Starting /dee2/code/volunteer_pipeline.sh SRR7171868 current disk space = 3110329372672 free memory = 1577868664 SRR7171868 SRAfilesize 3ae1c6954a633276b61adda7ade48107 SRR7171868.sra SRR7171868.sra file validated SRR7171868 is paired end SRR7171868 is conventional basespace SRR7171868 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171868_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.3545 31.0 18.0 33.0 18.0 33.0 2 31.99275 33.0 31.0 33.0 29.0 34.0 3 31.806 33.0 31.0 33.0 29.0 33.0 4 32.41775 33.0 33.0 33.0 32.0 34.0 5 32.86025 33.0 33.0 34.0 32.0 34.0 6 36.1595 38.0 36.0 38.0 33.0 38.0 7 37.1525 38.0 38.0 38.0 36.0 38.0 8 37.49375 38.0 38.0 38.0 37.0 38.0 9 37.68075 38.0 38.0 38.0 38.0 38.0 10-14 37.65205 38.0 38.0 38.0 38.0 38.0 15-19 37.605450000000005 38.0 38.0 38.0 38.0 38.0 20-24 37.61825 38.0 38.0 38.0 38.0 38.0 25-29 37.5968 38.0 38.0 38.0 38.0 38.0 30-34 37.568799999999996 38.0 38.0 38.0 38.0 38.0 35-39 37.48780000000001 38.0 38.0 38.0 38.0 38.0 40-44 37.489200000000004 38.0 38.0 38.0 38.0 38.0 45-49 37.424 38.0 38.0 38.0 37.4 38.0 50-54 37.3648 38.0 38.0 38.0 37.0 38.0 55-59 37.298 38.0 38.0 38.0 37.0 38.0 60-64 37.262499999999996 38.0 38.0 38.0 37.0 38.0 65-69 37.23005 38.0 38.0 38.0 36.6 38.0 70-74 37.18925 38.0 38.0 38.0 36.2 38.0 75-79 37.142700000000005 38.0 38.0 38.0 36.0 38.0 80-84 37.08995 38.0 38.0 38.0 36.0 38.0 85-89 36.998000000000005 38.0 38.0 38.0 36.0 38.0 90-94 36.8976 38.0 38.0 38.0 35.8 38.0 95-99 36.8597 38.0 38.0 38.0 35.4 38.0 100-104 36.73675 38.0 38.0 38.0 35.0 38.0 105-109 36.6144 38.0 38.0 38.0 34.8 38.0 110-114 36.4011 38.0 38.0 38.0 34.0 38.0 115-119 36.292649999999995 38.0 38.0 38.0 34.0 38.0 120-124 36.15604999999999 38.0 37.8 38.0 33.6 38.0 125-129 35.89315 38.0 37.0 38.0 33.0 38.0 130-134 35.84505 38.0 36.8 38.0 32.8 38.0 135-139 35.42095 38.0 36.0 38.0 31.0 38.0 140-144 35.126400000000004 38.0 36.0 38.0 29.6 38.0 145-149 34.702099999999994 38.0 35.2 38.0 28.2 38.0 150-151 31.711750000000002 36.5 31.5 38.0 14.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 1.0 10 2.0 11 2.0 12 0.0 13 1.0 14 1.0 15 0.0 16 0.0 17 1.0 18 3.0 19 5.0 20 7.0 21 3.0 22 1.0 23 5.0 24 5.0 25 10.0 26 13.0 27 14.0 28 21.0 29 16.0 30 26.0 31 39.0 32 46.0 33 72.0 34 113.0 35 224.0 36 646.0 37 2722.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.75 13.225000000000001 12.625 33.4 2 19.36452339254441 18.563922942206652 35.95196397297973 26.1195896922692 3 19.6 25.124999999999996 26.575 28.7 4 21.825 32.4 22.825 22.95 5 20.75 36.05 23.974999999999998 19.225 6 18.35 35.625 26.424999999999997 19.6 7 12.975 27.575 41.625 17.825 8 16.075 25.5 31.85 26.575 9 17.575 25.474999999999998 32.375 24.575 10-14 19.115 31.225 27.589999999999996 22.07 15-19 19.075 30.475 27.250000000000004 23.200000000000003 20-24 19.39 30.15 27.375 23.085 25-29 19.28 29.87 27.49 23.36 30-34 19.735 30.69 26.845000000000002 22.73 35-39 20.044999999999998 29.765000000000004 27.36 22.830000000000002 40-44 20.14 29.815 26.85 23.195 45-49 19.55 30.0 27.54 22.91 50-54 19.49 29.635 27.125 23.75 55-59 19.040000000000003 29.845 27.725 23.39 60-64 19.759999999999998 30.04 27.46 22.74 65-69 20.169999999999998 29.520000000000003 27.525 22.785 70-74 20.02 29.385 27.02 23.575 75-79 20.01 29.345 27.24 23.405 80-84 19.93 29.515 26.85 23.705000000000002 85-89 19.919999999999998 29.080000000000002 27.474999999999998 23.525 90-94 20.150000000000002 28.360000000000003 27.445000000000004 24.044999999999998 95-99 19.665 28.84 27.944999999999997 23.549999999999997 100-104 20.205000000000002 29.115000000000002 27.405 23.275000000000002 105-109 20.47 28.634999999999998 26.85 24.044999999999998 110-114 20.435 28.7 27.284999999999997 23.580000000000002 115-119 20.34 28.925 27.034999999999997 23.7 120-124 20.225 28.134999999999998 27.505000000000003 24.135 125-129 20.515 28.04 27.650000000000002 23.794999999999998 130-134 20.52 28.605000000000004 27.229999999999997 23.645 135-139 20.72 28.799999999999997 26.450000000000003 24.03 140-144 20.9 28.389999999999997 26.965 23.745 145-149 20.985 28.38 27.029999999999998 23.605 150-151 20.75 28.000000000000004 26.55 24.7 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 5.0 1 2.5 2 0.0 3 0.0 4 0.5 5 0.5 6 0.5 7 1.0 8 0.5 9 0.5 10 0.5 11 0.0 12 0.5 13 1.0 14 0.5 15 1.0 16 1.5 17 0.5 18 0.0 19 1.5 20 3.0 21 2.0 22 1.0 23 2.5 24 6.0 25 9.0 26 7.5 27 13.0 28 22.0 29 26.5 30 34.5 31 44.0 32 60.5 33 71.5 34 90.0 35 106.5 36 108.5 37 111.0 38 124.0 39 166.0 40 187.0 41 206.5 42 239.5 43 252.5 44 254.0 45 243.5 46 230.5 47 219.5 48 197.0 49 182.0 50 160.0 51 128.5 52 100.0 53 80.0 54 73.5 55 56.5 56 39.5 57 28.0 58 22.5 59 16.5 60 12.0 61 11.0 62 8.5 63 4.5 64 6.0 65 7.0 66 4.5 67 2.5 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74931060416145 99.47500000000001 2 0.22562045625470042 0.44999999999999996 3 0.0250689395838556 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0125 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.0875 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.3125 0.0 0.0 0.0 0.0 104-105 0.4625 0.0 0.0 0.0 0.0 106-107 0.5875 0.0 0.0 0.0 0.0 108-109 0.875 0.0 0.0 0.0 0.0 110-111 0.9875 0.0 0.0 0.0 0.0 112-113 1.0625 0.0 0.0 0.0 0.0 114-115 1.2000000000000002 0.0 0.0 0.0 0.0 116-117 1.3125 0.0 0.0 0.0 0.0 118-119 1.5125000000000002 0.0 0.0 0.0 0.0 120-121 1.675 0.0 0.0 0.0 0.0 122-123 1.7875 0.0 0.0 0.0 0.0 124-125 1.9125 0.0 0.0 0.0 0.0 126-127 2.125 0.0 0.0 0.0 0.0 128-129 2.425 0.0 0.0 0.0 0.0 130-131 2.6125 0.0 0.0 0.0 0.0 132-133 2.8625 0.0 0.0 0.0 0.0 134-135 3.15 0.0 0.0 0.0 0.0 136-137 3.625 0.0 0.0 0.0 0.0 138-139 4.0125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7171868 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171868_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.1085 34.0 33.0 34.0 33.0 34.0 2 33.15825 34.0 33.0 34.0 33.0 34.0 3 33.13975 34.0 33.0 34.0 33.0 34.0 4 33.12575 34.0 33.0 34.0 33.0 34.0 5 33.12425 34.0 33.0 34.0 33.0 34.0 6 37.302 38.0 38.0 38.0 38.0 38.0 7 37.2875 38.0 38.0 38.0 38.0 38.0 8 37.29575 38.0 38.0 38.0 38.0 38.0 9 37.28225 38.0 38.0 38.0 38.0 38.0 10-14 37.25655 38.0 38.0 38.0 38.0 38.0 15-19 37.205499999999994 38.0 38.0 38.0 38.0 38.0 20-24 37.17035 38.0 38.0 38.0 38.0 38.0 25-29 37.16875 38.0 38.0 38.0 37.6 38.0 30-34 37.13725 38.0 38.0 38.0 37.6 38.0 35-39 36.955349999999996 38.0 38.0 38.0 37.2 38.0 40-44 36.718900000000005 38.0 38.0 38.0 37.0 38.0 45-49 37.0495 38.0 38.0 38.0 37.0 38.0 50-54 37.0193 38.0 38.0 38.0 37.0 38.0 55-59 37.05920000000001 38.0 38.0 38.0 37.0 38.0 60-64 36.99375 38.0 38.0 38.0 37.0 38.0 65-69 36.96509999999999 38.0 38.0 38.0 36.8 38.0 70-74 36.88589999999999 38.0 38.0 38.0 36.6 38.0 75-79 36.89355 38.0 38.0 38.0 36.4 38.0 80-84 36.831999999999994 38.0 38.0 38.0 36.2 38.0 85-89 36.74495 38.0 38.0 38.0 36.0 38.0 90-94 36.6053 38.0 38.0 38.0 35.6 38.0 95-99 36.5053 38.0 38.0 38.0 35.2 38.0 100-104 36.49685 38.0 38.0 38.0 35.0 38.0 105-109 36.307950000000005 38.0 38.0 38.0 34.0 38.0 110-114 36.238800000000005 38.0 38.0 38.0 34.0 38.0 115-119 36.156 38.0 38.0 38.0 34.0 38.0 120-124 36.0185 38.0 38.0 38.0 33.8 38.0 125-129 35.79615 38.0 38.0 38.0 33.0 38.0 130-134 35.58514999999999 38.0 37.0 38.0 32.4 38.0 135-139 35.367650000000005 38.0 36.4 38.0 32.2 38.0 140-144 34.906 38.0 36.0 38.0 29.2 38.0 145-149 34.570049999999995 38.0 36.0 38.0 28.6 38.0 150-151 31.054875000000003 35.5 31.0 38.0 14.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 16.0 3 6.0 4 7.0 5 4.0 6 1.0 7 2.0 8 1.0 9 0.0 10 1.0 11 1.0 12 1.0 13 1.0 14 2.0 15 1.0 16 1.0 17 4.0 18 2.0 19 4.0 20 5.0 21 5.0 22 2.0 23 5.0 24 8.0 25 18.0 26 13.0 27 20.0 28 15.0 29 20.0 30 30.0 31 24.0 32 62.0 33 75.0 34 95.0 35 178.0 36 449.0 37 2921.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.199999999999996 15.925 17.125 24.75 2 24.8 24.15 30.825000000000003 20.225 3 20.974999999999998 28.349999999999998 29.325000000000003 21.349999999999998 4 26.1 33.425 21.3 19.175 5 25.0 35.175 22.05 17.775 6 19.900000000000002 35.425000000000004 25.45 19.225 7 21.525 19.025 38.4 21.05 8 22.35 24.325 26.724999999999998 26.6 9 22.400000000000002 26.400000000000002 27.875 23.325000000000003 10-14 23.935000000000002 28.525 25.88 21.66 15-19 24.295 27.41 27.675 20.62 20-24 23.625 28.084999999999997 26.995 21.295 25-29 24.15 28.43 26.810000000000002 20.61 30-34 23.945986496624155 28.342085521380344 26.716679169792446 20.99524881220305 35-39 24.3574297188755 27.429718875502008 27.178714859437754 21.03413654618474 40-44 24.207070707070706 27.727272727272727 27.03030303030303 21.035353535353536 45-49 23.735 26.779999999999998 27.939999999999998 21.545 50-54 23.794999999999998 28.125 27.495000000000005 20.585 55-59 24.425 28.065 26.905 20.605 60-64 24.755 27.305 27.075 20.865000000000002 65-69 24.279999999999998 27.46 27.334999999999997 20.925 70-74 24.195 27.35 27.6 20.855 75-79 23.75 27.950000000000003 27.36 20.94 80-84 24.08 27.644999999999996 27.495000000000005 20.78 85-89 24.375 27.634999999999998 27.77 20.22 90-94 24.25 27.35 27.76 20.64 95-99 23.71 27.905 27.955000000000002 20.43 100-104 23.655 27.750000000000004 27.834999999999997 20.76 105-109 23.98 27.43 27.965 20.625 110-114 24.224999999999998 27.339999999999996 28.575 19.86 115-119 24.09 28.365000000000002 27.58 19.965 120-124 24.315 27.450000000000003 28.044999999999998 20.19 125-129 24.055 27.975 28.185 19.785 130-134 24.21 27.529999999999998 28.249999999999996 20.01 135-139 23.925 27.994999999999997 28.285 19.794999999999998 140-144 24.33 27.689999999999998 28.015 19.965 145-149 24.77 27.474999999999998 27.950000000000003 19.805 150-151 24.887500000000003 27.3 28.799999999999997 19.0125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 1.0 12 0.0 13 0.5 14 0.5 15 0.5 16 1.0 17 0.5 18 0.5 19 0.5 20 1.0 21 2.0 22 1.0 23 1.5 24 2.5 25 2.0 26 2.0 27 2.5 28 5.5 29 8.0 30 9.5 31 13.0 32 19.5 33 26.5 34 29.0 35 35.5 36 55.0 37 78.0 38 110.5 39 145.0 40 164.5 41 195.0 42 236.0 43 261.0 44 272.0 45 294.0 46 301.0 47 279.0 48 253.0 49 227.0 50 203.0 51 165.0 52 147.0 53 123.5 54 78.0 55 58.0 56 43.5 57 36.5 58 30.0 59 17.5 60 14.0 61 12.0 62 6.0 63 5.0 64 6.5 65 3.5 66 1.5 67 0.5 68 1.0 69 2.0 70 1.5 71 0.5 72 0.5 73 1.5 74 1.0 75 0.5 76 1.0 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.025 35-39 0.4 40-44 1.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59839357429718 99.2 2 0.4016064257028112 0.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0125 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.0875 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.3125 0.0 0.0 0.0 0.0 104-105 0.4625 0.0 0.0 0.0 0.0 106-107 0.575 0.0 0.0 0.0 0.0 108-109 0.8375 0.0 0.0 0.0 0.0 110-111 0.9375 0.0 0.0 0.0 0.0 112-113 1.025 0.0 0.0 0.0 0.0 114-115 1.2125 0.0 0.0 0.0 0.0 116-117 1.35 0.0 0.0 0.0 0.0 118-119 1.5625 0.0 0.0 0.0 0.0 120-121 1.725 0.0 0.0 0.0 0.0 122-123 1.875 0.0 0.0 0.0 0.0 124-125 1.9875 0.0 0.0 0.0 0.0 126-127 2.2249999999999996 0.0 0.0 0.0 0.0 128-129 2.55 0.0 0.0 0.0 0.0 130-131 2.7125 0.0 0.0 0.0 0.0 132-133 2.9749999999999996 0.0 0.0 0.0 0.0 134-135 3.25 0.0 0.0 0.0 0.0 136-137 3.75 0.0 0.0 0.0 0.0 138-139 4.1625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGTAAC 10 0.0068661636 144.75 1 >>END_MODULE Read 552507 spots for SRR7171868.sra Written 552507 spots for SRR7171868.sra Read 552507 spots for SRR7171868.sra Written 552507 spots for SRR7171868.sra Read 552507 spots for SRR7171868.sra Written 552507 spots for SRR7171868.sra Read 552507 spots for SRR7171868.sra Written 552507 spots for SRR7171868.sra Read 552507 spots for SRR7171868.sra Written 552507 spots for SRR7171868.sra Read 552507 spots for SRR7171868.sra Written 552507 spots for SRR7171868.sra Read 552507 spots for SRR7171868.sra Written 552507 spots for SRR7171868.sra Read 552507 spots for SRR7171868.sra Written 552507 spots for SRR7171868.sra Read 552507 spots for SRR7171868.sra Written 552507 spots for SRR7171868.sra Read 552507 spots for SRR7171868.sra Written 552507 spots for SRR7171868.sra Read 552507 spots for SRR7171868.sra Written 552507 spots for SRR7171868.sra Read 552507 spots for SRR7171868.sra Written 552507 spots for SRR7171868.sra Read 552507 spots for SRR7171868.sra Written 552507 spots for SRR7171868.sra Read 552507 spots for SRR7171868.sra Written 552507 spots for SRR7171868.sra Read 552522 spots for SRR7171868.sra Written 552522 spots for SRR7171868.sra Read 552507 spots for SRR7171868.sra Written 552507 spots for SRR7171868.sra Read 552507 spots for SRR7171868.sra Written 552507 spots for SRR7171868.sra Read 552507 spots for SRR7171868.sra Written 552507 spots for SRR7171868.sra Read 552507 spots for SRR7171868.sra Written 552507 spots for SRR7171868.sra Read 552507 spots for SRR7171868.sra Written 552507 spots for SRR7171868.sra SRR ids: ['SRR7171868.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_shvghhjz SRR7171868.sra spots: 11050155 blocks: [[1, 552507], [552508, 1105014], [1105015, 1657521], [1657522, 2210028], [2210029, 2762535], [2762536, 3315042], [3315043, 3867549], [3867550, 4420056], [4420057, 4972563], [4972564, 5525070], [5525071, 6077577], [6077578, 6630084], [6630085, 7182591], [7182592, 7735098], [7735099, 8287605], [8287606, 8840112], [8840113, 9392619], [9392620, 9945126], [9945127, 10497633], [10497634, 11050155]] SRR7171868 file size 3722834 SRR7171868 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171868 SRR7171868_1.fastq SRR7171868_2.fastq Input file: SRR7171868_1.fastq Paired file: SRR7171868_2.fastq trimmed: SRR7171868-trimmed-pair1.fastq, SRR7171868-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 13:25:35 2025 >> started Fri Feb 14 13:25:48 2025 >> done (12.400s) 11050155 read pairs processed; of these: 29122 ( 0.26%) short read pairs filtered out after trimming by size control 18781 ( 0.17%) empty read pairs filtered out after trimming by size control 11002252 (99.57%) read pairs available; of these: 4586467 (41.69%) trimmed read pairs available after processing 6415785 (58.31%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 4 0.00% 20 2 0.00% 21 12 0.00% 22 8 0.00% 23 11 0.00% 24 12 0.00% 25 6 0.00% 26 9 0.00% 27 15 0.00% 28 9 0.00% 29 13 0.00% 30 8 0.00% 31 7 0.00% 32 3 0.00% 33 8 0.00% 34 14 0.00% 35 5 0.00% 36 9 0.00% 37 11 0.00% 38 8 0.00% 39 6 0.00% 40 9 0.00% 41 9 0.00% 42 6 0.00% 43 17 0.00% 44 14 0.00% 45 21 0.00% 46 16 0.00% 47 28 0.00% 48 18 0.00% 49 26 0.00% 50 31 0.00% 51 35 0.00% 52 37 0.00% 53 53 0.00% 54 48 0.00% 55 59 0.00% 56 52 0.00% 57 63 0.00% 58 67 0.00% 59 83 0.00% 60 82 0.00% 61 93 0.00% 62 106 0.00% 63 98 0.00% 64 97 0.00% 65 155 0.00% 66 131 0.00% 67 143 0.00% 68 151 0.00% 69 173 0.00% 70 232 0.00% 71 228 0.00% 72 273 0.00% 73 300 0.00% 74 379 0.00% 75 412 0.00% 76 618 0.01% 77 538 0.00% 78 557 0.01% 79 640 0.01% 80 696 0.01% 81 805 0.01% 82 872 0.01% 83 1108 0.01% 84 2218 0.02% 85 3136 0.03% 86 3361 0.03% 87 3954 0.04% 88 4123 0.04% 89 4111 0.04% 90 4100 0.04% 91 4096 0.04% 92 4167 0.04% 93 4373 0.04% 94 4382 0.04% 95 4747 0.04% 96 4863 0.04% 97 5307 0.05% 98 5561 0.05% 99 5741 0.05% 100 6285 0.06% 101 6453 0.06% 102 7150 0.06% 103 7713 0.07% 104 8096 0.07% 105 8536 0.08% 106 8985 0.08% 107 9648 0.09% 108 9914 0.09% 109 10834 0.10% 110 11225 0.10% 111 11775 0.11% 112 12481 0.11% 113 13318 0.12% 114 14165 0.13% 115 14627 0.13% 116 15619 0.14% 117 16168 0.15% 118 16510 0.15% 119 17384 0.16% 120 18021 0.16% 121 18738 0.17% 122 19426 0.18% 123 20539 0.19% 124 21646 0.20% 125 22722 0.21% 126 23489 0.21% 127 24295 0.22% 128 25301 0.23% 129 26182 0.24% 130 27443 0.25% 131 28621 0.26% 132 30525 0.28% 133 32137 0.29% 134 33844 0.31% 135 35417 0.32% 136 37070 0.34% 137 39343 0.36% 138 41566 0.38% 139 44126 0.40% 140 46323 0.42% 141 50573 0.46% 142 55649 0.51% 143 62365 0.57% 144 71733 0.65% 145 84220 0.77% 146 103754 0.94% 147 138843 1.26% 148 214143 1.95% 149 439656 4.00% 150 2443869 22.21% 151 6415785 58.31% 11002252 reads passed initial QC criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=2.37 fanout-score-rank=22 prefix-density=0.48 prefix-fanout=2.2 sequence=CAGGTGCAGTTTGATCC criterion=fanout-score sequence-density=0.15 sequence-density-rank=12 fanout-score=199.42 fanout-score-rank=1 prefix-density=1.14 prefix-fanout=25.9 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=3.04 fanout-score-rank=19 prefix-density=0.54 prefix-fanout=3.0 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.15 sequence-density-rank=16 fanout-score=105.03 fanout-score-rank=1 prefix-density=0.80 prefix-fanout=20.3 sequence=GAGAAGAAGGAT SRR7171868 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 13:26:52 Started mapping on | Feb 14 13:26:52 Finished on | Feb 14 13:28:40 Mapping speed, Million of reads per hour | 366.74 Number of input reads | 11002252 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 9950042 Uniquely mapped reads % | 90.44% Average mapped length | 295.28 Number of splices: Total | 8772730 Number of splices: Annotated (sjdb) | 8581079 Number of splices: GT/AG | 8621951 Number of splices: GC/AG | 110455 Number of splices: AT/AC | 7322 Number of splices: Non-canonical | 33002 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.04% Deletion average length | 2.54 Insertion rate per base | 0.03% Insertion average length | 2.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 309006 % of reads mapped to multiple loci | 2.81% Number of reads mapped to too many loci | 37792 % of reads mapped to too many loci | 0.34% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.32% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 769606 769606 769606 N_multimapping 309006 309006 309006 N_noFeature 218139 9838723 257288 N_ambiguous 129055 777 56581 UnstrandedReadsAssigned:9602848 PositiveStrandReadsAssigned:110542 NegativeStrandReadsAssigned:9636173 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7171868 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171868-trimmed-pair1.fastq SRR7171868-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,002,252 reads, 9,556,532 reads pseudoaligned [quant] estimated average fragment length: 233.399 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,152 rounds 52401 SRR7171868.ke.tsv 34699 SRR7171868.se.tsv 87100 total ==> SRR7171868.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1785.6 409 15.9902 Potri.005G024800.1.v4.1 1035 802.601 169 14.6994 Potri.004G059700.1.v4.1 961 728.601 15 1.43719 Potri.007G009000.2.v4.1 1416 1183.6 0 0 Potri.003G141000.2.v4.1 2943 2710.6 234 6.02649 Potri.016G087400.1.v4.1 270 74.6197 1152 1077.74 Potri.015G069301.1.v4.1 564 333.251 0 0 Potri.010G195200.1.v4.1 1773 1540.6 143 6.47977 Potri.012G127500.1.v4.1 977 744.601 2728 255.761 ==> SRR7171868.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 12 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 455 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 135 SRR7171868 completed mapping pipeline successfully