Starting /dee2/code/volunteer_pipeline.sh SRR7171874 current disk space = 3088618889216 free memory = 1440399040 SRR7171874 SRAfilesize 04da13b2c6fe13de0dc15096629028c0 SRR7171874.sra SRR7171874.sra file validated SRR7171874 is paired end SRR7171874 is conventional basespace SRR7171874 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171874_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.366 33.0 33.0 33.0 32.0 34.0 2 29.37625 31.0 28.0 33.0 18.0 34.0 3 29.57875 31.0 29.0 33.0 25.0 33.0 4 30.97125 33.0 31.0 33.0 29.0 33.0 5 32.26825 33.0 33.0 33.0 31.0 33.0 6 36.13425 38.0 36.0 38.0 33.0 38.0 7 36.93725 38.0 37.0 38.0 35.0 38.0 8 37.139 38.0 38.0 38.0 36.0 38.0 9 37.35575 38.0 38.0 38.0 37.0 38.0 10-14 37.44345 38.0 38.0 38.0 37.0 38.0 15-19 37.4524 38.0 38.0 38.0 37.0 38.0 20-24 37.4593 38.0 38.0 38.0 37.0 38.0 25-29 37.397149999999996 38.0 38.0 38.0 37.0 38.0 30-34 37.41440000000001 38.0 38.0 38.0 37.0 38.0 35-39 37.36155 38.0 38.0 38.0 37.0 38.0 40-44 37.3733 38.0 38.0 38.0 37.0 38.0 45-49 37.32505 38.0 38.0 38.0 37.0 38.0 50-54 37.2428 38.0 38.0 38.0 36.8 38.0 55-59 37.2116 38.0 38.0 38.0 36.6 38.0 60-64 37.154199999999996 38.0 38.0 38.0 36.0 38.0 65-69 37.1271 38.0 38.0 38.0 36.0 38.0 70-74 37.10459999999999 38.0 38.0 38.0 36.0 38.0 75-79 37.05694999999999 38.0 38.0 38.0 36.0 38.0 80-84 36.9824 38.0 38.0 38.0 36.0 38.0 85-89 36.9047 38.0 38.0 38.0 35.6 38.0 90-94 36.8479 38.0 38.0 38.0 35.0 38.0 95-99 36.76305 38.0 38.0 38.0 35.0 38.0 100-104 36.68615 38.0 38.0 38.0 34.8 38.0 105-109 36.538149999999995 38.0 38.0 38.0 34.0 38.0 110-114 36.3048 38.0 37.4 38.0 33.8 38.0 115-119 36.23585 38.0 37.2 38.0 34.0 38.0 120-124 36.15965 38.0 37.0 38.0 33.6 38.0 125-129 36.0081 38.0 37.0 38.0 33.0 38.0 130-134 35.66945 38.0 36.0 38.0 31.2 38.0 135-139 35.415099999999995 38.0 36.0 38.0 30.4 38.0 140-144 35.18150000000001 38.0 35.8 38.0 30.0 38.0 145-149 34.6986 38.0 35.0 38.0 28.0 38.0 150-151 31.956375 36.5 31.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 2.0 13 0.0 14 1.0 15 2.0 16 1.0 17 2.0 18 2.0 19 2.0 20 1.0 21 4.0 22 3.0 23 3.0 24 2.0 25 10.0 26 16.0 27 15.0 28 26.0 29 27.0 30 33.0 31 34.0 32 74.0 33 89.0 34 133.0 35 240.0 36 729.0 37 2548.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.45 17.1 10.0 34.449999999999996 2 25.1 22.875 26.825 25.2 3 25.825 27.075 22.05 25.05 4 24.4 34.150000000000006 22.475 18.975 5 22.775000000000002 35.05 22.875 19.3 6 18.875 35.8 24.45 20.875 7 14.05 22.625 43.35 19.975 8 18.925 22.125 29.349999999999998 29.599999999999998 9 17.875 23.025000000000002 32.425 26.674999999999997 10-14 19.61 29.45 26.950000000000003 23.990000000000002 15-19 20.145 27.744999999999997 27.77 24.34 20-24 20.605 28.53 27.21 23.655 25-29 20.075000000000003 29.215000000000003 27.24 23.47 30-34 20.064999999999998 28.77 27.755000000000003 23.41 35-39 20.225 28.48 27.339999999999996 23.955000000000002 40-44 20.330000000000002 28.405 27.755000000000003 23.51 45-49 20.145 28.16 27.675 24.02 50-54 20.549999999999997 28.485 27.12 23.845 55-59 20.49 28.785 26.889999999999997 23.835 60-64 20.23 28.015 27.675 24.08 65-69 20.27 27.97 27.46 24.3 70-74 20.585 28.475 27.05 23.89 75-79 20.145 27.865000000000002 27.83 24.16 80-84 20.8 27.725 27.26 24.215 85-89 20.395 28.1 27.36 24.145 90-94 20.105 27.744999999999997 27.985 24.165 95-99 20.78 27.639999999999997 27.810000000000002 23.77 100-104 20.674999999999997 27.894999999999996 27.884999999999998 23.544999999999998 105-109 20.82 28.17 27.235 23.775 110-114 21.099999999999998 27.779999999999998 27.675 23.445 115-119 21.05 28.335 27.095000000000002 23.52 120-124 20.625 28.050000000000004 27.834999999999997 23.49 125-129 20.585 27.665 27.400000000000002 24.349999999999998 130-134 21.275 27.450000000000003 27.195000000000004 24.08 135-139 21.595 27.21 27.145000000000003 24.05 140-144 21.175 27.99 27.334999999999997 23.5 145-149 21.135 27.994999999999997 26.88 23.990000000000002 150-151 21.637500000000003 27.200000000000003 27.200000000000003 23.962500000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 0.5 24 0.5 25 3.5 26 4.5 27 5.5 28 8.0 29 8.5 30 14.0 31 18.0 32 20.0 33 28.5 34 40.0 35 56.5 36 76.0 37 104.0 38 134.5 39 157.0 40 184.0 41 211.5 42 244.5 43 265.0 44 262.0 45 281.5 46 295.5 47 274.5 48 239.0 49 205.5 50 187.0 51 159.5 52 126.0 53 96.5 54 69.0 55 50.0 56 35.0 57 27.5 58 24.0 59 18.5 60 17.5 61 13.5 62 10.5 63 9.5 64 4.5 65 2.0 66 2.0 67 1.5 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79954898521673 99.575 2 0.17539463793535454 0.35000000000000003 3 0.025056376847907794 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.25 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.3125 0.0 0.0 0.0 0.0 104-105 0.38749999999999996 0.0 0.0 0.0 0.0 106-107 0.4625 0.0 0.0 0.0 0.0 108-109 0.5 0.0 0.0 0.0 0.0 110-111 0.5875 0.0 0.0 0.0 0.0 112-113 0.6375 0.0 0.0 0.0 0.0 114-115 0.6875 0.0 0.0 0.0 0.0 116-117 0.8 0.0 0.0 0.0 0.0 118-119 1.0 0.0 0.0 0.0 0.0 120-121 1.0875 0.0 0.0 0.0 0.0 122-123 1.3375 0.0 0.0 0.0 0.0 124-125 1.4125 0.0 0.0 0.0 0.0 126-127 1.5499999999999998 0.0 0.0 0.0 0.0 128-129 1.7875 0.0 0.0 0.0 0.0 130-131 2.1125 0.0 0.0 0.0 0.0 132-133 2.425 0.0 0.0 0.0 0.0 134-135 2.6375 0.0 0.0 0.0 0.0 136-137 2.8375 0.0 0.0 0.0 0.0 138-139 3.1625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AACGTAG 10 0.006830828 145.0 5 ATTTGTG 10 0.006830828 145.0 2 CTTCGAT 10 0.006830828 145.0 3 AAACGTA 10 0.006830828 145.0 4 TTTGTGA 10 0.006830828 145.0 3 >>END_MODULE SRR7171874 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171874_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.87625 33.0 33.0 34.0 32.0 34.0 2 32.988 34.0 33.0 34.0 32.0 34.0 3 32.97675 34.0 33.0 34.0 32.0 34.0 4 32.963 34.0 33.0 34.0 32.0 34.0 5 32.949 34.0 33.0 34.0 32.0 34.0 6 36.998 38.0 38.0 38.0 36.0 38.0 7 37.09625 38.0 38.0 38.0 37.0 38.0 8 37.06075 38.0 38.0 38.0 36.0 38.0 9 37.0575 38.0 38.0 38.0 37.0 38.0 10-14 37.03975 38.0 38.0 38.0 36.6 38.0 15-19 37.02915 38.0 38.0 38.0 36.0 38.0 20-24 36.95435 38.0 38.0 38.0 36.0 38.0 25-29 36.968149999999994 38.0 38.0 38.0 36.0 38.0 30-34 36.93695 38.0 38.0 38.0 36.0 38.0 35-39 36.6677 38.0 38.0 38.0 35.4 38.0 40-44 36.41545 38.0 38.0 38.0 35.2 38.0 45-49 36.795100000000005 38.0 38.0 38.0 35.4 38.0 50-54 36.8599 38.0 38.0 38.0 36.0 38.0 55-59 36.78685 38.0 38.0 38.0 35.6 38.0 60-64 36.77645 38.0 38.0 38.0 35.6 38.0 65-69 36.71275 38.0 38.0 38.0 35.2 38.0 70-74 36.56224999999999 38.0 38.0 38.0 34.6 38.0 75-79 36.57280000000001 38.0 38.0 38.0 34.2 38.0 80-84 36.515 38.0 38.0 38.0 34.6 38.0 85-89 36.33455 38.0 38.0 38.0 34.0 38.0 90-94 36.296299999999995 38.0 38.0 38.0 34.0 38.0 95-99 36.1481 38.0 37.8 38.0 33.2 38.0 100-104 36.06445000000001 38.0 37.4 38.0 33.2 38.0 105-109 35.913 38.0 37.0 38.0 32.8 38.0 110-114 35.7339 38.0 37.0 38.0 31.2 38.0 115-119 35.6182 38.0 37.0 38.0 31.0 38.0 120-124 35.41765 38.0 36.4 38.0 30.2 38.0 125-129 35.12075 38.0 36.0 38.0 28.4 38.0 130-134 34.737249999999996 38.0 35.0 38.0 27.2 38.0 135-139 34.443349999999995 38.0 35.0 38.0 25.6 38.0 140-144 34.10210000000001 38.0 35.0 38.0 23.8 38.0 145-149 33.313750000000006 38.0 34.0 38.0 18.2 38.0 150-151 29.964999999999996 36.0 29.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 2.0 4 1.0 5 0.0 6 1.0 7 1.0 8 5.0 9 0.0 10 2.0 11 3.0 12 0.0 13 0.0 14 1.0 15 3.0 16 5.0 17 4.0 18 5.0 19 5.0 20 2.0 21 4.0 22 13.0 23 14.0 24 16.0 25 22.0 26 15.0 27 33.0 28 32.0 29 34.0 30 42.0 31 53.0 32 79.0 33 108.0 34 154.0 35 317.0 36 687.0 37 2330.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.1 17.724999999999998 17.4 25.775 2 25.75 24.474999999999998 31.75 18.025 3 21.975 27.224999999999998 29.349999999999998 21.45 4 23.825 35.225 21.825 19.125 5 25.7 35.125 20.875 18.3 6 20.025000000000002 36.95 22.425 20.599999999999998 7 19.575 18.775 40.2 21.45 8 21.375 23.0 27.800000000000004 27.825 9 23.0 24.2 27.425 25.374999999999996 10-14 22.439999999999998 29.09 26.275 22.195 15-19 22.939999999999998 28.194999999999997 27.169999999999998 21.695 20-24 22.869999999999997 28.610000000000003 27.389999999999997 21.13 25-29 24.075 28.470000000000002 26.490000000000002 20.965 30-34 23.617085125537663 28.00340102030609 26.868060418125438 21.51145343603081 35-39 22.767497988736928 28.95716009654063 26.835277554304106 21.440064360418344 40-44 23.579703546314565 28.1125107502403 26.893307026862956 21.41447867658218 45-49 23.51 27.544999999999998 27.665 21.279999999999998 50-54 23.325000000000003 28.01 27.224999999999998 21.44 55-59 23.79 27.834999999999997 27.38 20.995 60-64 23.845 28.349999999999998 26.939999999999998 20.865000000000002 65-69 23.91 28.115000000000002 26.974999999999998 21.0 70-74 24.03 27.650000000000002 27.115000000000002 21.205 75-79 24.16 27.205000000000002 27.76 20.875 80-84 23.335 27.845 27.52 21.3 85-89 23.79 27.91 27.405 20.895 90-94 24.065 27.445000000000004 27.284999999999997 21.205 95-99 23.84 27.750000000000004 27.345000000000002 21.065 100-104 23.905 27.765 27.139999999999997 21.19 105-109 23.66 28.355000000000004 27.11 20.875 110-114 23.825 27.815 27.445000000000004 20.915 115-119 23.805 28.015 26.71 21.47 120-124 23.695 27.405 28.035 20.865000000000002 125-129 23.3 28.23 27.43 21.04 130-134 24.255 27.61 27.334999999999997 20.8 135-139 24.245 27.884999999999998 27.765 20.105 140-144 24.115000000000002 27.55 27.744999999999997 20.59 145-149 24.64 27.88 26.905 20.575 150-151 24.3625 27.8375 27.3 20.5 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 1.5 24 2.0 25 2.0 26 2.0 27 2.0 28 2.0 29 4.0 30 7.5 31 8.0 32 12.5 33 18.0 34 26.0 35 44.0 36 64.0 37 90.0 38 112.5 39 139.5 40 176.0 41 206.0 42 253.0 43 294.0 44 308.5 45 314.0 46 294.5 47 282.0 48 254.5 49 203.5 50 175.5 51 157.5 52 125.5 53 97.5 54 84.5 55 70.5 56 46.0 57 23.5 58 22.0 59 19.5 60 17.5 61 14.5 62 7.0 63 4.0 64 3.0 65 3.5 66 2.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.03 35-39 0.5599999999999999 40-44 1.165 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.25 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.3 0.0 0.0 0.0 0.0 104-105 0.36250000000000004 0.0 0.0 0.0 0.0 106-107 0.4625 0.0 0.0 0.0 0.0 108-109 0.5 0.0 0.0 0.0 0.0 110-111 0.5875 0.0 0.0 0.0 0.0 112-113 0.6375 0.0 0.0 0.0 0.0 114-115 0.6875 0.0 0.0 0.0 0.0 116-117 0.8 0.0 0.0 0.0 0.0 118-119 0.9125000000000001 0.0 0.0 0.0 0.0 120-121 0.9874999999999999 0.0 0.0 0.0 0.0 122-123 1.2374999999999998 0.0 0.0 0.0 0.0 124-125 1.35 0.0 0.0 0.0 0.0 126-127 1.5 0.0 0.0 0.0 0.0 128-129 1.725 0.0 0.0 0.0 0.0 130-131 2.05 0.0 0.0 0.0 0.0 132-133 2.375 0.0 0.0 0.0 0.0 134-135 2.5875 0.0 0.0 0.0 0.0 136-137 2.7875 0.0 0.0 0.0 0.0 138-139 3.1125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 776668 spots for SRR7171874.sra Written 776668 spots for SRR7171874.sra Read 776668 spots for SRR7171874.sra Written 776668 spots for SRR7171874.sra Read 776668 spots for SRR7171874.sra Written 776668 spots for SRR7171874.sra Read 776668 spots for SRR7171874.sra Written 776668 spots for SRR7171874.sra Read 776668 spots for SRR7171874.sra Written 776668 spots for SRR7171874.sra Read 776668 spots for SRR7171874.sra Written 776668 spots for SRR7171874.sra Read 776668 spots for SRR7171874.sra Written 776668 spots for SRR7171874.sra Read 776668 spots for SRR7171874.sra Written 776668 spots for SRR7171874.sra Read 776668 spots for SRR7171874.sra Written 776668 spots for SRR7171874.sra Read 776668 spots for SRR7171874.sra Written 776668 spots for SRR7171874.sra Read 776668 spots for SRR7171874.sra Written 776668 spots for SRR7171874.sra Read 776668 spots for SRR7171874.sra Written 776668 spots for SRR7171874.sra Read 776668 spots for SRR7171874.sra Written 776668 spots for SRR7171874.sra Read 776668 spots for SRR7171874.sra Written 776668 spots for SRR7171874.sra Read 776668 spots for SRR7171874.sra Written 776668 spots for SRR7171874.sra Read 776668 spots for SRR7171874.sra Written 776668 spots for SRR7171874.sra Read 776668 spots for SRR7171874.sra Written 776668 spots for SRR7171874.sra Read 776668 spots for SRR7171874.sra Written 776668 spots for SRR7171874.sra Read 776676 spots for SRR7171874.sra Written 776676 spots for SRR7171874.sra Read 776668 spots for SRR7171874.sra Written 776668 spots for SRR7171874.sra SRR ids: ['SRR7171874.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pm88irwy SRR7171874.sra spots: 15533368 blocks: [[1, 776668], [776669, 1553336], [1553337, 2330004], [2330005, 3106672], [3106673, 3883340], [3883341, 4660008], [4660009, 5436676], [5436677, 6213344], [6213345, 6990012], [6990013, 7766680], [7766681, 8543348], [8543349, 9320016], [9320017, 10096684], [10096685, 10873352], [10873353, 11650020], [11650021, 12426688], [12426689, 13203356], [13203357, 13980024], [13980025, 14756692], [14756693, 15533368]] SRR7171874 file size 5242048 SRR7171874 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171874 SRR7171874_1.fastq SRR7171874_2.fastq Input file: SRR7171874_1.fastq Paired file: SRR7171874_2.fastq trimmed: SRR7171874-trimmed-pair1.fastq, SRR7171874-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 22:21:29 2025 >> started Thu Feb 13 22:21:47 2025 >> done (17.610s) 15533368 read pairs processed; of these: 19312 ( 0.12%) short read pairs filtered out after trimming by size control 12551 ( 0.08%) empty read pairs filtered out after trimming by size control 15501505 (99.79%) read pairs available; of these: 6203818 (40.02%) trimmed read pairs available after processing 9297687 (59.98%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 3 0.00% 20 2 0.00% 21 4 0.00% 22 7 0.00% 23 5 0.00% 24 5 0.00% 25 4 0.00% 26 4 0.00% 27 8 0.00% 28 9 0.00% 29 8 0.00% 30 1 0.00% 31 5 0.00% 32 4 0.00% 33 2 0.00% 34 8 0.00% 35 7 0.00% 36 8 0.00% 37 6 0.00% 38 9 0.00% 39 8 0.00% 40 4 0.00% 41 5 0.00% 42 6 0.00% 43 6 0.00% 44 13 0.00% 45 12 0.00% 46 19 0.00% 47 15 0.00% 48 17 0.00% 49 14 0.00% 50 13 0.00% 51 23 0.00% 52 17 0.00% 53 22 0.00% 54 35 0.00% 55 38 0.00% 56 33 0.00% 57 30 0.00% 58 63 0.00% 59 84 0.00% 60 59 0.00% 61 67 0.00% 62 78 0.00% 63 82 0.00% 64 90 0.00% 65 114 0.00% 66 114 0.00% 67 128 0.00% 68 134 0.00% 69 181 0.00% 70 211 0.00% 71 213 0.00% 72 267 0.00% 73 286 0.00% 74 324 0.00% 75 369 0.00% 76 486 0.00% 77 502 0.00% 78 539 0.00% 79 587 0.00% 80 634 0.00% 81 739 0.00% 82 870 0.01% 83 1092 0.01% 84 1988 0.01% 85 2668 0.02% 86 2699 0.02% 87 3330 0.02% 88 3238 0.02% 89 3090 0.02% 90 3355 0.02% 91 3506 0.02% 92 3827 0.02% 93 3856 0.02% 94 4038 0.03% 95 4406 0.03% 96 4656 0.03% 97 4912 0.03% 98 5084 0.03% 99 5540 0.04% 100 5989 0.04% 101 6394 0.04% 102 6753 0.04% 103 7330 0.05% 104 7788 0.05% 105 8220 0.05% 106 8813 0.06% 107 9271 0.06% 108 9555 0.06% 109 10278 0.07% 110 10909 0.07% 111 11782 0.08% 112 12235 0.08% 113 13079 0.08% 114 13700 0.09% 115 14478 0.09% 116 15289 0.10% 117 16021 0.10% 118 16764 0.11% 119 17433 0.11% 120 18288 0.12% 121 19348 0.12% 122 20141 0.13% 123 21457 0.14% 124 22552 0.15% 125 23478 0.15% 126 24720 0.16% 127 26097 0.17% 128 27150 0.18% 129 28638 0.18% 130 30461 0.20% 131 32532 0.21% 132 33874 0.22% 133 36135 0.23% 134 38432 0.25% 135 41171 0.27% 136 44213 0.29% 137 47169 0.30% 138 50944 0.33% 139 54988 0.35% 140 59983 0.39% 141 66203 0.43% 142 75169 0.48% 143 85606 0.55% 144 100384 0.65% 145 120767 0.78% 146 154789 1.00% 147 211043 1.36% 148 329995 2.13% 149 674579 4.35% 150 3392483 21.88% 151 9297687 59.98% 15501505 reads passed initial QC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=3.04 fanout-score-rank=25 prefix-density=0.41 prefix-fanout=2.1 sequence=CACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.06 sequence-density-rank=32 fanout-score=423.18 fanout-score-rank=1 prefix-density=0.74 prefix-fanout=34.3 sequence=TCTTCTTCTTCCT criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=2.46 fanout-score-rank=29 prefix-density=0.40 prefix-fanout=2.4 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.10 sequence-density-rank=19 fanout-score=101.14 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=21.8 sequence=GAAGAAGAGAGG SRR7171874 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 22:22:35 Started mapping on | Feb 13 22:22:35 Finished on | Feb 13 22:24:02 Mapping speed, Million of reads per hour | 641.44 Number of input reads | 15501505 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 14632145 Uniquely mapped reads % | 94.39% Average mapped length | 296.63 Number of splices: Total | 15273944 Number of splices: Annotated (sjdb) | 15006562 Number of splices: GT/AG | 15037763 Number of splices: GC/AG | 188760 Number of splices: AT/AC | 11564 Number of splices: Non-canonical | 35857 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.69 Insertion rate per base | 0.02% Insertion average length | 2.57 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 412658 % of reads mapped to multiple loci | 2.66% Number of reads mapped to too many loci | 43829 % of reads mapped to too many loci | 0.28% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.60% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 475478 475478 475478 N_multimapping 412658 412658 412658 N_noFeature 281026 14490554 356183 N_ambiguous 140699 1140 73371 UnstrandedReadsAssigned:14210420 PositiveStrandReadsAssigned:140451 NegativeStrandReadsAssigned:14202591 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7171874 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171874-trimmed-pair1.fastq SRR7171874-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,501,505 reads, 14,110,352 reads pseudoaligned [quant] estimated average fragment length: 258.851 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,158 rounds 52401 SRR7171874.ke.tsv 34699 SRR7171874.se.tsv 87100 total ==> SRR7171874.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1760.15 1275 46.815 Potri.005G024800.1.v4.1 1035 777.149 160 13.3058 Potri.004G059700.1.v4.1 961 703.173 7 0.643369 Potri.007G009000.2.v4.1 1416 1158.15 1 0.0558032 Potri.003G141000.2.v4.1 2943 2685.15 428.158 10.3053 Potri.016G087400.1.v4.1 270 68.6661 875 823.549 Potri.015G069301.1.v4.1 564 310.148 0 0 Potri.010G195200.1.v4.1 1773 1515.15 384 16.3795 Potri.012G127500.1.v4.1 977 719.161 4805 431.809 ==> SRR7171874.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 7 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 294 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 450 Potri.001G452600.v4.1 199 SRR7171874 completed mapping pipeline successfully