Starting /dee2/code/volunteer_pipeline.sh SRR7171869 current disk space = 3110306410496 free memory = 1573232764 SRR7171869 SRAfilesize 2c2dbd6c8159711755451c9aad4e1b52 SRR7171869.sra SRR7171869.sra file validated SRR7171869 is paired end SRR7171869 is conventional basespace SRR7171869 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171869_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.12175 18.0 18.0 18.0 18.0 32.0 2 27.2705 27.0 27.0 30.0 18.0 31.0 3 27.828 29.0 27.0 31.0 18.0 33.0 4 30.41775 31.0 29.0 33.0 27.0 33.0 5 32.19475 33.0 32.0 33.0 32.0 33.0 6 35.81025 37.0 36.0 38.0 32.0 38.0 7 36.92675 38.0 37.0 38.0 35.0 38.0 8 36.686 38.0 37.0 38.0 34.0 38.0 9 37.12925 38.0 38.0 38.0 36.0 38.0 10-14 37.357899999999994 38.0 38.0 38.0 36.6 38.0 15-19 37.4227 38.0 38.0 38.0 37.0 38.0 20-24 37.446000000000005 38.0 38.0 38.0 37.0 38.0 25-29 37.4609 38.0 38.0 38.0 37.0 38.0 30-34 37.4231 38.0 38.0 38.0 37.0 38.0 35-39 37.433749999999996 38.0 38.0 38.0 37.0 38.0 40-44 37.396 38.0 38.0 38.0 37.0 38.0 45-49 37.335899999999995 38.0 38.0 38.0 36.8 38.0 50-54 37.2568 38.0 38.0 38.0 36.2 38.0 55-59 37.171350000000004 38.0 38.0 38.0 36.0 38.0 60-64 37.11995 38.0 38.0 38.0 36.0 38.0 65-69 37.084199999999996 38.0 38.0 38.0 36.0 38.0 70-74 37.051399999999994 38.0 38.0 38.0 36.0 38.0 75-79 36.957550000000005 38.0 38.0 38.0 35.6 38.0 80-84 36.88955 38.0 38.0 38.0 35.0 38.0 85-89 36.8217 38.0 38.0 38.0 35.0 38.0 90-94 36.669500000000006 38.0 38.0 38.0 34.2 38.0 95-99 36.577999999999996 38.0 38.0 38.0 34.2 38.0 100-104 36.41844999999999 38.0 37.8 38.0 34.0 38.0 105-109 36.27255 38.0 37.0 38.0 33.8 38.0 110-114 36.26225 38.0 37.0 38.0 33.8 38.0 115-119 35.98245 38.0 37.0 38.0 32.6 38.0 120-124 35.81229999999999 38.0 36.8 38.0 31.6 38.0 125-129 35.615449999999996 38.0 36.2 38.0 31.0 38.0 130-134 35.3247 38.0 36.0 38.0 30.0 38.0 135-139 34.99775000000001 38.0 35.0 38.0 28.0 38.0 140-144 34.610749999999996 38.0 35.0 38.0 27.0 38.0 145-149 34.0274 38.0 35.0 38.0 24.4 38.0 150-151 30.820124999999997 36.5 30.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 0.0 13 1.0 14 0.0 15 1.0 16 0.0 17 1.0 18 1.0 19 3.0 20 2.0 21 2.0 22 5.0 23 9.0 24 8.0 25 15.0 26 21.0 27 15.0 28 21.0 29 21.0 30 37.0 31 44.0 32 85.0 33 100.0 34 192.0 35 325.0 36 1024.0 37 2066.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.15061295971979 9.782336752564422 20.115086314736054 35.95196397297973 2 20.525 18.875 39.025 21.575 3 19.650000000000002 23.549999999999997 27.575 29.225 4 23.200000000000003 32.4 23.150000000000002 21.25 5 21.725 34.65 24.5 19.125 6 17.549999999999997 37.025000000000006 24.474999999999998 20.95 7 13.55 22.0 44.4 20.05 8 17.775 22.400000000000002 30.049999999999997 29.775000000000002 9 18.475 23.3 32.0 26.224999999999998 10-14 20.005 29.23 26.340000000000003 24.425 15-19 20.115 28.18 27.515 24.19 20-24 19.994999999999997 28.09 27.389999999999997 24.525 25-29 20.24 28.63 27.47 23.66 30-34 20.200000000000003 27.755000000000003 27.675 24.37 35-39 20.685000000000002 28.215 27.125 23.974999999999998 40-44 20.165 28.505000000000003 27.544999999999998 23.785 45-49 20.0 27.884999999999998 27.355 24.759999999999998 50-54 20.395 28.04 27.115000000000002 24.45 55-59 20.435 28.749999999999996 27.16 23.655 60-64 20.235 28.275 27.685 23.805 65-69 20.205000000000002 27.825 27.889999999999997 24.08 70-74 20.385 28.345 27.205000000000002 24.065 75-79 20.830000000000002 28.439999999999998 26.724999999999998 24.005000000000003 80-84 20.630000000000003 28.225 27.589999999999996 23.555 85-89 20.435 28.02 27.36 24.185000000000002 90-94 21.01 27.91 27.250000000000004 23.830000000000002 95-99 20.745 27.785 27.455000000000002 24.015 100-104 20.13 27.884999999999998 27.700000000000003 24.285 105-109 20.49 27.825 26.884999999999998 24.8 110-114 20.965 27.655 27.145000000000003 24.235 115-119 20.945 28.22 27.345000000000002 23.49 120-124 20.195 27.96 27.800000000000004 24.044999999999998 125-129 20.794999999999998 27.779999999999998 27.36 24.065 130-134 21.025 27.63 27.49 23.855 135-139 21.005 28.03 26.805 24.16 140-144 20.95 27.975 27.01 24.065 145-149 21.349999999999998 28.044999999999998 26.815 23.79 150-151 20.9375 27.525 26.900000000000002 24.637500000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 1.0 23 1.5 24 0.5 25 1.0 26 2.5 27 5.0 28 6.5 29 8.5 30 14.5 31 23.0 32 26.0 33 31.5 34 42.5 35 53.0 36 78.5 37 96.0 38 113.5 39 141.5 40 175.5 41 215.5 42 244.0 43 267.5 44 291.0 45 287.5 46 277.5 47 262.0 48 249.0 49 230.0 50 188.0 51 156.0 52 124.0 53 97.5 54 78.0 55 55.5 56 34.5 57 30.0 58 24.0 59 16.0 60 13.0 61 9.5 62 8.0 63 7.0 64 4.0 65 2.0 66 3.0 67 2.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87484355444305 99.75 2 0.1251564455569462 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.1375 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.21250000000000002 0.0 0.0 0.0 0.0 102-103 0.2375 0.0 0.0 0.0 0.0 104-105 0.2875 0.0 0.0 0.0 0.0 106-107 0.3375 0.0 0.0 0.0 0.0 108-109 0.4 0.0 0.0 0.0 0.0 110-111 0.4125 0.0 0.0 0.0 0.0 112-113 0.48750000000000004 0.0 0.0 0.0 0.0 114-115 0.625 0.0 0.0 0.0 0.0 116-117 0.6875 0.0 0.0 0.0 0.0 118-119 0.7124999999999999 0.0 0.0 0.0 0.0 120-121 0.85 0.0 0.0 0.0 0.0 122-123 0.9624999999999999 0.0 0.0 0.0 0.0 124-125 1.15 0.0 0.0 0.0 0.0 126-127 1.3875000000000002 0.0 0.0 0.0 0.0 128-129 1.5625 0.0 0.0 0.0 0.0 130-131 1.725 0.0 0.0 0.0 0.0 132-133 1.9249999999999998 0.0 0.0 0.0 0.0 134-135 2.0999999999999996 0.0 0.0 0.0 0.0 136-137 2.2 0.0 0.0 0.0 0.0 138-139 2.4000000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAAGCAG 10 0.006830828 145.0 9 AATGGAA 10 0.006830828 145.0 5 >>END_MODULE SRR7171869 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171869_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.97075 33.0 33.0 34.0 32.0 34.0 2 33.108 34.0 33.0 34.0 32.0 34.0 3 33.185 34.0 33.0 34.0 33.0 34.0 4 33.145 34.0 33.0 34.0 33.0 34.0 5 33.1175 34.0 33.0 34.0 33.0 34.0 6 37.324 38.0 38.0 38.0 37.0 38.0 7 37.3215 38.0 38.0 38.0 37.0 38.0 8 37.21475 38.0 38.0 38.0 37.0 38.0 9 37.34525 38.0 38.0 38.0 37.0 38.0 10-14 37.26805 38.0 38.0 38.0 37.0 38.0 15-19 37.23225 38.0 38.0 38.0 37.0 38.0 20-24 37.29445 38.0 38.0 38.0 37.0 38.0 25-29 37.277100000000004 38.0 38.0 38.0 37.0 38.0 30-34 37.221900000000005 38.0 38.0 38.0 37.0 38.0 35-39 36.99465 38.0 38.0 38.0 36.6 38.0 40-44 36.68245 38.0 38.0 38.0 36.0 38.0 45-49 37.064049999999995 38.0 38.0 38.0 36.0 38.0 50-54 37.146750000000004 38.0 38.0 38.0 36.4 38.0 55-59 37.0406 38.0 38.0 38.0 36.0 38.0 60-64 36.97995 38.0 38.0 38.0 36.0 38.0 65-69 36.91325 38.0 38.0 38.0 36.0 38.0 70-74 36.875150000000005 38.0 38.0 38.0 36.0 38.0 75-79 36.82085 38.0 38.0 38.0 35.4 38.0 80-84 36.70715 38.0 38.0 38.0 35.0 38.0 85-89 36.59905 38.0 38.0 38.0 34.6 38.0 90-94 36.5102 38.0 38.0 38.0 34.0 38.0 95-99 36.395300000000006 38.0 38.0 38.0 34.0 38.0 100-104 36.32645 38.0 38.0 38.0 34.0 38.0 105-109 36.14265 38.0 37.6 38.0 33.4 38.0 110-114 35.894 38.0 37.0 38.0 32.6 38.0 115-119 35.773649999999996 38.0 37.0 38.0 31.8 38.0 120-124 35.57025 38.0 36.4 38.0 31.0 38.0 125-129 35.37415000000001 38.0 36.0 38.0 30.0 38.0 130-134 35.0158 38.0 35.8 38.0 28.2 38.0 135-139 34.6457 38.0 35.0 38.0 27.6 38.0 140-144 34.24805 38.0 35.0 38.0 25.2 38.0 145-149 33.581 38.0 34.6 38.0 20.6 38.0 150-151 30.098875 36.5 28.5 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 2.0 4 2.0 5 1.0 6 0.0 7 0.0 8 1.0 9 1.0 10 0.0 11 2.0 12 0.0 13 3.0 14 0.0 15 1.0 16 1.0 17 0.0 18 4.0 19 2.0 20 4.0 21 6.0 22 4.0 23 10.0 24 11.0 25 12.0 26 24.0 27 21.0 28 20.0 29 28.0 30 39.0 31 43.0 32 95.0 33 101.0 34 166.0 35 292.0 36 696.0 37 2402.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.75 16.475 16.1 29.675 2 23.525 24.175 34.5 17.8 3 19.425 28.199999999999996 31.424999999999997 20.95 4 23.974999999999998 34.525 22.25 19.25 5 22.650000000000002 36.95 20.8 19.6 6 18.375 37.325 23.724999999999998 20.575 7 19.5 17.125 40.8 22.575 8 20.925 22.175 28.725 28.175 9 21.45 25.6 29.2 23.75 10-14 23.075000000000003 28.68 26.075 22.17 15-19 22.925 28.249999999999996 27.255000000000003 21.57 20-24 23.21 28.185 27.18 21.425 25-29 22.975 27.900000000000002 27.27 21.855 30-34 22.919999999999998 27.565 27.595 21.92 35-39 23.016192296087702 28.014683697073316 27.863823795635117 21.10530021120386 40-44 23.021328211866976 28.666734054381887 27.393106236733043 20.918831497018093 45-49 23.549999999999997 27.785 27.665 21.0 50-54 22.66 28.134999999999998 27.744999999999997 21.46 55-59 23.244999999999997 27.99 27.375 21.39 60-64 23.425 28.38 27.029999999999998 21.165 65-69 23.31 28.189999999999998 27.18 21.32 70-74 23.505000000000003 28.235 27.07 21.19 75-79 23.825 27.150000000000002 27.794999999999998 21.23 80-84 23.75 27.589999999999996 27.21 21.45 85-89 23.625 28.055000000000003 27.439999999999998 20.880000000000003 90-94 22.93 27.76 27.755000000000003 21.555 95-99 23.95 27.965 27.12 20.965 100-104 23.775 27.83 26.955000000000002 21.44 105-109 24.240000000000002 27.450000000000003 27.82 20.49 110-114 24.01 28.15 27.29 20.549999999999997 115-119 23.74 28.044999999999998 27.229999999999997 20.985 120-124 24.73 27.950000000000003 26.61 20.71 125-129 24.37 27.495000000000005 27.455000000000002 20.68 130-134 24.025 27.584999999999997 26.740000000000002 21.65 135-139 23.54 26.99 27.884999999999998 21.584999999999997 140-144 24.215 28.035 26.935 20.815 145-149 24.779999999999998 27.99 27.235 19.994999999999997 150-151 24.8625 28.212500000000002 26.900000000000002 20.025000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.5 25 1.0 26 3.0 27 4.5 28 4.0 29 5.0 30 6.0 31 8.5 32 12.5 33 21.0 34 37.0 35 49.5 36 69.5 37 100.5 38 121.0 39 147.0 40 183.5 41 214.5 42 258.0 43 299.0 44 304.0 45 288.0 46 287.5 47 276.5 48 247.5 49 214.0 50 176.5 51 154.0 52 128.0 53 99.0 54 76.0 55 51.5 56 34.5 57 26.5 58 20.5 59 14.5 60 13.5 61 11.0 62 6.5 63 6.5 64 4.5 65 5.0 66 4.0 67 1.0 68 1.0 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.5700000000000001 40-44 1.0699999999999998 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67385850476668 99.325 2 0.3010536879076769 0.6 3 0.025087807325639738 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.1375 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.21250000000000002 0.0 0.0 0.0 0.0 102-103 0.2375 0.0 0.0 0.0 0.0 104-105 0.2875 0.0 0.0 0.0 0.0 106-107 0.3375 0.0 0.0 0.0 0.0 108-109 0.4 0.0 0.0 0.0 0.0 110-111 0.4125 0.0 0.0 0.0 0.0 112-113 0.48750000000000004 0.0 0.0 0.0 0.0 114-115 0.65 0.0 0.0 0.0 0.0 116-117 0.7124999999999999 0.0 0.0 0.0 0.0 118-119 0.7375 0.0 0.0 0.0 0.0 120-121 0.875 0.0 0.0 0.0 0.0 122-123 1.0125 0.0 0.0 0.0 0.0 124-125 1.2 0.0 0.0 0.0 0.0 126-127 1.4375 0.0 0.0 0.0 0.0 128-129 1.6125 0.0 0.0 0.0 0.0 130-131 1.775 0.0 0.0 0.0 0.0 132-133 2.0 0.0 0.0 0.0 0.0 134-135 2.2 0.0 0.0 0.0 0.0 136-137 2.2874999999999996 0.0 0.0 0.0 0.0 138-139 2.4749999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTCAGG 10 0.006830828 145.0 5 >>END_MODULE Read 801147 spots for SRR7171869.sra Written 801147 spots for SRR7171869.sra Read 801147 spots for SRR7171869.sra Written 801147 spots for SRR7171869.sra Read 801147 spots for SRR7171869.sra Written 801147 spots for SRR7171869.sra Read 801147 spots for SRR7171869.sra Written 801147 spots for SRR7171869.sra Read 801147 spots for SRR7171869.sra Written 801147 spots for SRR7171869.sra Read 801147 spots for SRR7171869.sra Written 801147 spots for SRR7171869.sra Read 801147 spots for SRR7171869.sra Written 801147 spots for SRR7171869.sra Read 801147 spots for SRR7171869.sra Written 801147 spots for SRR7171869.sra Read 801147 spots for SRR7171869.sra Written 801147 spots for SRR7171869.sra Read 801147 spots for SRR7171869.sra Written 801147 spots for SRR7171869.sra Read 801147 spots for SRR7171869.sra Written 801147 spots for SRR7171869.sra Read 801147 spots for SRR7171869.sra Written 801147 spots for SRR7171869.sra Read 801147 spots for SRR7171869.sra Written 801147 spots for SRR7171869.sra Read 801147 spots for SRR7171869.sra Written 801147 spots for SRR7171869.sra Read 801147 spots for SRR7171869.sra Written 801147 spots for SRR7171869.sra Read 801147 spots for SRR7171869.sra Written 801147 spots for SRR7171869.sra Read 801147 spots for SRR7171869.sra Written 801147 spots for SRR7171869.sra Read 801147 spots for SRR7171869.sra Written 801147 spots for SRR7171869.sra Read 801147 spots for SRR7171869.sra Written 801147 spots for SRR7171869.sra Read 801147 spots for SRR7171869.sra Written 801147 spots for SRR7171869.sra SRR ids: ['SRR7171869.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__qht92ch SRR7171869.sra spots: 16022940 blocks: [[1, 801147], [801148, 1602294], [1602295, 2403441], [2403442, 3204588], [3204589, 4005735], [4005736, 4806882], [4806883, 5608029], [5608030, 6409176], [6409177, 7210323], [7210324, 8011470], [8011471, 8812617], [8812618, 9613764], [9613765, 10414911], [10414912, 11216058], [11216059, 12017205], [12017206, 12818352], [12818353, 13619499], [13619500, 14420646], [14420647, 15221793], [15221794, 16022940]] SRR7171869 file size 5407948 SRR7171869 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171869 SRR7171869_1.fastq SRR7171869_2.fastq Input file: SRR7171869_1.fastq Paired file: SRR7171869_2.fastq trimmed: SRR7171869-trimmed-pair1.fastq, SRR7171869-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 13:32:53 2025 >> started Fri Feb 14 13:33:12 2025 >> done (18.379s) 16022940 read pairs processed; of these: 11197 ( 0.07%) short read pairs filtered out after trimming by size control 8676 ( 0.05%) empty read pairs filtered out after trimming by size control 16003067 (99.88%) read pairs available; of these: 6638952 (41.49%) trimmed read pairs available after processing 9364115 (58.51%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 2 0.00% 20 1 0.00% 21 3 0.00% 22 3 0.00% 23 5 0.00% 24 6 0.00% 25 4 0.00% 26 2 0.00% 27 2 0.00% 28 2 0.00% 29 5 0.00% 30 2 0.00% 31 3 0.00% 32 4 0.00% 33 3 0.00% 34 8 0.00% 35 6 0.00% 36 6 0.00% 37 2 0.00% 38 3 0.00% 39 3 0.00% 40 9 0.00% 41 4 0.00% 42 8 0.00% 43 7 0.00% 44 6 0.00% 45 5 0.00% 46 8 0.00% 47 15 0.00% 48 11 0.00% 49 11 0.00% 50 18 0.00% 51 20 0.00% 52 20 0.00% 53 23 0.00% 54 25 0.00% 55 34 0.00% 56 39 0.00% 57 34 0.00% 58 36 0.00% 59 65 0.00% 60 64 0.00% 61 40 0.00% 62 74 0.00% 63 69 0.00% 64 89 0.00% 65 85 0.00% 66 95 0.00% 67 119 0.00% 68 153 0.00% 69 190 0.00% 70 173 0.00% 71 202 0.00% 72 260 0.00% 73 308 0.00% 74 291 0.00% 75 367 0.00% 76 434 0.00% 77 453 0.00% 78 463 0.00% 79 555 0.00% 80 631 0.00% 81 763 0.00% 82 903 0.01% 83 1005 0.01% 84 1602 0.01% 85 2025 0.01% 86 2132 0.01% 87 2472 0.02% 88 2475 0.02% 89 2636 0.02% 90 2803 0.02% 91 2984 0.02% 92 3195 0.02% 93 3407 0.02% 94 3722 0.02% 95 4083 0.03% 96 4173 0.03% 97 4424 0.03% 98 4700 0.03% 99 4962 0.03% 100 5491 0.03% 101 5662 0.04% 102 6311 0.04% 103 6638 0.04% 104 7092 0.04% 105 7525 0.05% 106 7962 0.05% 107 8267 0.05% 108 8992 0.06% 109 9498 0.06% 110 10010 0.06% 111 10866 0.07% 112 11467 0.07% 113 11889 0.07% 114 12772 0.08% 115 13570 0.08% 116 14023 0.09% 117 14683 0.09% 118 15241 0.10% 119 16085 0.10% 120 16736 0.10% 121 17790 0.11% 122 18743 0.12% 123 19383 0.12% 124 20627 0.13% 125 21785 0.14% 126 23048 0.14% 127 24288 0.15% 128 25297 0.16% 129 26643 0.17% 130 28121 0.18% 131 29638 0.19% 132 32045 0.20% 133 33784 0.21% 134 36540 0.23% 135 39028 0.24% 136 42063 0.26% 137 44961 0.28% 138 48995 0.31% 139 53293 0.33% 140 58369 0.36% 141 64953 0.41% 142 74059 0.46% 143 85189 0.53% 144 102251 0.64% 145 124990 0.78% 146 161933 1.01% 147 229229 1.43% 148 363972 2.27% 149 760402 4.75% 150 3746697 23.41% 151 9364115 58.51% 16003067 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.43 fanout-score-rank=30 prefix-density=0.25 prefix-fanout=2.2 sequence=CAGGTGCAGTTTGATCC criterion=fanout-score sequence-density=0.11 sequence-density-rank=8 fanout-score=325.72 fanout-score-rank=1 prefix-density=1.05 prefix-fanout=35.4 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=2.79 fanout-score-rank=30 prefix-density=0.32 prefix-fanout=2.7 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.10 sequence-density-rank=20 fanout-score=117.35 fanout-score-rank=1 prefix-density=0.56 prefix-fanout=20.5 sequence=CAAAGAAGAAGAT SRR7171869 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 13:34:08 Started mapping on | Feb 14 13:34:08 Finished on | Feb 14 13:35:55 Mapping speed, Million of reads per hour | 538.42 Number of input reads | 16003067 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 15195160 Uniquely mapped reads % | 94.95% Average mapped length | 296.96 Number of splices: Total | 16204617 Number of splices: Annotated (sjdb) | 15960760 Number of splices: GT/AG | 15956182 Number of splices: GC/AG | 200277 Number of splices: AT/AC | 11536 Number of splices: Non-canonical | 36622 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.58 Insertion rate per base | 0.02% Insertion average length | 2.58 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 419464 % of reads mapped to multiple loci | 2.62% Number of reads mapped to too many loci | 47560 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.06% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 399917 399917 399917 N_multimapping 419464 419464 419464 N_noFeature 254575 15076860 302557 N_ambiguous 141604 605 71016 UnstrandedReadsAssigned:14798981 PositiveStrandReadsAssigned:117695 NegativeStrandReadsAssigned:14821587 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7171869 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171869-trimmed-pair1.fastq SRR7171869-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,003,067 reads, 14,631,481 reads pseudoaligned [quant] estimated average fragment length: 266.567 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,149 rounds 52401 SRR7171869.ke.tsv 34699 SRR7171869.se.tsv 87100 total ==> SRR7171869.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1752.43 867 29.9356 Potri.005G024800.1.v4.1 1035 769.433 175 13.7619 Potri.004G059700.1.v4.1 961 695.45 13 1.13106 Potri.007G009000.2.v4.1 1416 1150.43 0 0 Potri.003G141000.2.v4.1 2943 2677.43 612 13.8307 Potri.016G087400.1.v4.1 270 66.5358 1308 1189.5 Potri.015G069301.1.v4.1 564 303.6 0 0 Potri.010G195200.1.v4.1 1773 1507.43 155 6.22162 Potri.012G127500.1.v4.1 977 711.444 2515 213.898 ==> SRR7171869.se.tsv <== Potri.001G166300.v4.1 2 Potri.001G448400.v4.1 21 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 222 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 101 SRR7171869 completed mapping pipeline successfully