Starting /dee2/code/volunteer_pipeline.sh SRR7171872 current disk space = 3088561172480 free memory = 1466140888 SRR7171872 SRAfilesize c819405f188225e2c9d1eea3190576ae SRR7171872.sra SRR7171872.sra file validated SRR7171872 is paired end SRR7171872 is conventional basespace SRR7171872 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171872_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.889 33.0 33.0 34.0 32.0 34.0 2 33.16625 34.0 33.0 34.0 33.0 34.0 3 32.70175 33.0 33.0 34.0 31.0 34.0 4 32.816 33.0 33.0 34.0 31.0 34.0 5 33.07575 33.0 33.0 34.0 32.0 34.0 6 36.2545 38.0 36.0 38.0 33.0 38.0 7 37.15275 38.0 38.0 38.0 36.0 38.0 8 37.3435 38.0 38.0 38.0 36.0 38.0 9 37.41225 38.0 38.0 38.0 37.0 38.0 10-14 37.53099999999999 38.0 38.0 38.0 37.0 38.0 15-19 37.5137 38.0 38.0 38.0 37.0 38.0 20-24 37.55024999999999 38.0 38.0 38.0 37.8 38.0 25-29 37.55025 38.0 38.0 38.0 37.8 38.0 30-34 37.5315 38.0 38.0 38.0 38.0 38.0 35-39 37.4894 38.0 38.0 38.0 37.2 38.0 40-44 37.43895 38.0 38.0 38.0 37.2 38.0 45-49 37.3945 38.0 38.0 38.0 37.0 38.0 50-54 37.388799999999996 38.0 38.0 38.0 37.0 38.0 55-59 37.289 38.0 38.0 38.0 36.8 38.0 60-64 37.26905 38.0 38.0 38.0 36.8 38.0 65-69 37.1564 38.0 38.0 38.0 36.0 38.0 70-74 37.1511 38.0 38.0 38.0 36.0 38.0 75-79 37.099399999999996 38.0 38.0 38.0 36.0 38.0 80-84 37.03845 38.0 38.0 38.0 36.0 38.0 85-89 37.0025 38.0 38.0 38.0 36.0 38.0 90-94 36.916250000000005 38.0 38.0 38.0 35.6 38.0 95-99 36.8041 38.0 38.0 38.0 35.0 38.0 100-104 36.7028 38.0 38.0 38.0 34.6 38.0 105-109 36.5796 38.0 38.0 38.0 34.0 38.0 110-114 36.3346 38.0 37.8 38.0 34.0 38.0 115-119 36.172200000000004 38.0 37.0 38.0 33.6 38.0 120-124 36.10325 38.0 37.0 38.0 33.2 38.0 125-129 36.02705 38.0 37.0 38.0 33.0 38.0 130-134 35.70685 38.0 36.2 38.0 31.0 38.0 135-139 35.40689999999999 38.0 36.0 38.0 30.6 38.0 140-144 35.11725 38.0 35.6 38.0 29.8 38.0 145-149 34.5899 38.0 35.0 38.0 27.8 38.0 150-151 31.8195 36.5 32.0 38.0 14.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 2.0 12 0.0 13 1.0 14 0.0 15 1.0 16 1.0 17 2.0 18 0.0 19 4.0 20 0.0 21 2.0 22 5.0 23 7.0 24 10.0 25 2.0 26 8.0 27 14.0 28 20.0 29 19.0 30 29.0 31 39.0 32 65.0 33 82.0 34 133.0 35 241.0 36 669.0 37 2644.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.949999999999996 15.35 10.7 38.0 2 18.825 22.275 36.6 22.3 3 17.775 28.65 26.25 27.325 4 21.85 35.8 21.375 20.974999999999998 5 19.900000000000002 38.550000000000004 23.200000000000003 18.35 6 16.775000000000002 37.625 26.25 19.35 7 13.750000000000002 21.45 44.85 19.950000000000003 8 17.974999999999998 22.400000000000002 29.299999999999997 30.325000000000003 9 17.825 23.05 31.65 27.474999999999998 10-14 19.595000000000002 29.965000000000003 26.455000000000002 23.985 15-19 19.09 28.425 27.905 24.58 20-24 19.875 29.15 27.794999999999998 23.18 25-29 19.885 28.970000000000002 27.755000000000003 23.39 30-34 20.025000000000002 28.67 27.779999999999998 23.525 35-39 19.675 29.12 27.445000000000004 23.76 40-44 19.885 28.815 27.61 23.69 45-49 20.135 28.785 27.139999999999997 23.94 50-54 20.03 29.505 26.99 23.474999999999998 55-59 19.765 29.04 27.744999999999997 23.45 60-64 19.705000000000002 27.87 27.994999999999997 24.43 65-69 20.1 28.49 27.85 23.56 70-74 19.885 28.49 27.735 23.89 75-79 19.645000000000003 28.46 27.42 24.474999999999998 80-84 19.705000000000002 28.42 28.025 23.849999999999998 85-89 19.78 28.62 28.08 23.52 90-94 20.119999999999997 28.139999999999997 27.939999999999998 23.799999999999997 95-99 20.22 28.33 27.915 23.535 100-104 20.235 28.634999999999998 27.389999999999997 23.74 105-109 20.474999999999998 28.27 27.589999999999996 23.665 110-114 19.955000000000002 29.115000000000002 27.48 23.45 115-119 20.369999999999997 28.694999999999997 27.445000000000004 23.49 120-124 20.185 28.444999999999997 27.61 23.76 125-129 20.225 28.01 28.09 23.674999999999997 130-134 20.575 28.59 27.275 23.56 135-139 20.89 28.205000000000002 27.650000000000002 23.255 140-144 20.74 28.22 27.279999999999998 23.76 145-149 20.674999999999997 27.860000000000003 27.389999999999997 24.075 150-151 20.4375 28.325 28.1125 23.125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 0.0 20 0.0 21 1.0 22 2.5 23 3.0 24 3.0 25 2.5 26 5.0 27 9.0 28 10.0 29 12.5 30 18.0 31 23.5 32 30.0 33 37.5 34 50.5 35 74.5 36 88.0 37 108.5 38 143.5 39 175.5 40 202.0 41 234.5 42 268.0 43 283.5 44 281.5 45 283.5 46 272.5 47 236.5 48 221.5 49 200.0 50 158.0 51 127.5 52 102.5 53 82.5 54 69.5 55 52.0 56 33.5 57 21.0 58 17.0 59 14.5 60 10.0 61 7.0 62 5.5 63 3.5 64 3.5 65 2.0 66 2.0 67 2.5 68 1.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.0875 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.275 0.0 0.0 0.0 0.0 106-107 0.2875 0.0 0.0 0.0 0.0 108-109 0.35 0.0 0.0 0.0 0.0 110-111 0.4375 0.0 0.0 0.0 0.0 112-113 0.5125 0.0 0.0 0.0 0.0 114-115 0.65 0.0 0.0 0.0 0.0 116-117 0.825 0.0 0.0 0.0 0.0 118-119 1.0 0.0 0.0 0.0 0.0 120-121 1.1625 0.0 0.0 0.0 0.0 122-123 1.375 0.0 0.0 0.0 0.0 124-125 1.5750000000000002 0.0 0.0 0.0 0.0 126-127 1.8 0.0 0.0 0.0 0.0 128-129 2.0625 0.0 0.0 0.0 0.0 130-131 2.2625 0.0 0.0 0.0 0.0 132-133 2.4625 0.0 0.0 0.0 0.0 134-135 2.55 0.0 0.0 0.0 0.0 136-137 2.6375 0.0 0.0 0.0 0.0 138-139 2.8625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7171872 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171872_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.88825 33.0 33.0 34.0 32.0 34.0 2 33.0075 34.0 33.0 34.0 32.0 34.0 3 33.05325 34.0 33.0 34.0 32.0 34.0 4 33.00425 34.0 33.0 34.0 32.0 34.0 5 33.09175 34.0 33.0 34.0 32.0 34.0 6 37.1945 38.0 38.0 38.0 37.0 38.0 7 37.249 38.0 38.0 38.0 37.0 38.0 8 37.2525 38.0 38.0 38.0 37.0 38.0 9 37.22325 38.0 38.0 38.0 37.0 38.0 10-14 37.147400000000005 38.0 38.0 38.0 36.6 38.0 15-19 37.1241 38.0 38.0 38.0 36.8 38.0 20-24 37.217949999999995 38.0 38.0 38.0 37.0 38.0 25-29 37.1774 38.0 38.0 38.0 36.8 38.0 30-34 37.03835 38.0 38.0 38.0 36.6 38.0 35-39 36.5914 38.0 38.0 38.0 35.8 38.0 40-44 36.4985 38.0 38.0 38.0 35.8 38.0 45-49 36.99660000000001 38.0 38.0 38.0 36.0 38.0 50-54 37.05485 38.0 38.0 38.0 36.0 38.0 55-59 37.0049 38.0 38.0 38.0 36.0 38.0 60-64 36.963800000000006 38.0 38.0 38.0 36.0 38.0 65-69 36.88005 38.0 38.0 38.0 36.0 38.0 70-74 36.7901 38.0 38.0 38.0 35.4 38.0 75-79 36.82165 38.0 38.0 38.0 35.6 38.0 80-84 36.7778 38.0 38.0 38.0 35.4 38.0 85-89 36.557950000000005 38.0 38.0 38.0 34.0 38.0 90-94 36.5 38.0 38.0 38.0 34.4 38.0 95-99 36.382250000000006 38.0 38.0 38.0 34.0 38.0 100-104 36.2275 38.0 37.8 38.0 33.8 38.0 105-109 36.1439 38.0 37.6 38.0 33.4 38.0 110-114 35.994749999999996 38.0 37.0 38.0 33.0 38.0 115-119 35.9018 38.0 37.0 38.0 32.6 38.0 120-124 35.44865 38.0 36.4 38.0 30.2 38.0 125-129 35.242399999999996 38.0 36.0 38.0 29.4 38.0 130-134 35.0124 38.0 36.0 38.0 28.2 38.0 135-139 34.799549999999996 38.0 35.4 38.0 28.0 38.0 140-144 34.50455 38.0 35.0 38.0 27.0 38.0 145-149 33.95385 38.0 34.6 38.0 24.4 38.0 150-151 30.384999999999998 36.5 29.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 0.0 4 0.0 5 1.0 6 0.0 7 1.0 8 0.0 9 1.0 10 1.0 11 0.0 12 1.0 13 0.0 14 0.0 15 4.0 16 2.0 17 4.0 18 4.0 19 7.0 20 6.0 21 14.0 22 11.0 23 8.0 24 8.0 25 17.0 26 17.0 27 22.0 28 28.0 29 23.0 30 46.0 31 44.0 32 74.0 33 93.0 34 156.0 35 299.0 36 659.0 37 2442.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.625 16.425 15.299999999999999 29.65 2 24.75 24.075 34.0 17.175 3 20.5 26.275 32.35 20.875 4 24.025 35.0 21.6 19.375 5 23.3 37.574999999999996 21.325 17.8 6 18.6 36.325 24.05 21.025 7 16.950000000000003 18.425 43.15 21.475 8 21.475 23.549999999999997 27.224999999999998 27.750000000000004 9 21.725 24.775 28.4 25.1 10-14 23.255 28.199999999999996 26.91 21.634999999999998 15-19 22.955000000000002 27.389999999999997 28.465 21.19 20-24 22.825 28.155 28.13 20.89 25-29 22.685 27.735 28.610000000000003 20.97 30-34 23.18796992481203 28.1203007518797 28.421052631578945 20.27067669172932 35-39 23.47429729045328 28.088123575588757 27.384147885540642 21.05343124841732 40-44 23.382680997769214 28.077469073210302 28.047049280064897 20.492800648955587 45-49 23.015 28.275 27.725 20.985 50-54 23.07 28.410000000000004 28.03 20.49 55-59 23.474999999999998 27.425 28.349999999999998 20.75 60-64 22.814999999999998 27.975 28.405 20.805 65-69 23.595 27.975 28.165000000000003 20.265 70-74 23.915 27.839999999999996 27.534999999999997 20.71 75-79 22.555 28.610000000000003 28.235 20.599999999999998 80-84 23.400000000000002 27.975 27.625 21.0 85-89 23.84 27.805000000000003 27.905 20.45 90-94 23.09 28.255000000000003 27.595 21.060000000000002 95-99 23.44 28.084999999999997 27.83 20.645 100-104 24.135 28.134999999999998 27.21 20.52 105-109 23.544999999999998 27.834999999999997 28.34 20.28 110-114 23.485 28.205000000000002 27.894999999999996 20.415 115-119 23.46 27.950000000000003 28.244999999999997 20.345 120-124 23.805 27.35 28.17 20.674999999999997 125-129 24.45 27.605 27.92 20.025000000000002 130-134 24.104999999999997 27.125 28.335 20.435 135-139 23.794999999999998 27.744999999999997 28.07 20.39 140-144 24.025 28.32 27.175 20.48 145-149 24.185000000000002 27.465 28.444999999999997 19.905 150-151 24.587500000000002 27.737499999999997 27.575 20.1 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 1.0 23 1.0 24 0.5 25 3.5 26 4.5 27 3.5 28 5.5 29 6.5 30 7.5 31 12.0 32 19.0 33 29.5 34 43.0 35 59.5 36 83.0 37 107.0 38 133.5 39 169.0 40 201.0 41 236.5 42 274.5 43 287.5 44 293.0 45 303.0 46 298.5 47 268.0 48 227.5 49 198.5 50 165.5 51 130.5 52 114.0 53 97.0 54 65.0 55 38.0 56 27.5 57 20.5 58 14.5 59 14.0 60 12.0 61 8.5 62 5.5 63 4.0 64 2.0 65 1.0 66 0.5 67 0.5 68 0.5 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.25 35-39 1.275 40-44 1.38 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62311557788944 99.125 2 0.3015075376884422 0.6 3 0.02512562814070352 0.075 4 0.05025125628140704 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.025 0.0 64-65 0.0 0.0 0.0 0.025 0.0 66-67 0.0 0.0 0.0 0.025 0.0 68-69 0.0 0.0 0.0 0.025 0.0 70-71 0.0 0.0 0.0 0.025 0.0 72-73 0.0 0.0 0.0 0.025 0.0 74-75 0.0 0.0 0.0 0.025 0.0 76-77 0.0 0.0 0.0 0.025 0.0 78-79 0.0 0.0 0.0 0.025 0.0 80-81 0.0 0.0 0.0 0.025 0.0 82-83 0.0 0.0 0.0 0.025 0.0 84-85 0.0 0.0 0.0 0.025 0.0 86-87 0.025 0.0 0.0 0.025 0.0 88-89 0.025 0.0 0.0 0.025 0.0 90-91 0.025 0.0 0.0 0.025 0.0 92-93 0.025 0.0 0.0 0.025 0.0 94-95 0.025 0.0 0.0 0.025 0.0 96-97 0.05 0.0 0.0 0.025 0.0 98-99 0.0625 0.0 0.0 0.025 0.0 100-101 0.1 0.0 0.0 0.025 0.0 102-103 0.125 0.0 0.0 0.025 0.0 104-105 0.25 0.0 0.0 0.025 0.0 106-107 0.2625 0.0 0.0 0.025 0.0 108-109 0.325 0.0 0.0 0.025 0.0 110-111 0.4125 0.0 0.0 0.025 0.0 112-113 0.48750000000000004 0.0 0.0 0.025 0.0 114-115 0.6 0.0 0.0 0.025 0.0 116-117 0.775 0.0 0.0 0.025 0.0 118-119 0.95 0.0 0.0 0.025 0.0 120-121 1.1124999999999998 0.0 0.0 0.025 0.0 122-123 1.3250000000000002 0.0 0.0 0.025 0.0 124-125 1.5125 0.0 0.0 0.025 0.0 126-127 1.7125 0.0 0.0 0.025 0.0 128-129 1.95 0.0 0.0 0.025 0.0 130-131 2.1375 0.0 0.0 0.025 0.0 132-133 2.3625 0.0 0.0 0.025 0.0 134-135 2.45 0.0 0.0 0.025 0.0 136-137 2.5374999999999996 0.0 0.0 0.025 0.0 138-139 2.7625 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 820127 spots for SRR7171872.sra Written 820127 spots for SRR7171872.sra Read 820127 spots for SRR7171872.sra Written 820127 spots for SRR7171872.sra Read 820127 spots for SRR7171872.sra Written 820127 spots for SRR7171872.sra Read 820127 spots for SRR7171872.sra Written 820127 spots for SRR7171872.sra Read 820127 spots for SRR7171872.sra Written 820127 spots for SRR7171872.sra Read 820127 spots for SRR7171872.sra Written 820127 spots for SRR7171872.sra Read 820127 spots for SRR7171872.sra Written 820127 spots for SRR7171872.sra Read 820127 spots for SRR7171872.sra Written 820127 spots for SRR7171872.sra Read 820127 spots for SRR7171872.sra Written 820127 spots for SRR7171872.sra Read 820127 spots for SRR7171872.sra Written 820127 spots for SRR7171872.sra Read 820127 spots for SRR7171872.sra Written 820127 spots for SRR7171872.sra Read 820127 spots for SRR7171872.sra Written 820127 spots for SRR7171872.sra Read 820127 spots for SRR7171872.sra Written 820127 spots for SRR7171872.sra Read 820127 spots for SRR7171872.sra Written 820127 spots for SRR7171872.sra Read 820127 spots for SRR7171872.sra Written 820127 spots for SRR7171872.sra Read 820131 spots for SRR7171872.sra Written 820131 spots for SRR7171872.sra Read 820127 spots for SRR7171872.sra Written 820127 spots for SRR7171872.sra Read 820127 spots for SRR7171872.sra Written 820127 spots for SRR7171872.sra Read 820127 spots for SRR7171872.sra Written 820127 spots for SRR7171872.sra Read 820127 spots for SRR7171872.sra Written 820127 spots for SRR7171872.sra SRR ids: ['SRR7171872.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rqhbgps5 SRR7171872.sra spots: 16402544 blocks: [[1, 820127], [820128, 1640254], [1640255, 2460381], [2460382, 3280508], [3280509, 4100635], [4100636, 4920762], [4920763, 5740889], [5740890, 6561016], [6561017, 7381143], [7381144, 8201270], [8201271, 9021397], [9021398, 9841524], [9841525, 10661651], [10661652, 11481778], [11481779, 12301905], [12301906, 13122032], [13122033, 13942159], [13942160, 14762286], [14762287, 15582413], [15582414, 16402544]] SRR7171872 file size 5536583 SRR7171872 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171872 SRR7171872_1.fastq SRR7171872_2.fastq Input file: SRR7171872_1.fastq Paired file: SRR7171872_2.fastq trimmed: SRR7171872-trimmed-pair1.fastq, SRR7171872-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 22:09:59 2025 >> started Thu Feb 13 22:10:18 2025 >> done (19.005s) 16402544 read pairs processed; of these: 10574 ( 0.06%) short read pairs filtered out after trimming by size control 8052 ( 0.05%) empty read pairs filtered out after trimming by size control 16383918 (99.89%) read pairs available; of these: 6552527 (39.99%) trimmed read pairs available after processing 9831391 (60.01%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 1 0.00% 21 0 0.00% 22 4 0.00% 23 4 0.00% 24 7 0.00% 25 2 0.00% 26 3 0.00% 27 0 0.00% 28 2 0.00% 29 5 0.00% 30 6 0.00% 31 3 0.00% 32 6 0.00% 33 5 0.00% 34 3 0.00% 35 2 0.00% 36 2 0.00% 37 5 0.00% 38 6 0.00% 39 7 0.00% 40 3 0.00% 41 7 0.00% 42 10 0.00% 43 11 0.00% 44 9 0.00% 45 7 0.00% 46 12 0.00% 47 9 0.00% 48 15 0.00% 49 11 0.00% 50 17 0.00% 51 14 0.00% 52 18 0.00% 53 22 0.00% 54 21 0.00% 55 30 0.00% 56 33 0.00% 57 27 0.00% 58 47 0.00% 59 56 0.00% 60 53 0.00% 61 48 0.00% 62 68 0.00% 63 67 0.00% 64 79 0.00% 65 84 0.00% 66 96 0.00% 67 117 0.00% 68 129 0.00% 69 139 0.00% 70 145 0.00% 71 184 0.00% 72 228 0.00% 73 243 0.00% 74 282 0.00% 75 330 0.00% 76 438 0.00% 77 417 0.00% 78 456 0.00% 79 512 0.00% 80 591 0.00% 81 639 0.00% 82 789 0.00% 83 930 0.01% 84 1456 0.01% 85 1895 0.01% 86 1934 0.01% 87 2178 0.01% 88 2322 0.01% 89 2356 0.01% 90 2490 0.02% 91 2673 0.02% 92 3012 0.02% 93 3202 0.02% 94 3411 0.02% 95 3598 0.02% 96 3840 0.02% 97 4094 0.02% 98 4349 0.03% 99 4659 0.03% 100 4958 0.03% 101 5439 0.03% 102 5741 0.04% 103 6280 0.04% 104 6635 0.04% 105 6895 0.04% 106 7445 0.05% 107 8003 0.05% 108 8370 0.05% 109 8792 0.05% 110 9441 0.06% 111 9877 0.06% 112 10430 0.06% 113 11156 0.07% 114 11941 0.07% 115 12836 0.08% 116 13228 0.08% 117 14148 0.09% 118 14788 0.09% 119 15290 0.09% 120 15783 0.10% 121 16787 0.10% 122 17543 0.11% 123 18714 0.11% 124 20170 0.12% 125 21112 0.13% 126 22240 0.14% 127 23488 0.14% 128 24499 0.15% 129 25652 0.16% 130 27476 0.17% 131 29023 0.18% 132 30865 0.19% 133 33428 0.20% 134 35665 0.22% 135 38803 0.24% 136 41446 0.25% 137 44980 0.27% 138 48292 0.29% 139 52926 0.32% 140 58181 0.36% 141 65328 0.40% 142 73396 0.45% 143 85125 0.52% 144 100859 0.62% 145 123055 0.75% 146 158825 0.97% 147 223999 1.37% 148 356071 2.17% 149 732998 4.47% 150 3739118 22.82% 151 9831391 60.01% 16383918 reads passed initial QC criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=2.59 fanout-score-rank=27 prefix-density=0.82 prefix-fanout=1.9 sequence=CACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.08 sequence-density-rank=23 fanout-score=20.90 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=7.7 sequence=TGTCCTTGTTGAAGATGAT criterion=sequence-density sequence-density=0.87 sequence-density-rank=1 fanout-score=2.63 fanout-score-rank=24 prefix-density=0.88 prefix-fanout=2.6 sequence=ATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.13 sequence-density-rank=16 fanout-score=53.49 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=14.2 sequence=TTGGTGCTGAGA SRR7171872 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 22:11:05 Started mapping on | Feb 13 22:11:05 Finished on | Feb 13 22:13:00 Mapping speed, Million of reads per hour | 512.89 Number of input reads | 16383918 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 15462032 Uniquely mapped reads % | 94.37% Average mapped length | 297.25 Number of splices: Total | 15887744 Number of splices: Annotated (sjdb) | 15583143 Number of splices: GT/AG | 15636435 Number of splices: GC/AG | 202603 Number of splices: AT/AC | 11769 Number of splices: Non-canonical | 36937 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.75 Insertion rate per base | 0.02% Insertion average length | 2.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 376489 % of reads mapped to multiple loci | 2.30% Number of reads mapped to too many loci | 48234 % of reads mapped to too many loci | 0.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.96% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 556223 556223 556223 N_multimapping 376489 376489 376489 N_noFeature 441992 15305604 516854 N_ambiguous 168046 932 85963 UnstrandedReadsAssigned:14851994 PositiveStrandReadsAssigned:155496 NegativeStrandReadsAssigned:14859215 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7171872 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171872-trimmed-pair1.fastq SRR7171872-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,383,918 reads, 14,695,940 reads pseudoaligned [quant] estimated average fragment length: 269.504 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,128 rounds 52401 SRR7171872.ke.tsv 34699 SRR7171872.se.tsv 87100 total ==> SRR7171872.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1749.5 1577 57.7041 Potri.005G024800.1.v4.1 1035 766.496 380 31.7367 Potri.004G059700.1.v4.1 961 692.513 16 1.47904 Potri.007G009000.2.v4.1 1416 1147.5 0 0 Potri.003G141000.2.v4.1 2943 2674.5 763 18.2629 Potri.016G087400.1.v4.1 270 65.6585 728 709.787 Potri.015G069301.1.v4.1 564 301.419 0 0 Potri.010G195200.1.v4.1 1773 1504.5 325 13.8287 Potri.012G127500.1.v4.1 977 708.496 5016 453.219 ==> SRR7171872.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 31 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 440 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 306 SRR7171872 completed mapping pipeline successfully