Starting /dee2/code/volunteer_pipeline.sh SRR7171873 current disk space = 3088577257472 free memory = 1446568916 SRR7171873 SRAfilesize 6800cd2eaa27c05dfd75ab733b11d9b5 SRR7171873.sra SRR7171873.sra file validated SRR7171873 is paired end SRR7171873 is conventional basespace SRR7171873 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171873_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.112 32.0 25.0 33.0 18.0 33.0 2 31.50875 33.0 31.0 33.0 28.0 33.0 3 30.4755 31.0 29.0 33.0 27.0 33.0 4 30.01275 31.0 29.0 33.0 25.0 33.0 5 32.256 33.0 32.0 33.0 32.0 33.0 6 36.63075 38.0 37.0 38.0 34.0 38.0 7 37.04525 38.0 38.0 38.0 35.0 38.0 8 37.04 38.0 38.0 38.0 35.0 38.0 9 37.239 38.0 38.0 38.0 36.0 38.0 10-14 37.422450000000005 38.0 38.0 38.0 37.0 38.0 15-19 37.431850000000004 38.0 38.0 38.0 37.0 38.0 20-24 37.4293 38.0 38.0 38.0 37.0 38.0 25-29 37.42595 38.0 38.0 38.0 37.0 38.0 30-34 37.3923 38.0 38.0 38.0 37.0 38.0 35-39 37.29805 38.0 38.0 38.0 37.0 38.0 40-44 37.32945 38.0 38.0 38.0 37.0 38.0 45-49 37.2752 38.0 38.0 38.0 37.0 38.0 50-54 37.1228 38.0 38.0 38.0 36.4 38.0 55-59 37.113749999999996 38.0 38.0 38.0 36.0 38.0 60-64 37.0327 38.0 38.0 38.0 36.0 38.0 65-69 37.0383 38.0 38.0 38.0 36.0 38.0 70-74 36.93135 38.0 38.0 38.0 35.8 38.0 75-79 36.83985 38.0 38.0 38.0 35.4 38.0 80-84 36.66355 38.0 38.0 38.0 34.8 38.0 85-89 36.63629999999999 38.0 38.0 38.0 34.4 38.0 90-94 36.62445 38.0 38.0 38.0 34.4 38.0 95-99 36.44425 38.0 38.0 38.0 34.0 38.0 100-104 36.21525 38.0 37.4 38.0 33.8 38.0 105-109 36.09995 38.0 37.0 38.0 33.2 38.0 110-114 35.936899999999994 38.0 37.0 38.0 32.6 38.0 115-119 35.8857 38.0 37.0 38.0 32.8 38.0 120-124 35.7238 38.0 36.8 38.0 31.4 38.0 125-129 35.4443 38.0 36.0 38.0 31.0 38.0 130-134 34.9487 38.0 35.8 38.0 28.0 38.0 135-139 34.76735000000001 38.0 35.0 38.0 27.8 38.0 140-144 34.346250000000005 38.0 35.0 38.0 25.2 38.0 145-149 33.8471 38.0 35.0 38.0 22.4 38.0 150-151 30.387750000000004 36.5 28.5 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 2.0 12 2.0 13 1.0 14 0.0 15 3.0 16 3.0 17 1.0 18 4.0 19 6.0 20 5.0 21 5.0 22 6.0 23 8.0 24 11.0 25 19.0 26 14.0 27 19.0 28 21.0 29 24.0 30 39.0 31 50.0 32 74.0 33 106.0 34 173.0 35 334.0 36 778.0 37 2291.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.75 13.425 10.05 28.775000000000002 2 18.97974493623406 18.72968242060515 38.03450862715679 24.256064016004 3 20.150000000000002 25.775 27.0 27.075 4 22.900000000000002 33.825 23.549999999999997 19.725 5 21.275 36.575 24.75 17.4 6 18.099999999999998 35.4 24.9 21.6 7 14.025000000000002 23.0 43.475 19.5 8 17.45 22.375 30.875000000000004 29.299999999999997 9 19.525000000000002 22.825 31.974999999999998 25.674999999999997 10-14 20.285 29.459999999999997 27.200000000000003 23.055 15-19 20.18 28.43 27.944999999999997 23.445 20-24 19.735 28.82 27.894999999999996 23.549999999999997 25-29 19.81 29.035 27.839999999999996 23.315 30-34 19.805 28.78 27.860000000000003 23.555 35-39 20.035 28.57 27.96 23.435 40-44 19.425 28.634999999999998 28.505000000000003 23.435 45-49 19.415 29.325000000000003 27.245 24.015 50-54 20.32 28.185 27.98 23.515 55-59 20.07 28.355000000000004 27.93 23.645 60-64 20.265 28.775000000000002 28.139999999999997 22.82 65-69 20.39 28.215 27.845 23.549999999999997 70-74 20.385 27.800000000000004 28.475 23.34 75-79 19.785 28.449999999999996 27.834999999999997 23.93 80-84 20.215 27.815 28.749999999999996 23.22 85-89 20.44 28.21 27.58 23.77 90-94 19.975 29.095 27.245 23.685000000000002 95-99 20.7 28.799999999999997 27.025 23.474999999999998 100-104 20.34 28.88 27.284999999999997 23.494999999999997 105-109 20.115 28.48 28.075 23.330000000000002 110-114 20.565 28.465 27.779999999999998 23.189999999999998 115-119 20.66 29.015 26.974999999999998 23.35 120-124 20.29 28.050000000000004 27.860000000000003 23.799999999999997 125-129 20.96 28.29 27.534999999999997 23.215 130-134 20.955 28.375 27.060000000000002 23.61 135-139 20.455000000000002 28.65 27.615000000000002 23.28 140-144 20.415 28.4 27.639999999999997 23.544999999999998 145-149 19.985 27.845 28.110000000000003 24.060000000000002 150-151 21.425 28.8875 27.325 22.3625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 1.0 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 1.0 10 1.0 11 0.5 12 0.0 13 1.0 14 1.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.0 20 0.0 21 1.5 22 1.5 23 1.0 24 1.5 25 2.0 26 4.5 27 7.0 28 9.0 29 8.5 30 10.0 31 20.5 32 34.5 33 49.5 34 55.0 35 63.5 36 87.5 37 110.5 38 132.0 39 170.5 40 205.5 41 239.5 42 254.5 43 264.5 44 286.0 45 281.0 46 281.0 47 263.0 48 213.5 49 196.0 50 188.0 51 147.5 52 107.5 53 86.5 54 61.5 55 37.5 56 29.0 57 21.5 58 17.0 59 10.0 60 5.5 61 5.5 62 4.5 63 3.0 64 3.0 65 2.0 66 3.0 67 3.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69902182091799 99.375 2 0.27589666415851516 0.5499999999999999 3 0.025081514923501375 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.2625 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.3 0.0 0.0 0.0 0.0 104-105 0.325 0.0 0.0 0.0 0.0 106-107 0.425 0.0 0.0 0.0 0.0 108-109 0.475 0.0 0.0 0.0 0.0 110-111 0.525 0.0 0.0 0.0 0.0 112-113 0.55 0.0 0.0 0.0 0.0 114-115 0.575 0.0 0.0 0.0 0.0 116-117 0.625 0.0 0.0 0.0 0.0 118-119 0.7124999999999999 0.0 0.0 0.0 0.0 120-121 0.8625 0.0 0.0 0.0 0.0 122-123 0.925 0.0 0.0 0.0 0.0 124-125 1.0625 0.0 0.0 0.0 0.0 126-127 1.35 0.0 0.0 0.0 0.0 128-129 1.4625 0.0 0.0 0.0 0.0 130-131 1.5875 0.0 0.0 0.0 0.0 132-133 1.6875 0.0 0.0 0.0 0.0 134-135 1.8375 0.0 0.0 0.0 0.0 136-137 2.075 0.0 0.0 0.0 0.0 138-139 2.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTTATC 10 0.006830828 145.0 1 TTTATCC 10 0.006830828 145.0 2 >>END_MODULE SRR7171873 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171873_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.89025 33.0 33.0 34.0 32.0 34.0 2 33.0035 34.0 33.0 34.0 32.0 34.0 3 32.9605 34.0 33.0 34.0 32.0 34.0 4 32.929 34.0 33.0 34.0 32.0 34.0 5 32.96275 34.0 33.0 34.0 32.0 34.0 6 37.1675 38.0 38.0 38.0 37.0 38.0 7 37.21425 38.0 38.0 38.0 37.0 38.0 8 37.12875 38.0 38.0 38.0 37.0 38.0 9 37.1725 38.0 38.0 38.0 37.0 38.0 10-14 37.115449999999996 38.0 38.0 38.0 37.0 38.0 15-19 37.103300000000004 38.0 38.0 38.0 37.0 38.0 20-24 37.09135 38.0 38.0 38.0 36.8 38.0 25-29 37.09675 38.0 38.0 38.0 37.0 38.0 30-34 36.965050000000005 38.0 38.0 38.0 36.6 38.0 35-39 36.72205 38.0 38.0 38.0 36.0 38.0 40-44 36.685500000000005 38.0 38.0 38.0 36.0 38.0 45-49 36.936299999999996 38.0 38.0 38.0 36.0 38.0 50-54 36.863600000000005 38.0 38.0 38.0 36.0 38.0 55-59 36.790350000000004 38.0 38.0 38.0 36.0 38.0 60-64 36.75305000000001 38.0 38.0 38.0 35.6 38.0 65-69 36.691649999999996 38.0 38.0 38.0 35.4 38.0 70-74 36.57115 38.0 38.0 38.0 35.0 38.0 75-79 36.6382 38.0 38.0 38.0 35.0 38.0 80-84 36.4782 38.0 38.0 38.0 34.4 38.0 85-89 36.41875 38.0 38.0 38.0 34.2 38.0 90-94 36.196349999999995 38.0 38.0 38.0 33.8 38.0 95-99 35.99365 38.0 37.6 38.0 32.8 38.0 100-104 35.997249999999994 38.0 37.2 38.0 33.4 38.0 105-109 35.76855 38.0 37.2 38.0 31.8 38.0 110-114 35.6734 38.0 37.0 38.0 31.6 38.0 115-119 35.3447 38.0 36.6 38.0 30.4 38.0 120-124 35.22395 38.0 36.2 38.0 28.8 38.0 125-129 34.9207 38.0 36.0 38.0 28.0 38.0 130-134 34.637950000000004 38.0 35.6 38.0 26.8 38.0 135-139 34.22865 38.0 35.0 38.0 24.4 38.0 140-144 33.8328 38.0 35.0 38.0 22.2 38.0 145-149 33.22885 38.0 34.4 38.0 16.0 38.0 150-151 29.629375 36.5 28.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 3.0 4 4.0 5 1.0 6 1.0 7 2.0 8 4.0 9 1.0 10 1.0 11 2.0 12 2.0 13 3.0 14 3.0 15 3.0 16 5.0 17 4.0 18 5.0 19 9.0 20 3.0 21 3.0 22 5.0 23 10.0 24 16.0 25 17.0 26 25.0 27 22.0 28 19.0 29 42.0 30 54.0 31 50.0 32 77.0 33 109.0 34 162.0 35 297.0 36 662.0 37 2367.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.074999999999996 18.075 14.799999999999999 23.05 2 22.525000000000002 26.0 33.425 18.05 3 21.125 28.549999999999997 31.025000000000002 19.3 4 24.525 35.325 21.4 18.75 5 22.525000000000002 36.15 22.625 18.7 6 18.675 37.25 25.650000000000002 18.425 7 18.2 18.675 41.55 21.575 8 20.575 22.475 28.425 28.525 9 22.15 26.075 27.675 24.099999999999998 10-14 23.645 28.58 25.935000000000002 21.84 15-19 22.425 28.439999999999998 27.975 21.16 20-24 22.245 27.935 28.375 21.445 25-29 22.285 28.83 27.57 21.315 30-34 22.015131018588104 28.072548724886015 28.488401222506138 21.42391903401974 35-39 22.92180035202414 28.207191350264015 27.648981644455624 21.222026653256222 40-44 22.54364340695276 27.79594506213211 28.58077174623937 21.079639784675756 45-49 23.315 27.82 28.299999999999997 20.565 50-54 22.75 28.044999999999998 28.335 20.87 55-59 22.869999999999997 28.325 27.715 21.09 60-64 23.125 27.884999999999998 28.26 20.73 65-69 23.18 27.900000000000002 28.694999999999997 20.225 70-74 23.25 28.415000000000003 27.74 20.595 75-79 22.73 28.310000000000002 27.894999999999996 21.065 80-84 23.02 27.495000000000005 28.65 20.835 85-89 23.165 27.815 28.015 21.005 90-94 23.935000000000002 27.975 27.639999999999997 20.45 95-99 23.145 27.689999999999998 28.634999999999998 20.53 100-104 23.52 28.595 27.41 20.474999999999998 105-109 24.135 28.110000000000003 27.534999999999997 20.22 110-114 23.74 28.249999999999996 27.67 20.34 115-119 23.595 27.815 28.28 20.31 120-124 23.48 27.900000000000002 28.255000000000003 20.365 125-129 22.91 28.255000000000003 27.755000000000003 21.08 130-134 23.9 28.435 27.584999999999997 20.080000000000002 135-139 23.605 27.61 28.22 20.565 140-144 23.345 28.310000000000002 28.13 20.215 145-149 23.985 27.88 27.825 20.31 150-151 23.7875 27.525 28.199999999999996 20.4875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 1.5 20 2.0 21 1.0 22 0.5 23 0.5 24 1.5 25 3.0 26 4.5 27 6.0 28 8.5 29 11.5 30 14.5 31 17.5 32 20.0 33 27.0 34 42.0 35 55.5 36 76.5 37 101.0 38 123.0 39 173.0 40 225.0 41 257.5 42 268.5 43 278.0 44 289.5 45 295.0 46 286.5 47 257.0 48 223.5 49 199.0 50 166.5 51 134.0 52 113.5 53 83.0 54 64.5 55 45.5 56 33.5 57 28.0 58 14.5 59 11.0 60 10.0 61 5.5 62 6.5 63 5.5 64 2.0 65 2.0 66 1.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.20500000000000002 35-39 0.575 40-44 0.615 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59798994974875 99.1 2 0.32663316582914576 0.65 3 0.05025125628140704 0.15 4 0.02512562814070352 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.2625 0.0 0.0 0.0 0.0 100-101 0.3 0.0 0.0 0.0 0.0 102-103 0.325 0.0 0.0 0.0 0.0 104-105 0.325 0.0 0.0 0.0 0.0 106-107 0.425 0.0 0.0 0.0 0.0 108-109 0.475 0.0 0.0 0.0 0.0 110-111 0.525 0.0 0.0 0.0 0.0 112-113 0.55 0.0 0.0 0.0 0.0 114-115 0.575 0.0 0.0 0.0 0.0 116-117 0.65 0.0 0.0 0.0 0.0 118-119 0.7375 0.0 0.0 0.0 0.0 120-121 0.8875 0.0 0.0 0.0 0.0 122-123 0.95 0.0 0.0 0.0 0.0 124-125 1.0625 0.0 0.0 0.0 0.0 126-127 1.35 0.0 0.0 0.0 0.0 128-129 1.4500000000000002 0.0 0.0 0.0 0.0 130-131 1.5625 0.0 0.0 0.0 0.0 132-133 1.6625 0.0 0.0 0.0 0.0 134-135 1.8125 0.0 0.0 0.0 0.0 136-137 2.0875 0.0 0.0 0.0 0.0 138-139 2.3625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGGCAG 10 0.0068573058 144.8125 6 AGGCAGC 10 0.0068573058 144.8125 7 >>END_MODULE Read 817655 spots for SRR7171873.sra Written 817655 spots for SRR7171873.sra Read 817655 spots for SRR7171873.sra Written 817655 spots for SRR7171873.sra Read 817655 spots for SRR7171873.sra Written 817655 spots for SRR7171873.sra Read 817655 spots for SRR7171873.sra Written 817655 spots for SRR7171873.sra Read 817655 spots for SRR7171873.sra Written 817655 spots for SRR7171873.sra Read 817655 spots for SRR7171873.sra Written 817655 spots for SRR7171873.sra Read 817655 spots for SRR7171873.sra Written 817655 spots for SRR7171873.sra Read 817655 spots for SRR7171873.sra Written 817655 spots for SRR7171873.sra Read 817655 spots for SRR7171873.sra Written 817655 spots for SRR7171873.sra Read 817655 spots for SRR7171873.sra Written 817655 spots for SRR7171873.sra Read 817655 spots for SRR7171873.sra Written 817655 spots for SRR7171873.sra Read 817655 spots for SRR7171873.sra Written 817655 spots for SRR7171873.sra Read 817655 spots for SRR7171873.sra Written 817655 spots for SRR7171873.sra Read 817655 spots for SRR7171873.sra Written 817655 spots for SRR7171873.sra Read 817655 spots for SRR7171873.sra Written 817655 spots for SRR7171873.sra Read 817655 spots for SRR7171873.sra Written 817655 spots for SRR7171873.sra Read 817655 spots for SRR7171873.sra Written 817655 spots for SRR7171873.sra Read 817655 spots for SRR7171873.sra Written 817655 spots for SRR7171873.sra Read 817655 spots for SRR7171873.sra Written 817655 spots for SRR7171873.sra Read 817660 spots for SRR7171873.sra Written 817660 spots for SRR7171873.sra SRR ids: ['SRR7171873.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kzek_isp SRR7171873.sra spots: 16353105 blocks: [[1, 817655], [817656, 1635310], [1635311, 2452965], [2452966, 3270620], [3270621, 4088275], [4088276, 4905930], [4905931, 5723585], [5723586, 6541240], [6541241, 7358895], [7358896, 8176550], [8176551, 8994205], [8994206, 9811860], [9811861, 10629515], [10629516, 11447170], [11447171, 12264825], [12264826, 13082480], [13082481, 13900135], [13900136, 14717790], [14717791, 15535445], [15535446, 16353105]] SRR7171873 file size 5519830 SRR7171873 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171873 SRR7171873_1.fastq SRR7171873_2.fastq Input file: SRR7171873_1.fastq Paired file: SRR7171873_2.fastq trimmed: SRR7171873-trimmed-pair1.fastq, SRR7171873-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 22:11:45 2025 >> started Thu Feb 13 22:12:02 2025 >> done (17.576s) 16353105 read pairs processed; of these: 25065 ( 0.15%) short read pairs filtered out after trimming by size control 20437 ( 0.12%) empty read pairs filtered out after trimming by size control 16307603 (99.72%) read pairs available; of these: 7343035 (45.03%) trimmed read pairs available after processing 8964568 (54.97%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 2 0.00% 20 4 0.00% 21 8 0.00% 22 8 0.00% 23 7 0.00% 24 9 0.00% 25 6 0.00% 26 6 0.00% 27 11 0.00% 28 6 0.00% 29 8 0.00% 30 3 0.00% 31 7 0.00% 32 6 0.00% 33 4 0.00% 34 6 0.00% 35 6 0.00% 36 16 0.00% 37 4 0.00% 38 9 0.00% 39 7 0.00% 40 15 0.00% 41 12 0.00% 42 16 0.00% 43 16 0.00% 44 17 0.00% 45 17 0.00% 46 18 0.00% 47 29 0.00% 48 35 0.00% 49 38 0.00% 50 46 0.00% 51 45 0.00% 52 41 0.00% 53 46 0.00% 54 67 0.00% 55 68 0.00% 56 74 0.00% 57 80 0.00% 58 69 0.00% 59 101 0.00% 60 124 0.00% 61 135 0.00% 62 164 0.00% 63 147 0.00% 64 175 0.00% 65 180 0.00% 66 214 0.00% 67 252 0.00% 68 273 0.00% 69 280 0.00% 70 340 0.00% 71 364 0.00% 72 402 0.00% 73 446 0.00% 74 493 0.00% 75 596 0.00% 76 780 0.00% 77 943 0.01% 78 858 0.01% 79 886 0.01% 80 1000 0.01% 81 1110 0.01% 82 1272 0.01% 83 1448 0.01% 84 2614 0.02% 85 3329 0.02% 86 3529 0.02% 87 3984 0.02% 88 4082 0.03% 89 4233 0.03% 90 4197 0.03% 91 4322 0.03% 92 4627 0.03% 93 4704 0.03% 94 4889 0.03% 95 4955 0.03% 96 5353 0.03% 97 5492 0.03% 98 5907 0.04% 99 6148 0.04% 100 6558 0.04% 101 6954 0.04% 102 7529 0.05% 103 7829 0.05% 104 8272 0.05% 105 8946 0.05% 106 9269 0.06% 107 9937 0.06% 108 10332 0.06% 109 10827 0.07% 110 11278 0.07% 111 12093 0.07% 112 12810 0.08% 113 13388 0.08% 114 14292 0.09% 115 14994 0.09% 116 15503 0.10% 117 16484 0.10% 118 18212 0.11% 119 16233 0.10% 120 18511 0.11% 121 19386 0.12% 122 20205 0.12% 123 21470 0.13% 124 22634 0.14% 125 23641 0.14% 126 25205 0.15% 127 26480 0.16% 128 27874 0.17% 129 29595 0.18% 130 31419 0.19% 131 33591 0.21% 132 36034 0.22% 133 38656 0.24% 134 41708 0.26% 135 41183 0.25% 136 44723 0.27% 137 49787 0.31% 138 54838 0.34% 139 60394 0.37% 140 66830 0.41% 141 74495 0.46% 142 86062 0.53% 143 100454 0.62% 144 119316 0.73% 145 146056 0.90% 146 192495 1.18% 147 274114 1.68% 148 435189 2.67% 149 893770 5.48% 150 3968937 24.34% 151 8964568 54.97% 16307603 reads passed initial QC criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=2.15 fanout-score-rank=32 prefix-density=0.54 prefix-fanout=2.1 sequence=CAGGTGCAGTTTGATCC criterion=fanout-score sequence-density=0.06 sequence-density-rank=36 fanout-score=19.57 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=4.8 sequence=CAAAATCCTTGGCAAA criterion=sequence-density sequence-density=0.78 sequence-density-rank=1 fanout-score=3.54 fanout-score-rank=14 prefix-density=0.96 prefix-fanout=2.9 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.06 sequence-density-rank=26 fanout-score=28.81 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=6.0 sequence=CTTCCAAAAGTTAAAGGCTTGAGGGGGGATGATTATTACCTGTACCAAGGCTTTTGGTACG SRR7171873 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 22:12:47 Started mapping on | Feb 13 22:12:47 Finished on | Feb 13 22:14:51 Mapping speed, Million of reads per hour | 473.45 Number of input reads | 16307603 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 15068391 Uniquely mapped reads % | 92.40% Average mapped length | 296.33 Number of splices: Total | 15685612 Number of splices: Annotated (sjdb) | 15403899 Number of splices: GT/AG | 15440398 Number of splices: GC/AG | 198144 Number of splices: AT/AC | 11374 Number of splices: Non-canonical | 35696 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.78 Insertion rate per base | 0.02% Insertion average length | 2.61 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 456023 % of reads mapped to multiple loci | 2.80% Number of reads mapped to too many loci | 32596 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.52% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 808131 808131 808131 N_multimapping 456023 456023 456023 N_noFeature 350710 14935212 410031 N_ambiguous 156917 1164 82195 UnstrandedReadsAssigned:14560764 PositiveStrandReadsAssigned:132015 NegativeStrandReadsAssigned:14576165 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7171873 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171873-trimmed-pair1.fastq SRR7171873-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,307,603 reads, 14,416,921 reads pseudoaligned [quant] estimated average fragment length: 279.201 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,122 rounds 52401 SRR7171873.ke.tsv 34699 SRR7171873.se.tsv 87100 total ==> SRR7171873.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1739.8 1284 48.2694 Potri.005G024800.1.v4.1 1035 756.799 552 47.7051 Potri.004G059700.1.v4.1 961 682.832 23 2.20303 Potri.007G009000.2.v4.1 1416 1137.8 0 0 Potri.003G141000.2.v4.1 2943 2664.8 721.438 17.7068 Potri.016G087400.1.v4.1 270 66.044 1002 992.294 Potri.015G069301.1.v4.1 564 294.71 0 0 Potri.010G195200.1.v4.1 1773 1494.8 318 13.9139 Potri.012G127500.1.v4.1 977 698.826 1678 157.047 ==> SRR7171873.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 19 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 493 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 254 SRR7171873 completed mapping pipeline successfully