0 33.0 31.0 34.0 5 32.49225 33.0 33.0 33.0 32.0 34.0 6 35.43775 37.0 35.0 38.0 31.0 38.0 7 37.075 38.0 37.0 38.0 35.0 38.0 8 37.38375 38.0 38.0 38.0 36.0 38.0 9 37.57125 38.0 38.0 38.0 37.0 38.0 10-14 37.5299 38.0 38.0 38.0 37.6 38.0 15-19 37.53895 38.0 38.0 38.0 37.8 38.0 20-24 37.5496 38.0 38.0 38.0 37.4 38.0 25-29 37.50205 38.0 38.0 38.0 37.4 38.0 30-34 37.4667 38.0 38.0 38.0 37.2 38.0 35-39 37.50665 38.0 38.0 38.0 37.2 38.0 40-44 37.41865 38.0 38.0 38.0 37.0 38.0 45-49 37.41895 38.0 38.0 38.0 37.0 38.0 50-54 37.40065 38.0 38.0 38.0 37.0 38.0 55-59 37.325149999999994 38.0 38.0 38.0 36.8 38.0 60-64 37.2316 38.0 38.0 38.0 36.2 38.0 65-69 37.19805 38.0 38.0 38.0 36.0 38.0 70-74 37.165499999999994 38.0 38.0 38.0 36.0 38.0 75-79 37.1121 38.0 38.0 38.0 36.0 38.0 80-84 37.043 38.0 38.0 38.0 36.0 38.0 85-89 36.9501 38.0 38.0 38.0 35.6 38.0 90-94 36.877250000000004 38.0 38.0 38.0 35.0 38.0 95-99 36.76365 38.0 38.0 38.0 34.8 38.0 100-104 36.660000000000004 38.0 38.0 38.0 34.2 38.0 105-109 36.61955 38.0 38.0 38.0 34.0 38.0 110-114 36.45765 38.0 38.0 38.0 34.0 38.0 115-119 36.23205 38.0 37.2 38.0 33.6 38.0 120-124 36.099650000000004 38.0 37.2 38.0 33.2 38.0 125-129 35.9609 38.0 37.0 38.0 33.0 38.0 130-134 35.68055 38.0 36.0 38.0 31.0 38.0 135-139 35.321749999999994 38.0 36.0 38.0 30.4 38.0 140-144 35.1376 38.0 35.6 38.0 29.0 38.0 145-149 34.668549999999996 38.0 35.0 38.0 28.0 38.0 150-151 31.622999999999998 36.5 31.5 38.0 13.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 0.0 14 1.0 15 0.0 16 2.0 17 2.0 18 1.0 19 3.0 20 4.0 21 4.0 22 2.0 23 4.0 24 6.0 25 6.0 26 4.0 27 19.0 28 12.0 29 24.0 30 28.0 31 42.0 32 52.0 33 75.0 34 153.0 35 248.0 36 757.0 37 2550.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.90897724431108 14.078519629907477 11.827956989247312 38.18454613653413 2 21.0 20.375 35.075 23.549999999999997 3 20.95 23.925 24.625 30.5 4 22.425 34.2 21.625 21.75 5 21.475 35.875 23.200000000000003 19.45 6 17.875 37.974999999999994 24.375 19.775000000000002 7 13.175 22.675 44.6 19.55 8 17.849999999999998 22.2 30.5 29.45 9 18.0 24.325 31.374999999999996 26.3 10-14 19.62 29.075 27.365000000000002 23.94 15-19 20.68 28.4 27.725 23.195 20-24 19.68 28.389999999999997 27.634999999999998 24.295 25-29 20.465 28.685 27.36 23.49 30-34 20.119999999999997 28.27 27.88 23.73 35-39 19.98 28.18 27.805000000000003 24.035 40-44 20.315 27.99 27.860000000000003 23.835 45-49 20.11 28.13 27.894999999999996 23.865 50-54 20.445 27.72 28.33 23.505000000000003 55-59 20.22 28.365000000000002 27.735 23.68 60-64 20.39 28.000000000000004 27.735 23.875 65-69 20.39 27.839999999999996 28.13 23.64 70-74 20.66 27.794999999999998 27.750000000000004 23.794999999999998 75-79 20.365 28.455000000000002 27.689999999999998 23.49 80-84 20.669999999999998 28.125 27.51 23.695 85-89 20.605 27.794999999999998 27.725 23.875 90-94 20.385 27.985 27.800000000000004 23.830000000000002 95-99 20.77 28.265 27.63 23.335 100-104 21.060000000000002 28.360000000000003 26.640000000000004 23.94 105-109 20.53 28.060000000000002 27.61 23.799999999999997 110-114 20.674999999999997 27.889999999999997 27.715 23.72 115-119 20.669999999999998 27.800000000000004 27.615000000000002 23.915 120-124 20.745 27.805000000000003 27.155 24.295 125-129 20.435 28.015 27.584999999999997 23.965 130-134 20.685000000000002 27.465 27.639999999999997 24.21 135-139 20.645 27.82 27.74 23.794999999999998 140-144 21.41 27.485 27.205000000000002 23.9 145-149 20.875 27.665 27.755000000000003 23.705000000000002 150-151 21.7375 27.750000000000004 27.450000000000003 23.0625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 1.0 22 1.0 23 1.0 24 1.0 25 2.5 26 4.5 27 4.5 28 5.0 29 10.5 30 15.0 31 20.0 32 32.0 33 42.0 34 55.0 35 66.0 36 72.5 37 87.0 38 120.5 39 164.5 40 190.0 41 227.0 42 259.5 43 263.0 44 269.5 45 265.5 46 266.5 47 271.5 48 242.5 49 217.5 50 188.0 51 148.0 52 120.0 53 93.0 54 67.0 55 45.5 56 39.0 57 34.5 58 26.5 59 17.0 60 10.0 61 7.0 62 7.0 63 5.5 64 2.5 65 2.5 66 2.5 67 2.5 68 1.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87481221832749 99.725 2 0.10015022533800699 0.2 3 0.025037556334501748 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.11249999999999999 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.2625 0.0 0.0 0.0 0.0 100-101 0.375 0.0 0.0 0.0 0.0 102-103 0.425 0.0 0.0 0.0 0.0 104-105 0.425 0.0 0.0 0.0 0.0 106-107 0.4875 0.0 0.0 0.0 0.0 108-109 0.5375 0.0 0.0 0.0 0.0 110-111 0.675 0.0 0.0 0.0 0.0 112-113 0.7625 0.0 0.0 0.0 0.0 114-115 0.875 0.0 0.0 0.0 0.0 116-117 1.0125 0.0 0.0 0.0 0.0 118-119 1.1124999999999998 0.0 0.0 0.0 0.0 120-121 1.2625 0.0 0.0 0.0 0.0 122-123 1.2875 0.0 0.0 0.0 0.0 124-125 1.3875 0.0 0.0 0.0 0.0 126-127 1.6124999999999998 0.0 0.0 0.0 0.0 128-129 1.775 0.0 0.0 0.0 0.0 130-131 1.9874999999999998 0.0 0.0 0.0 0.0 132-133 2.1500000000000004 0.0 0.0 0.0 0.0 134-135 2.4625000000000004 0.0 0.0 0.0 0.0 136-137 2.8125 0.0 0.0 0.0 0.0 138-139 3.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7171867 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171867_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.94825 33.0 33.0 34.0 32.0 34.0 2 33.055 34.0 33.0 34.0 32.0 34.0 3 33.09425 34.0 33.0 34.0 32.0 34.0 4 33.094 34.0 33.0 34.0 32.0 34.0 5 33.07375 34.0 33.0 34.0 33.0 34.0 6 37.1815 38.0 38.0 38.0 37.0 38.0 7 37.3085 38.0 38.0 38.0 37.0 38.0 8 37.25425 38.0 38.0 38.0 37.0 38.0 9 37.2625 38.0 38.0 38.0 37.0 38.0 10-14 37.18735 38.0 38.0 38.0 36.8 38.0 15-19 37.17015 38.0 38.0 38.0 37.0 38.0 20-24 37.175850000000004 38.0 38.0 38.0 37.0 38.0 25-29 37.17785 38.0 38.0 38.0 37.0 38.0 30-34 37.10345 38.0 38.0 38.0 37.0 38.0 35-39 36.6747 38.0 38.0 38.0 36.0 38.0 40-44 36.5338 38.0 38.0 38.0 35.8 38.0 45-49 37.0388 38.0 38.0 38.0 36.0 38.0 50-54 36.996950000000005 38.0 38.0 38.0 36.2 38.0 55-59 36.95975 38.0 38.0 38.0 36.0 38.0 60-64 36.94160000000001 38.0 38.0 38.0 36.0 38.0 65-69 36.84805 38.0 38.0 38.0 36.0 38.0 70-74 36.803 38.0 38.0 38.0 35.6 38.0 75-79 36.768499999999996 38.0 38.0 38.0 35.2 38.0 80-84 36.7322 38.0 38.0 38.0 35.2 38.0 85-89 36.55745 38.0 38.0 38.0 34.6 38.0 90-94 36.4989 38.0 38.0 38.0 34.0 38.0 95-99 36.39725 38.0 38.0 38.0 34.0 38.0 100-104 36.24685 38.0 38.0 38.0 33.8 38.0 105-109 36.13625 38.0 37.6 38.0 33.4 38.0 110-114 36.05055 38.0 37.0 38.0 33.0 38.0 115-119 35.995850000000004 38.0 37.0 38.0 32.8 38.0 120-124 35.531349999999996 38.0 36.4 38.0 30.6 38.0 125-129 35.2964 38.0 36.0 38.0 30.2 38.0 130-134 35.12515 38.0 36.0 38.0 28.8 38.0 135-139 34.863350000000004 38.0 35.4 38.0 28.6 38.0 140-144 34.6351 38.0 35.0 38.0 27.4 38.0 145-149 33.971349999999994 38.0 34.6 38.0 24.2 38.0 150-151 30.300125 36.0 29.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 1.0 4 2.0 5 2.0 6 0.0 7 1.0 8 0.0 9 3.0 10 1.0 11 2.0 12 0.0 13 0.0 14 2.0 15 1.0 16 3.0 17 1.0 18 1.0 19 2.0 20 5.0 21 6.0 22 12.0 23 11.0 24 17.0 25 19.0 26 8.0 27 19.0 28 30.0 29 29.0 30 41.0 31 49.0 32 83.0 33 110.0 34 145.0 35 254.0 36 700.0 37 2437.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.05 17.825 16.375 29.75 2 24.125 24.075 35.0 16.8 3 21.45 26.5 30.5 21.55 4 24.7 34.525 21.25 19.525000000000002 5 23.849999999999998 37.175000000000004 21.2 17.775 6 19.975 37.25 23.425 19.35 7 18.8 17.849999999999998 41.175 22.175 8 20.8 22.625 27.85 28.725 9 22.55 25.424999999999997 28.475 23.549999999999997 10-14 23.64 29.015 25.805 21.54 15-19 23.16 27.93 27.750000000000004 21.16 20-24 23.01 28.215 27.46 21.315 25-29 23.155 28.360000000000003 27.27 21.215 30-34 23.09890220061156 28.247029926312095 27.44498471101308 21.209083162063262 35-39 23.577730453300884 27.877497211236186 27.5276341141872 21.017138221275733 40-44 23.308308816069797 27.635183118595926 27.53373237293294 21.52277569240134 45-49 23.18 28.275 27.425 21.12 50-54 23.64 27.935 27.245 21.18 55-59 23.145 28.79 26.855 21.21 60-64 23.195 28.155 27.650000000000002 21.0 65-69 23.724999999999998 28.575 26.935 20.765 70-74 23.97 28.215 27.355 20.46 75-79 23.21 27.665 27.71 21.415 80-84 23.16 28.53 27.0 21.310000000000002 85-89 23.665 28.34 27.189999999999998 20.805 90-94 24.095 27.52 27.700000000000003 20.685000000000002 95-99 23.885 27.74 27.295 21.08 100-104 24.03 27.88 27.405 20.685000000000002 105-109 23.835 28.01 27.07 21.085 110-114 23.875 28.375 27.07 20.68 115-119 24.15 27.589999999999996 27.345000000000002 20.915 120-124 24.104999999999997 27.85 27.1 20.945 125-129 23.98 27.715 27.71 20.595 130-134 24.085 27.99 26.810000000000002 21.115000000000002 135-139 24.505 27.975 27.145000000000003 20.375 140-144 24.5 28.335 26.995 20.169999999999998 145-149 24.565 28.249999999999996 26.83 20.355 150-151 24.275 28.1875 28.012500000000003 19.525000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 1.0 24 1.0 25 1.0 26 1.5 27 1.5 28 1.5 29 3.0 30 7.0 31 11.5 32 17.0 33 22.0 34 30.5 35 49.5 36 70.5 37 88.5 38 121.0 39 164.0 40 196.5 41 220.5 42 251.0 43 293.0 44 308.0 45 299.0 46 290.0 47 271.5 48 238.0 49 210.0 50 189.0 51 156.5 52 122.5 53 103.0 54 80.5 55 49.0 56 32.0 57 22.5 58 18.0 59 17.5 60 12.0 61 6.5 62 4.0 63 3.5 64 4.0 65 2.5 66 2.5 67 1.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.255 35-39 1.39 40-44 1.43 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.23750000000000002 0.0 0.0 0.0 0.0 100-101 0.35 0.0 0.0 0.0 0.0 102-103 0.4 0.0 0.0 0.0 0.0 104-105 0.4 0.0 0.0 0.0 0.0 106-107 0.4625 0.0 0.0 0.0 0.0 108-109 0.5125 0.0 0.0 0.0 0.0 110-111 0.6499999999999999 0.0 0.0 0.0 0.0 112-113 0.7375 0.0 0.0 0.0 0.0 114-115 0.85 0.0 0.0 0.0 0.0 116-117 0.9874999999999999 0.0 0.0 0.0 0.0 118-119 1.0875 0.0 0.0 0.0 0.0 120-121 1.275 0.0 0.0 0.0 0.0 122-123 1.3125 0.0 0.0 0.0 0.0 124-125 1.4125 0.0 0.0 0.0 0.0 126-127 1.6375000000000002 0.0 0.0 0.0 0.0 128-129 1.7625 0.0 0.0 0.0 0.0 130-131 1.975 0.0 0.0 0.0 0.0 132-133 2.125 0.0 0.0 0.0 0.0 134-135 2.425 0.0 0.0 0.0 0.0 136-137 2.7625 0.0 0.0 0.0 0.0 138-139 3.0125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATCCAG 10 0.0068484643 144.875 5 CATTTGG 20 0.0059601753 28.975002 100-104 >>END_MODULE Read 763227 spots for SRR7171867.sra Written 763227 spots for SRR7171867.sra Read 763227 spots for SRR7171867.sra Written 763227 spots for SRR7171867.sra Read 763227 spots for SRR7171867.sra Written 763227 spots for SRR7171867.sra Read 763227 spots for SRR7171867.sra Written 763227 spots for SRR7171867.sra Read 763227 spots for SRR7171867.sra Written 763227 spots for SRR7171867.sra Read 763227 spots for SRR7171867.sra Written 763227 spots for SRR7171867.sra Read 763227 spots for SRR7171867.sra Written 763227 spots for SRR7171867.sra Read 763227 spots for SRR7171867.sra Written 763227 spots for SRR7171867.sra Read 763227 spots for SRR7171867.sra Written 763227 spots for SRR7171867.sra Read 763227 spots for SRR7171867.sra Written 763227 spots for SRR7171867.sra Read 763227 spots for SRR7171867.sra Written 763227 spots for SRR7171867.sra Read 763227 spots for SRR7171867.sra Written 763227 spots for SRR7171867.sra Read 763227 spots for SRR7171867.sra Written 763227 spots for SRR7171867.sra Read 763233 spots for SRR7171867.sra Written 763233 spots for SRR7171867.sra Read 763227 spots for SRR7171867.sra Written 763227 spots for SRR7171867.sra Read 763227 spots for SRR7171867.sra Written 763227 spots for SRR7171867.sra Read 763227 spots for SRR7171867.sra Written 763227 spots for SRR7171867.sra Read 763227 spots for SRR7171867.sra Written 763227 spots for SRR7171867.sra Read 763227 spots for SRR7171867.sra Written 763227 spots for SRR7171867.sra Read 763227 spots for SRR7171867.sra Written 763227 spots for SRR7171867.sra SRR ids: ['SRR7171867.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_plkt1m7j SRR7171867.sra spots: 15264546 blocks: [[1, 763227], [763228, 1526454], [1526455, 2289681], [2289682, 3052908], [3052909, 3816135], [3816136, 4579362], [4579363, 5342589], [5342590, 6105816], [6105817, 6869043], [6869044, 7632270], [7632271, 8395497], [8395498, 9158724], [9158725, 9921951], [9921952, 10685178], [10685179, 11448405], [11448406, 12211632], [12211633, 12974859], [12974860, 13738086], [13738087, 14501313], [14501314, 15264546]] SRR7171867 file size 5150953 SRR7171867 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171867 SRR7171867_1.fastq SRR7171867_2.fastq Input file: SRR7171867_1.fastq Paired file: SRR7171867_2.fastq trimmed: SRR7171867-trimmed-pair1.fastq, SRR7171867-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 22:15:19 2025 >> started Thu Feb 13 22:15:37 2025 >> done (17.459s) 15264546 read pairs processed; of these: 10368 ( 0.07%) short read pairs filtered out after trimming by size control 6282 ( 0.04%) empty read pairs filtered out after trimming by size control 15247896 (99.89%) read pairs available; of these: 6187740 (40.58%) trimmed read pairs available after processing 9060156 (59.42%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 1 0.00% 20 2 0.00% 21 1 0.00% 22 4 0.00% 23 4 0.00% 24 1 0.00% 25 4 0.00% 26 4 0.00% 27 1 0.00% 28 4 0.00% 29 3 0.00% 30 5 0.00% 31 5 0.00% 32 4 0.00% 33 2 0.00% 34 2 0.00% 35 3 0.00% 36 5 0.00% 37 5 0.00% 38 4 0.00% 39 3 0.00% 40 6 0.00% 41 6 0.00% 42 6 0.00% 43 6 0.00% 44 9 0.00% 45 6 0.00% 46 11 0.00% 47 6 0.00% 48 4 0.00% 49 14 0.00% 50 17 0.00% 51 14 0.00% 52 17 0.00% 53 22 0.00% 54 20 0.00% 55 39 0.00% 56 24 0.00% 57 42 0.00% 58 37 0.00% 59 41 0.00% 60 49 0.00% 61 67 0.00% 62 72 0.00% 63 82 0.00% 64 84 0.00% 65 84 0.00% 66 120 0.00% 67 122 0.00% 68 142 0.00% 69 165 0.00% 70 195 0.00% 71 208 0.00% 72 211 0.00% 73 306 0.00% 74 340 0.00% 75 378 0.00% 76 467 0.00% 77 507 0.00% 78 592 0.00% 79 682 0.00% 80 700 0.00% 81 875 0.01% 82 920 0.01% 83 1127 0.01% 84 1676 0.01% 85 2162 0.01% 86 2252 0.01% 87 2608 0.02% 88 2695 0.02% 89 2852 0.02% 90 3055 0.02% 91 3321 0.02% 92 3471 0.02% 93 3895 0.03% 94 4121 0.03% 95 4469 0.03% 96 4663 0.03% 97 4831 0.03% 98 5294 0.03% 99 5631 0.04% 100 6000 0.04% 101 6492 0.04% 102 6856 0.04% 103 7497 0.05% 104 7931 0.05% 105 8506 0.06% 106 8961 0.06% 107 9388 0.06% 108 9991 0.07% 109 10373 0.07% 110 11163 0.07% 111 11565 0.08% 112 12289 0.08% 113 13121 0.09% 114 14180 0.09% 115 14775 0.10% 116 15372 0.10% 117 16254 0.11% 118 16954 0.11% 119 17414 0.11% 120 18203 0.12% 121 19028 0.12% 122 20128 0.13% 123 21344 0.14% 124 22350 0.15% 125 23358 0.15% 126 24667 0.16% 127 25820 0.17% 128 27136 0.18% 129 28329 0.19% 130 29962 0.20% 131 31663 0.21% 132 33430 0.22% 133 35545 0.23% 134 37439 0.25% 135 39854 0.26% 136 42522 0.28% 137 45713 0.30% 138 49683 0.33% 139 53200 0.35% 140 57381 0.38% 141 63593 0.42% 142 70619 0.46% 143 81113 0.53% 144 94665 0.62% 145 114601 0.75% 146 145649 0.96% 147 202898 1.33% 148 321590 2.11% 149 661423 4.34% 150 3453843 22.65% 151 9060156 59.42% 15247896 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=5.61 fanout-score-rank=17 prefix-density=0.46 prefix-fanout=3.2 sequence=TTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGT criterion=fanout-score sequence-density=0.09 sequence-density-rank=17 fanout-score=376.11 fanout-score-rank=1 prefix-density=0.95 prefix-fanout=35.4 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=2.25 fanout-score-rank=35 prefix-density=0.33 prefix-fanout=2.2 sequence=GGCAGTGGCTGCAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=174.76 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=9.9 sequence=AAAAATGGCGACTCCAATGAAGTACATTTGCTTGTTTATGTTTCTTGCAATTCTCAGCATTGCTGGGCTCAATCAAGTTGACGGGGCTGGTGAATGTGGGAAAAACACCACTCCTGACATGGAGGCTTTCAAGATGGCTCCTTGTGCATCAGCAGCACAGGATGAGAATTCTTCAGTTTCGAGCCAGTGCTGCGCTCGGGTGAAGAAAATTGGACAGAACCCAGCGTGCCTTTGTGCTGTTATGCTTTCCAACACTGCTAAGAGCTCTGGAATCAAGCCAGAAATTGCAATGACCATTCCCAAACGATGCAACATTGCTGATCGTCCTGTGGGCTACAAGTGTGGAGCTTATACTTTACCTTGAAGAGTGAAGACCATGAACTGTGCTCGCCCTGTAA SRR7171867 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 22:16:22 Started mapping on | Feb 13 22:16:22 Finished on | Feb 13 22:17:56 Mapping speed, Million of reads per hour | 583.96 Number of input reads | 15247896 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 14386565 Uniquely mapped reads % | 94.35% Average mapped length | 296.66 Number of splices: Total | 14525608 Number of splices: Annotated (sjdb) | 14267235 Number of splices: GT/AG | 14291577 Number of splices: GC/AG | 186792 Number of splices: AT/AC | 11593 Number of splices: Non-canonical | 35646 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.56 Insertion rate per base | 0.02% Insertion average length | 2.67 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 390938 % of reads mapped to multiple loci | 2.56% Number of reads mapped to too many loci | 73180 % of reads mapped to too many loci | 0.48% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.51% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 481136 481136 481136 N_multimapping 390938 390938 390938 N_noFeature 307166 14257682 368903 N_ambiguous 140673 823 73048 UnstrandedReadsAssigned:13938726 PositiveStrandReadsAssigned:128060 NegativeStrandReadsAssigned:13944614 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7171867 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171867-trimmed-pair1.fastq SRR7171867-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,247,896 reads, 13,873,280 reads pseudoaligned [quant] estimated average fragment length: 253.206 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,173 rounds 52401 SRR7171867.ke.tsv 34699 SRR7171867.se.tsv 87100 total ==> SRR7171867.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1765.79 978 37.0843 Potri.005G024800.1.v4.1 1035 782.794 268 22.9233 Potri.004G059700.1.v4.1 961 708.794 26 2.45609 Potri.007G009000.2.v4.1 1416 1163.79 0 0 Potri.003G141000.2.v4.1 2943 2690.79 392 9.75431 Potri.016G087400.1.v4.1 270 69.7814 1066 1022.84 Potri.015G069301.1.v4.1 564 315.25 0 0 Potri.010G195200.1.v4.1 1773 1520.79 303 13.3402 Potri.012G127500.1.v4.1 977 724.794 9516 879.084 ==> SRR7171867.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 54 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 352 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 123 SRR7171867 completed mapping pipeline successfully