Starting /dee2/code/volunteer_pipeline.sh SRR7171871 current disk space = 3088526114816 free memory = 1402497660 SRR7171871 SRAfilesize 70b91a8b0819976c106bc98775af632b SRR7171871.sra SRR7171871.sra file validated SRR7171871 is paired end SRR7171871 is conventional basespace SRR7171871 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171871_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.51425 32.0 18.0 33.0 18.0 33.0 2 32.09 33.0 32.0 33.0 28.0 34.0 3 31.39525 33.0 31.0 33.0 29.0 33.0 4 31.63325 33.0 31.0 33.0 29.0 33.0 5 32.62075 33.0 33.0 33.0 32.0 34.0 6 36.81 38.0 37.0 38.0 34.0 38.0 7 37.37975 38.0 38.0 38.0 37.0 38.0 8 37.47075 38.0 38.0 38.0 37.0 38.0 9 37.556 38.0 38.0 38.0 37.0 38.0 10-14 37.640499999999996 38.0 38.0 38.0 38.0 38.0 15-19 37.597950000000004 38.0 38.0 38.0 38.0 38.0 20-24 37.57905 38.0 38.0 38.0 38.0 38.0 25-29 37.55930000000001 38.0 38.0 38.0 38.0 38.0 30-34 37.54595 38.0 38.0 38.0 37.8 38.0 35-39 37.504900000000006 38.0 38.0 38.0 37.8 38.0 40-44 37.51605 38.0 38.0 38.0 37.4 38.0 45-49 37.4567 38.0 38.0 38.0 37.0 38.0 50-54 37.4282 38.0 38.0 38.0 37.0 38.0 55-59 37.36945 38.0 38.0 38.0 37.0 38.0 60-64 37.33675 38.0 38.0 38.0 37.0 38.0 65-69 37.2413 38.0 38.0 38.0 36.2 38.0 70-74 37.19015 38.0 38.0 38.0 36.0 38.0 75-79 37.1529 38.0 38.0 38.0 36.0 38.0 80-84 37.09895 38.0 38.0 38.0 36.0 38.0 85-89 37.0687 38.0 38.0 38.0 35.8 38.0 90-94 36.90275 38.0 38.0 38.0 35.2 38.0 95-99 36.821450000000006 38.0 38.0 38.0 35.2 38.0 100-104 36.78645 38.0 38.0 38.0 35.0 38.0 105-109 36.552049999999994 38.0 38.0 38.0 34.0 38.0 110-114 36.504999999999995 38.0 38.0 38.0 34.0 38.0 115-119 36.3008 38.0 37.2 38.0 34.0 38.0 120-124 36.1768 38.0 37.2 38.0 33.4 38.0 125-129 36.060050000000004 38.0 37.0 38.0 33.0 38.0 130-134 35.842650000000006 38.0 36.2 38.0 32.4 38.0 135-139 35.621550000000006 38.0 36.0 38.0 31.4 38.0 140-144 35.21900000000001 38.0 36.0 38.0 30.4 38.0 145-149 34.88164999999999 38.0 35.2 38.0 29.0 38.0 150-151 31.683750000000003 36.5 31.5 38.0 14.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 1.0 16 2.0 17 0.0 18 2.0 19 0.0 20 4.0 21 3.0 22 3.0 23 3.0 24 7.0 25 7.0 26 7.0 27 16.0 28 17.0 29 21.0 30 38.0 31 38.0 32 44.0 33 84.0 34 133.0 35 225.0 36 716.0 37 2628.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.550000000000004 13.200000000000001 13.950000000000001 34.300000000000004 2 20.75 19.125 37.3 22.825 3 19.55 25.5 25.2 29.75 4 23.325000000000003 31.95 23.0 21.725 5 21.625 33.775 24.525 20.075000000000003 6 18.525 34.875 26.325 20.275000000000002 7 14.299999999999999 23.200000000000003 43.575 18.925 8 18.099999999999998 22.925 30.4 28.575 9 17.775 22.625 32.95 26.650000000000002 10-14 19.62 29.409999999999997 27.034999999999997 23.935000000000002 15-19 20.255000000000003 28.15 27.49 24.104999999999997 20-24 19.79 28.165000000000003 27.77 24.275 25-29 19.805 28.689999999999998 27.905 23.599999999999998 30-34 20.16 28.34 27.185 24.315 35-39 20.375 27.76 27.634999999999998 24.23 40-44 20.215 28.294999999999998 28.044999999999998 23.445 45-49 20.3 27.779999999999998 27.735 24.185000000000002 50-54 20.580000000000002 28.194999999999997 27.35 23.875 55-59 20.275000000000002 27.950000000000003 27.575 24.2 60-64 20.06 28.455000000000002 27.21 24.275 65-69 20.73 28.189999999999998 27.415 23.665 70-74 20.77 28.365000000000002 27.439999999999998 23.425 75-79 20.465 28.13 27.189999999999998 24.215 80-84 20.615 28.005000000000003 27.205000000000002 24.175 85-89 20.785 28.044999999999998 27.265 23.905 90-94 20.47 28.15 27.905 23.474999999999998 95-99 20.875 27.339999999999996 28.105000000000004 23.68 100-104 21.11 27.63 27.21 24.05 105-109 20.990000000000002 27.935 26.86 24.215 110-114 20.835 27.815 27.634999999999998 23.715 115-119 20.97 27.57 27.744999999999997 23.715 120-124 20.515 27.779999999999998 27.41 24.295 125-129 20.59 27.395000000000003 27.845 24.169999999999998 130-134 20.51 27.450000000000003 27.689999999999998 24.349999999999998 135-139 20.585 27.450000000000003 27.655 24.310000000000002 140-144 20.93 27.195000000000004 27.82 24.055 145-149 21.255 28.035 27.339999999999996 23.369999999999997 150-151 21.4 27.975 26.7625 23.8625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.5 16 1.0 17 0.0 18 0.0 19 0.5 20 1.5 21 1.5 22 1.5 23 2.0 24 1.5 25 2.0 26 4.0 27 6.0 28 9.0 29 15.5 30 18.0 31 25.0 32 37.5 33 42.5 34 48.5 35 62.0 36 81.5 37 101.5 38 115.5 39 146.5 40 187.0 41 206.0 42 242.5 43 241.5 44 238.5 45 278.5 46 289.0 47 264.5 48 234.0 49 215.5 50 186.0 51 143.0 52 103.5 53 90.0 54 79.5 55 58.0 56 50.0 57 48.0 58 32.0 59 16.0 60 12.0 61 12.5 62 9.0 63 8.5 64 8.5 65 5.5 66 5.5 67 4.0 68 1.0 69 1.0 70 1.0 71 1.0 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69902182091799 99.375 2 0.27589666415851516 0.5499999999999999 3 0.025081514923501375 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.3 0.0 0.0 0.0 0.0 100-101 0.32499999999999996 0.0 0.0 0.0 0.0 102-103 0.4125 0.0 0.0 0.0 0.0 104-105 0.5875 0.0 0.0 0.0 0.0 106-107 0.725 0.0 0.0 0.0 0.0 108-109 0.7625 0.0 0.0 0.0 0.0 110-111 0.8125 0.0 0.0 0.0 0.0 112-113 0.9125 0.0 0.0 0.0 0.0 114-115 1.0 0.0 0.0 0.0 0.0 116-117 1.1375 0.0 0.0 0.0 0.0 118-119 1.3375 0.0 0.0 0.0 0.0 120-121 1.4375 0.0 0.0 0.0 0.0 122-123 1.5375 0.0 0.0 0.0 0.0 124-125 1.7000000000000002 0.0 0.0 0.0 0.0 126-127 1.8125 0.0 0.0 0.0 0.0 128-129 1.8875000000000002 0.0 0.0 0.0 0.0 130-131 2.0 0.0 0.0 0.0 0.0 132-133 2.1 0.0 0.0 0.0 0.0 134-135 2.325 0.0 0.0 0.0 0.0 136-137 2.5125 0.0 0.0 0.0 0.0 138-139 2.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCTCTC 10 0.006830828 145.0 7 >>END_MODULE SRR7171871 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171871_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.081 33.0 33.0 34.0 32.0 34.0 2 33.117 34.0 33.0 34.0 32.0 34.0 3 33.1845 34.0 33.0 34.0 33.0 34.0 4 33.16275 34.0 33.0 34.0 33.0 34.0 5 33.19175 34.0 33.0 34.0 33.0 34.0 6 37.336 38.0 38.0 38.0 37.0 38.0 7 37.33475 38.0 38.0 38.0 37.0 38.0 8 37.3695 38.0 38.0 38.0 38.0 38.0 9 37.296 38.0 38.0 38.0 37.0 38.0 10-14 37.3463 38.0 38.0 38.0 37.0 38.0 15-19 37.297200000000004 38.0 38.0 38.0 37.0 38.0 20-24 37.28555 38.0 38.0 38.0 37.0 38.0 25-29 37.309000000000005 38.0 38.0 38.0 37.0 38.0 30-34 37.246500000000005 38.0 38.0 38.0 37.0 38.0 35-39 37.184900000000006 38.0 38.0 38.0 37.0 38.0 40-44 37.049099999999996 38.0 38.0 38.0 36.8 38.0 45-49 37.2029 38.0 38.0 38.0 36.8 38.0 50-54 37.164699999999996 38.0 38.0 38.0 36.8 38.0 55-59 37.15089999999999 38.0 38.0 38.0 36.6 38.0 60-64 37.06095 38.0 38.0 38.0 36.2 38.0 65-69 37.030100000000004 38.0 38.0 38.0 36.0 38.0 70-74 36.94945 38.0 38.0 38.0 36.0 38.0 75-79 36.8666 38.0 38.0 38.0 35.6 38.0 80-84 36.80179999999999 38.0 38.0 38.0 35.4 38.0 85-89 36.7292 38.0 38.0 38.0 35.2 38.0 90-94 36.55815 38.0 38.0 38.0 34.4 38.0 95-99 36.4236 38.0 38.0 38.0 34.2 38.0 100-104 36.32785 38.0 38.0 38.0 34.0 38.0 105-109 36.181650000000005 38.0 37.6 38.0 33.8 38.0 110-114 36.19305 38.0 37.6 38.0 33.6 38.0 115-119 35.9804 38.0 37.0 38.0 33.0 38.0 120-124 35.84955000000001 38.0 37.0 38.0 32.2 38.0 125-129 35.499 38.0 36.0 38.0 31.0 38.0 130-134 35.1972 38.0 36.0 38.0 29.6 38.0 135-139 34.8934 38.0 35.2 38.0 28.0 38.0 140-144 34.6163 38.0 35.0 38.0 27.0 38.0 145-149 34.01915 38.0 35.0 38.0 23.4 38.0 150-151 30.370874999999998 36.5 29.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 2.0 4 1.0 5 0.0 6 1.0 7 0.0 8 2.0 9 1.0 10 0.0 11 1.0 12 0.0 13 5.0 14 2.0 15 2.0 16 3.0 17 0.0 18 3.0 19 2.0 20 4.0 21 2.0 22 12.0 23 8.0 24 7.0 25 13.0 26 10.0 27 16.0 28 14.0 29 29.0 30 41.0 31 52.0 32 73.0 33 84.0 34 143.0 35 250.0 36 665.0 37 2547.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.875 16.725 17.125 28.275 2 23.45 24.349999999999998 33.825 18.375 3 22.175 27.525 28.875 21.425 4 25.650000000000002 34.075 20.8 19.475 5 24.75 35.975 21.575 17.7 6 19.950000000000003 36.8 23.025000000000002 20.225 7 19.125 18.075 40.975 21.825 8 21.224999999999998 23.825 26.150000000000002 28.799999999999997 9 23.724999999999998 24.099999999999998 28.000000000000004 24.175 10-14 23.395 28.43 25.935000000000002 22.24 15-19 23.64 28.384999999999998 26.645000000000003 21.33 20-24 23.724999999999998 28.244999999999997 26.5 21.529999999999998 25-29 23.51 28.449999999999996 26.43 21.61 30-34 23.135 27.99 26.945000000000004 21.93 35-39 23.116935080524158 28.428528558567574 26.888066419925977 21.566469940982294 40-44 23.978747932434462 27.45225803217884 27.186607187609646 21.382386847777056 45-49 23.52 27.67 27.11 21.7 50-54 23.705000000000002 28.425 27.145000000000003 20.724999999999998 55-59 23.775 27.534999999999997 27.62 21.07 60-64 23.685000000000002 27.505000000000003 27.785 21.025 65-69 23.845 27.200000000000003 27.33 21.625 70-74 23.905 27.51 26.96 21.625 75-79 24.37 27.275 27.365000000000002 20.990000000000002 80-84 24.02 28.08 27.08 20.82 85-89 24.435000000000002 27.54 27.27 20.755000000000003 90-94 24.455 27.12 27.295 21.13 95-99 23.23 27.805000000000003 27.415 21.55 100-104 24.11 27.72 27.215 20.955 105-109 23.9 27.529999999999998 27.49 21.08 110-114 23.875 27.655 27.560000000000002 20.91 115-119 24.42 27.51 26.950000000000003 21.12 120-124 24.240000000000002 27.87 27.32 20.57 125-129 23.849999999999998 27.62 27.544999999999998 20.985 130-134 24.235 27.405 27.089999999999996 21.27 135-139 24.37 27.515 27.3 20.815 140-144 24.45 28.025 26.479999999999997 21.044999999999998 145-149 24.445 27.250000000000004 27.544999999999998 20.76 150-151 24.099999999999998 28.487499999999997 27.200000000000003 20.2125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 1.0 20 1.0 21 0.5 22 0.5 23 0.0 24 0.5 25 1.5 26 2.5 27 2.5 28 2.5 29 5.5 30 7.0 31 7.0 32 14.0 33 23.5 34 36.0 35 49.0 36 58.5 37 82.0 38 110.0 39 135.0 40 164.0 41 196.5 42 241.0 43 277.0 44 296.0 45 297.0 46 289.0 47 278.5 48 243.0 49 220.0 50 206.0 51 156.5 52 113.0 53 95.0 54 81.0 55 62.5 56 50.0 57 46.0 58 36.0 59 29.0 60 18.0 61 10.5 62 11.5 63 11.0 64 8.5 65 5.5 66 4.0 67 1.5 68 2.0 69 2.5 70 2.5 71 1.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.03 40-44 0.245 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.3 0.0 0.0 0.0 0.0 100-101 0.32499999999999996 0.0 0.0 0.0 0.0 102-103 0.4125 0.0 0.0 0.0 0.0 104-105 0.575 0.0 0.0 0.0 0.0 106-107 0.6875 0.0 0.0 0.0 0.0 108-109 0.7124999999999999 0.0 0.0 0.0 0.0 110-111 0.7625 0.0 0.0 0.0 0.0 112-113 0.8625 0.0 0.0 0.0 0.0 114-115 0.95 0.0 0.0 0.0 0.0 116-117 1.0875 0.0 0.0 0.0 0.0 118-119 1.2625 0.0 0.0 0.0 0.0 120-121 1.3625 0.0 0.0 0.0 0.0 122-123 1.4625 0.0 0.0 0.0 0.0 124-125 1.625 0.0 0.0 0.0 0.0 126-127 1.7374999999999998 0.0 0.0 0.0 0.0 128-129 1.8125 0.0 0.0 0.0 0.0 130-131 1.9249999999999998 0.0 0.0 0.0 0.0 132-133 2.025 0.0 0.0 0.0 0.0 134-135 2.2125 0.0 0.0 0.0 0.0 136-137 2.425 0.0 0.0 0.0 0.0 138-139 2.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 761606 spots for SRR7171871.sra Written 761606 spots for SRR7171871.sra Read 761606 spots for SRR7171871.sra Written 761606 spots for SRR7171871.sra Read 761606 spots for SRR7171871.sra Written 761606 spots for SRR7171871.sra Read 761606 spots for SRR7171871.sra Written 761606 spots for SRR7171871.sra Read 761606 spots for SRR7171871.sra Written 761606 spots for SRR7171871.sra Read 761606 spots for SRR7171871.sra Written 761606 spots for SRR7171871.sra Read 761606 spots for SRR7171871.sra Written 761606 spots for SRR7171871.sra Read 761621 spots for SRR7171871.sra Written 761621 spots for SRR7171871.sra Read 761606 spots for SRR7171871.sra Written 761606 spots for SRR7171871.sra Read 761606 spots for SRR7171871.sra Written 761606 spots for SRR7171871.sra Read 761606 spots for SRR7171871.sra Written 761606 spots for SRR7171871.sra Read 761606 spots for SRR7171871.sra Written 761606 spots for SRR7171871.sra Read 761606 spots for SRR7171871.sra Written 761606 spots for SRR7171871.sra Read 761606 spots for SRR7171871.sra Written 761606 spots for SRR7171871.sra Read 761606 spots for SRR7171871.sra Written 761606 spots for SRR7171871.sra Read 761606 spots for SRR7171871.sra Written 761606 spots for SRR7171871.sra Read 761606 spots for SRR7171871.sra Written 761606 spots for SRR7171871.sra Read 761606 spots for SRR7171871.sra Written 761606 spots for SRR7171871.sra Read 761606 spots for SRR7171871.sra Written 761606 spots for SRR7171871.sra Read 761606 spots for SRR7171871.sra Written 761606 spots for SRR7171871.sra SRR ids: ['SRR7171871.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_71_sca2k SRR7171871.sra spots: 15232135 blocks: [[1, 761606], [761607, 1523212], [1523213, 2284818], [2284819, 3046424], [3046425, 3808030], [3808031, 4569636], [4569637, 5331242], [5331243, 6092848], [6092849, 6854454], [6854455, 7616060], [7616061, 8377666], [8377667, 9139272], [9139273, 9900878], [9900879, 10662484], [10662485, 11424090], [11424091, 12185696], [12185697, 12947302], [12947303, 13708908], [13708909, 14470514], [14470515, 15232135]] SRR7171871 file size 5139970 SRR7171871 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171871 SRR7171871_1.fastq SRR7171871_2.fastq Input file: SRR7171871_1.fastq Paired file: SRR7171871_2.fastq trimmed: SRR7171871-trimmed-pair1.fastq, SRR7171871-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 21:57:49 2025 >> started Thu Feb 13 21:58:07 2025 >> done (17.908s) 15232135 read pairs processed; of these: 11656 ( 0.08%) short read pairs filtered out after trimming by size control 8357 ( 0.05%) empty read pairs filtered out after trimming by size control 15212122 (99.87%) read pairs available; of these: 5848810 (38.45%) trimmed read pairs available after processing 9363312 (61.55%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 1 0.00% 20 4 0.00% 21 4 0.00% 22 4 0.00% 23 1 0.00% 24 3 0.00% 25 3 0.00% 26 6 0.00% 27 5 0.00% 28 3 0.00% 29 8 0.00% 30 1 0.00% 31 5 0.00% 32 3 0.00% 33 5 0.00% 34 4 0.00% 35 5 0.00% 36 4 0.00% 37 4 0.00% 38 7 0.00% 39 3 0.00% 40 6 0.00% 41 6 0.00% 42 8 0.00% 43 9 0.00% 44 8 0.00% 45 8 0.00% 46 6 0.00% 47 13 0.00% 48 15 0.00% 49 30 0.00% 50 19 0.00% 51 42 0.00% 52 31 0.00% 53 33 0.00% 54 43 0.00% 55 56 0.00% 56 37 0.00% 57 66 0.00% 58 61 0.00% 59 76 0.00% 60 71 0.00% 61 83 0.00% 62 89 0.00% 63 102 0.00% 64 96 0.00% 65 128 0.00% 66 160 0.00% 67 165 0.00% 68 192 0.00% 69 192 0.00% 70 257 0.00% 71 264 0.00% 72 285 0.00% 73 350 0.00% 74 408 0.00% 75 387 0.00% 76 513 0.00% 77 575 0.00% 78 644 0.00% 79 670 0.00% 80 820 0.01% 81 924 0.01% 82 993 0.01% 83 1193 0.01% 84 1758 0.01% 85 2304 0.02% 86 2581 0.02% 87 2987 0.02% 88 3181 0.02% 89 3226 0.02% 90 3266 0.02% 91 3440 0.02% 92 3769 0.02% 93 4025 0.03% 94 4249 0.03% 95 4554 0.03% 96 4640 0.03% 97 5031 0.03% 98 5315 0.03% 99 5613 0.04% 100 6060 0.04% 101 6511 0.04% 102 6832 0.04% 103 7374 0.05% 104 7816 0.05% 105 8475 0.06% 106 8799 0.06% 107 9201 0.06% 108 9729 0.06% 109 10171 0.07% 110 10688 0.07% 111 11355 0.07% 112 12101 0.08% 113 12811 0.08% 114 13611 0.09% 115 14177 0.09% 116 14986 0.10% 117 15603 0.10% 118 16031 0.11% 119 16940 0.11% 120 17677 0.12% 121 18198 0.12% 122 19204 0.13% 123 20264 0.13% 124 21171 0.14% 125 21977 0.14% 126 23238 0.15% 127 24319 0.16% 128 25340 0.17% 129 26643 0.18% 130 27816 0.18% 131 29383 0.19% 132 30838 0.20% 133 32813 0.22% 134 34535 0.23% 135 37126 0.24% 136 39317 0.26% 137 42031 0.28% 138 44995 0.30% 139 48862 0.32% 140 52933 0.35% 141 58785 0.39% 142 65482 0.43% 143 74140 0.49% 144 86784 0.57% 145 104525 0.69% 146 133195 0.88% 147 183573 1.21% 148 292655 1.92% 149 612388 4.03% 150 3309173 21.75% 151 9363312 61.55% 15212122 reads passed initial QC criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=4.72 fanout-score-rank=23 prefix-density=0.88 prefix-fanout=3.0 sequence=TTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGT criterion=fanout-score sequence-density=0.12 sequence-density-rank=14 fanout-score=225.10 fanout-score-rank=1 prefix-density=1.17 prefix-fanout=22.1 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=2.08 fanout-score-rank=38 prefix-density=0.65 prefix-fanout=2.0 sequence=GGCAGTGGCTGCAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=104.57 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=4.5 sequence=TCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCC SRR7171871 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 21:58:54 Started mapping on | Feb 13 21:58:54 Finished on | Feb 13 22:01:38 Mapping speed, Million of reads per hour | 333.92 Number of input reads | 15212122 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 13666215 Uniquely mapped reads % | 89.84% Average mapped length | 296.84 Number of splices: Total | 14117981 Number of splices: Annotated (sjdb) | 13872515 Number of splices: GT/AG | 13890744 Number of splices: GC/AG | 178970 Number of splices: AT/AC | 11209 Number of splices: Non-canonical | 37058 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.60 Insertion rate per base | 0.02% Insertion average length | 2.64 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 412499 % of reads mapped to multiple loci | 2.71% Number of reads mapped to too many loci | 105110 % of reads mapped to too many loci | 0.69% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.58% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1144928 1144928 1144928 N_multimapping 412499 412499 412499 N_noFeature 279298 13537000 332765 N_ambiguous 151493 993 75140 UnstrandedReadsAssigned:13235424 PositiveStrandReadsAssigned:128222 NegativeStrandReadsAssigned:13258310 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7171871 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171871-trimmed-pair1.fastq SRR7171871-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,212,122 reads, 13,186,212 reads pseudoaligned [quant] estimated average fragment length: 255.973 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,097 rounds 52401 SRR7171871.ke.tsv 34699 SRR7171871.se.tsv 87100 total ==> SRR7171871.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1763.03 793 27.5713 Potri.005G024800.1.v4.1 1035 780.027 263 20.6676 Potri.004G059700.1.v4.1 961 706.039 19 1.64956 Potri.007G009000.2.v4.1 1416 1161.03 0 0 Potri.003G141000.2.v4.1 2943 2688.03 318 7.25166 Potri.016G087400.1.v4.1 270 67.6175 1426 1292.72 Potri.015G069301.1.v4.1 564 312.079 0 0 Potri.010G195200.1.v4.1 1773 1518.03 325 13.1234 Potri.012G127500.1.v4.1 977 722.039 5396 458.094 ==> SRR7171871.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 61 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 460 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 225 SRR7171871 completed mapping pipeline successfully