Starting /dee2/code/volunteer_pipeline.sh SRR7171875 current disk space = 3089353441280 free memory = 1580070072 SRR7171875 SRAfilesize ba5fc546beaeab394ee8637ea2e7817e SRR7171875.sra SRR7171875.sra file validated SRR7171875 is paired end SRR7171875 is conventional basespace SRR7171875 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171875_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.881 32.0 25.0 33.0 18.0 33.0 2 30.2585 31.0 29.0 33.0 25.0 34.0 3 30.844 32.0 31.0 33.0 25.0 33.0 4 32.33725 33.0 32.0 33.0 32.0 34.0 5 32.7275 33.0 33.0 33.0 32.0 34.0 6 36.0275 37.0 36.0 38.0 33.0 38.0 7 37.0495 38.0 37.0 38.0 35.0 38.0 8 37.2535 38.0 38.0 38.0 36.0 38.0 9 37.5415 38.0 38.0 38.0 37.0 38.0 10-14 37.598400000000005 38.0 38.0 38.0 37.8 38.0 15-19 37.59095 38.0 38.0 38.0 37.8 38.0 20-24 37.554899999999996 38.0 38.0 38.0 38.0 38.0 25-29 37.5464 38.0 38.0 38.0 38.0 38.0 30-34 37.5408 38.0 38.0 38.0 37.8 38.0 35-39 37.54774999999999 38.0 38.0 38.0 37.8 38.0 40-44 37.4673 38.0 38.0 38.0 37.2 38.0 45-49 37.4559 38.0 38.0 38.0 37.0 38.0 50-54 37.4298 38.0 38.0 38.0 37.0 38.0 55-59 37.35635 38.0 38.0 38.0 37.0 38.0 60-64 37.353899999999996 38.0 38.0 38.0 37.0 38.0 65-69 37.2481 38.0 38.0 38.0 36.2 38.0 70-74 37.2413 38.0 38.0 38.0 36.2 38.0 75-79 37.16395 38.0 38.0 38.0 36.2 38.0 80-84 37.09754999999999 38.0 38.0 38.0 36.0 38.0 85-89 37.0508 38.0 38.0 38.0 36.0 38.0 90-94 36.94545000000001 38.0 38.0 38.0 36.0 38.0 95-99 36.90915 38.0 38.0 38.0 35.2 38.0 100-104 36.843900000000005 38.0 38.0 38.0 35.0 38.0 105-109 36.687799999999996 38.0 38.0 38.0 34.4 38.0 110-114 36.588350000000005 38.0 38.0 38.0 34.0 38.0 115-119 36.33915 38.0 37.6 38.0 34.0 38.0 120-124 36.3022 38.0 37.2 38.0 33.8 38.0 125-129 35.9837 38.0 36.8 38.0 32.8 38.0 130-134 35.81394999999999 38.0 36.2 38.0 32.0 38.0 135-139 35.618399999999994 38.0 36.0 38.0 31.0 38.0 140-144 35.385450000000006 38.0 36.0 38.0 31.0 38.0 145-149 34.7252 38.0 35.0 38.0 28.2 38.0 150-151 31.920250000000003 36.5 31.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 2.0 16 0.0 17 0.0 18 2.0 19 2.0 20 4.0 21 0.0 22 3.0 23 2.0 24 8.0 25 10.0 26 9.0 27 15.0 28 9.0 29 25.0 30 30.0 31 31.0 32 51.0 33 76.0 34 143.0 35 233.0 36 721.0 37 2623.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.175 13.325000000000001 11.025 35.475 2 21.80545136284071 18.454613653413354 37.23430857714429 22.50562640660165 3 18.95 25.85 26.825 28.375 4 22.425 33.7 23.1 20.775 5 22.7 36.05 23.7 17.549999999999997 6 18.075 36.825 25.7 19.400000000000002 7 13.975000000000001 23.5 43.175000000000004 19.35 8 18.55 22.7 30.049999999999997 28.7 9 18.45 22.975 32.574999999999996 26.0 10-14 20.365 29.759999999999998 26.21 23.665 15-19 21.105 28.055000000000003 28.044999999999998 22.795 20-24 20.419999999999998 27.915 27.97 23.695 25-29 21.13 28.185 27.92 22.765 30-34 20.41 28.055000000000003 27.905 23.630000000000003 35-39 20.474999999999998 27.54 28.17 23.815 40-44 20.93 27.74 27.92 23.41 45-49 20.885 28.175 27.529999999999998 23.41 50-54 20.474999999999998 28.205000000000002 27.66 23.66 55-59 20.794999999999998 28.08 27.615000000000002 23.51 60-64 21.25 27.950000000000003 27.425 23.375 65-69 21.05 28.044999999999998 27.43 23.474999999999998 70-74 21.145 27.355 27.905 23.595 75-79 20.419999999999998 27.950000000000003 27.765 23.865 80-84 20.53 27.810000000000002 28.515 23.145 85-89 20.74 28.08 27.860000000000003 23.32 90-94 21.195 27.894999999999996 27.810000000000002 23.1 95-99 21.275 28.000000000000004 27.334999999999997 23.39 100-104 20.54 27.544999999999998 28.505000000000003 23.41 105-109 21.265 27.315 27.965 23.455000000000002 110-114 21.584999999999997 27.63 27.88 22.905 115-119 21.315 27.54 28.13 23.015 120-124 21.01 27.38 28.384999999999998 23.225 125-129 20.724999999999998 27.939999999999998 27.865000000000002 23.47 130-134 20.815 27.425 28.189999999999998 23.57 135-139 20.64 27.92 27.644999999999996 23.794999999999998 140-144 21.2 27.66 27.505000000000003 23.635 145-149 20.815 28.144999999999996 27.61 23.43 150-151 20.474999999999998 27.9375 28.000000000000004 23.5875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 0.5 23 0.0 24 0.5 25 1.0 26 1.5 27 5.0 28 7.0 29 8.5 30 15.5 31 18.0 32 25.5 33 40.0 34 51.5 35 58.5 36 74.0 37 105.0 38 122.0 39 150.0 40 187.5 41 208.0 42 244.0 43 270.5 44 287.5 45 298.5 46 283.0 47 270.0 48 240.5 49 213.0 50 170.0 51 123.0 52 117.5 53 103.0 54 81.0 55 56.0 56 41.5 57 36.5 58 22.5 59 15.0 60 12.0 61 9.5 62 7.5 63 4.5 64 3.0 65 2.5 66 1.5 67 0.5 68 0.5 69 1.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.92494370778083 99.85000000000001 2 0.07505629221916438 0.15 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.0875 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.16249999999999998 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.2625 0.0 0.0 0.0 0.0 106-107 0.3 0.0 0.0 0.0 0.0 108-109 0.36250000000000004 0.0 0.0 0.0 0.0 110-111 0.4 0.0 0.0 0.0 0.0 112-113 0.42500000000000004 0.0 0.0 0.0 0.0 114-115 0.4625 0.0 0.0 0.0 0.0 116-117 0.475 0.0 0.0 0.0 0.0 118-119 0.6125 0.0 0.0 0.0 0.0 120-121 0.7125 0.0 0.0 0.0 0.0 122-123 0.9 0.0 0.0 0.0 0.0 124-125 1.0 0.0 0.0 0.0 0.0 126-127 1.1125 0.0 0.0 0.0 0.0 128-129 1.2375 0.0 0.0 0.0 0.0 130-131 1.3250000000000002 0.0 0.0 0.0 0.0 132-133 1.5 0.0 0.0 0.0 0.0 134-135 1.6625 0.0 0.0 0.0 0.0 136-137 1.8624999999999998 0.0 0.0 0.0 0.0 138-139 2.1624999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTCAAA 10 0.006830828 145.0 5 >>END_MODULE SRR7171875 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171875_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.10925 33.0 33.0 34.0 33.0 34.0 2 33.19025 34.0 33.0 34.0 33.0 34.0 3 33.281 34.0 33.0 34.0 33.0 34.0 4 33.254 34.0 33.0 34.0 33.0 34.0 5 33.2015 34.0 33.0 34.0 33.0 34.0 6 37.38725 38.0 38.0 38.0 37.0 38.0 7 37.37525 38.0 38.0 38.0 37.0 38.0 8 37.31675 38.0 38.0 38.0 37.0 38.0 9 37.406 38.0 38.0 38.0 37.0 38.0 10-14 37.334649999999996 38.0 38.0 38.0 37.0 38.0 15-19 37.3106 38.0 38.0 38.0 37.0 38.0 20-24 37.3261 38.0 38.0 38.0 37.0 38.0 25-29 37.31210000000001 38.0 38.0 38.0 37.0 38.0 30-34 37.2735 38.0 38.0 38.0 37.0 38.0 35-39 37.11749999999999 38.0 38.0 38.0 37.0 38.0 40-44 37.0368 38.0 38.0 38.0 36.6 38.0 45-49 37.158500000000004 38.0 38.0 38.0 36.6 38.0 50-54 37.134 38.0 38.0 38.0 36.2 38.0 55-59 37.139050000000005 38.0 38.0 38.0 36.4 38.0 60-64 37.08284999999999 38.0 38.0 38.0 36.0 38.0 65-69 37.0202 38.0 38.0 38.0 36.0 38.0 70-74 36.968999999999994 38.0 38.0 38.0 36.0 38.0 75-79 36.91255 38.0 38.0 38.0 36.0 38.0 80-84 36.792199999999994 38.0 38.0 38.0 35.0 38.0 85-89 36.70975 38.0 38.0 38.0 35.0 38.0 90-94 36.63075 38.0 38.0 38.0 34.8 38.0 95-99 36.52415 38.0 38.0 38.0 34.2 38.0 100-104 36.299350000000004 38.0 37.8 38.0 33.8 38.0 105-109 36.22115 38.0 37.2 38.0 34.0 38.0 110-114 36.11015 38.0 37.4 38.0 33.8 38.0 115-119 35.903949999999995 38.0 37.0 38.0 33.0 38.0 120-124 35.6946 38.0 36.8 38.0 32.0 38.0 125-129 35.3931 38.0 36.0 38.0 31.0 38.0 130-134 35.13425 38.0 35.8 38.0 28.6 38.0 135-139 34.8417 38.0 35.0 38.0 28.0 38.0 140-144 34.53055 38.0 35.0 38.0 27.2 38.0 145-149 33.9339 38.0 34.6 38.0 23.4 38.0 150-151 30.287375 36.5 29.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 1.0 4 2.0 5 0.0 6 1.0 7 0.0 8 0.0 9 0.0 10 1.0 11 1.0 12 1.0 13 1.0 14 2.0 15 3.0 16 6.0 17 1.0 18 1.0 19 4.0 20 3.0 21 4.0 22 4.0 23 14.0 24 7.0 25 9.0 26 15.0 27 17.0 28 20.0 29 22.0 30 29.0 31 48.0 32 75.0 33 91.0 34 167.0 35 285.0 36 702.0 37 2460.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.675 17.625 15.125 29.575000000000003 2 23.45 24.25 34.8 17.5 3 20.325 26.575 31.574999999999996 21.525 4 22.775000000000002 34.675 23.925 18.625 5 22.1 37.15 22.45 18.3 6 18.675 37.8 23.425 20.1 7 18.975 18.325 42.575 20.125 8 20.075000000000003 22.95 27.375 29.599999999999998 9 21.7 23.7 28.625 25.974999999999998 10-14 22.24 28.825 26.995 21.94 15-19 22.24 28.449999999999996 28.305000000000003 21.005 20-24 22.275 28.1 27.615000000000002 22.009999999999998 25-29 22.07 28.189999999999998 27.955000000000002 21.785 30-34 22.248911574838612 28.19896912375519 27.333233248261024 22.218886053145173 35-39 22.307962118554894 28.075362028360978 28.421105376559602 21.195570476524527 40-44 22.523833416959356 28.058203712995482 27.691921726041148 21.726041144004014 45-49 22.625 27.52 28.425 21.43 50-54 22.375 28.595 27.900000000000002 21.13 55-59 23.015 28.07 27.805000000000003 21.11 60-64 23.14 27.985 27.665 21.21 65-69 22.89 28.560000000000002 27.08 21.47 70-74 23.075000000000003 28.310000000000002 27.68 20.935000000000002 75-79 23.044999999999998 28.345 27.415 21.195 80-84 22.865 28.065 27.685 21.385 85-89 23.615 28.17 27.245 20.97 90-94 22.965 28.315 27.735 20.985 95-99 23.47 28.52 26.77 21.240000000000002 100-104 24.05 28.249999999999996 26.950000000000003 20.75 105-109 23.325000000000003 28.015 27.79 20.87 110-114 23.080000000000002 28.33 27.405 21.185000000000002 115-119 22.985 27.805000000000003 27.384999999999998 21.825 120-124 23.7 28.345 27.155 20.8 125-129 23.919999999999998 29.17 26.400000000000002 20.51 130-134 23.74 28.265 27.045 20.95 135-139 23.53 28.494999999999997 26.945000000000004 21.029999999999998 140-144 23.76 28.15 27.265 20.825 145-149 24.125 28.194999999999997 26.69 20.990000000000002 150-151 23.9 28.5625 27.500000000000004 20.0375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 0.0 22 0.0 23 1.0 24 2.5 25 3.0 26 5.5 27 5.0 28 5.0 29 8.0 30 10.0 31 12.0 32 18.5 33 30.5 34 41.5 35 51.5 36 68.5 37 109.5 38 129.5 39 153.0 40 199.0 41 245.0 42 283.5 43 307.0 44 300.0 45 274.0 46 276.5 47 276.5 48 239.5 49 191.0 50 166.0 51 149.5 52 113.5 53 78.5 54 59.5 55 51.5 56 46.5 57 25.5 58 12.5 59 12.5 60 11.5 61 6.5 62 4.0 63 4.0 64 3.5 65 2.0 66 1.0 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.08499999999999999 35-39 0.215 40-44 0.35000000000000003 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49723479135244 98.95 2 0.47762694821518353 0.95 3 0.0 0.0 4 0.025138260432378077 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.0875 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.16249999999999998 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.2625 0.0 0.0 0.0 0.0 106-107 0.3 0.0 0.0 0.0 0.0 108-109 0.36250000000000004 0.0 0.0 0.0 0.0 110-111 0.4 0.0 0.0 0.0 0.0 112-113 0.42500000000000004 0.0 0.0 0.0 0.0 114-115 0.4625 0.0 0.0 0.0 0.0 116-117 0.475 0.0 0.0 0.0 0.0 118-119 0.6125 0.0 0.0 0.0 0.0 120-121 0.7125 0.0 0.0 0.0 0.0 122-123 0.8875 0.0 0.0 0.0 0.0 124-125 0.975 0.0 0.0 0.0 0.0 126-127 1.0875 0.0 0.0 0.0 0.0 128-129 1.2 0.0 0.0 0.0 0.0 130-131 1.2999999999999998 0.0 0.0 0.0 0.0 132-133 1.45 0.0 0.0 0.0 0.0 134-135 1.625 0.0 0.0 0.0 0.0 136-137 1.8375 0.0 0.0 0.0 0.0 138-139 2.1375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGCATTC 10 0.006830828 145.0 145 TGCAAAT 10 0.006830828 145.0 9 TTAAGCT 10 0.006830828 145.0 6 >>END_MODULE Read 700968 spots for SRR7171875.sra Written 700968 spots for SRR7171875.sra Read 700968 spots for SRR7171875.sra Written 700968 spots for SRR7171875.sra Read 700968 spots for SRR7171875.sra Written 700968 spots for SRR7171875.sra Read 700968 spots for SRR7171875.sra Written 700968 spots for SRR7171875.sra Read 700968 spots for SRR7171875.sra Written 700968 spots for SRR7171875.sra Read 700968 spots for SRR7171875.sra Written 700968 spots for SRR7171875.sra Read 700968 spots for SRR7171875.sra Written 700968 spots for SRR7171875.sra Read 700968 spots for SRR7171875.sra Written 700968 spots for SRR7171875.sra Read 700968 spots for SRR7171875.sra Written 700968 spots for SRR7171875.sra Read 700968 spots for SRR7171875.sra Written 700968 spots for SRR7171875.sra Read 700968 spots for SRR7171875.sra Written 700968 spots for SRR7171875.sra Read 700968 spots for SRR7171875.sra Written 700968 spots for SRR7171875.sra Read 700968 spots for SRR7171875.sra Written 700968 spots for SRR7171875.sra Read 700968 spots for SRR7171875.sra Written 700968 spots for SRR7171875.sra Read 700968 spots for SRR7171875.sra Written 700968 spots for SRR7171875.sra Read 700968 spots for SRR7171875.sra Written 700968 spots for SRR7171875.sra Read 700968 spots for SRR7171875.sra Written 700968 spots for SRR7171875.sra Read 700982 spots for SRR7171875.sra Written 700982 spots for SRR7171875.sra Read 700968 spots for SRR7171875.sra Written 700968 spots for SRR7171875.sra Read 700968 spots for SRR7171875.sra Written 700968 spots for SRR7171875.sra SRR ids: ['SRR7171875.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bs6_o4nj SRR7171875.sra spots: 14019374 blocks: [[1, 700968], [700969, 1401936], [1401937, 2102904], [2102905, 2803872], [2803873, 3504840], [3504841, 4205808], [4205809, 4906776], [4906777, 5607744], [5607745, 6308712], [6308713, 7009680], [7009681, 7710648], [7710649, 8411616], [8411617, 9112584], [9112585, 9813552], [9813553, 10514520], [10514521, 11215488], [11215489, 11916456], [11916457, 12617424], [12617425, 13318392], [13318393, 14019374]] SRR7171875 file size 4729005 SRR7171875 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171875 SRR7171875_1.fastq SRR7171875_2.fastq Input file: SRR7171875_1.fastq Paired file: SRR7171875_2.fastq trimmed: SRR7171875-trimmed-pair1.fastq, SRR7171875-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 23:02:12 2025 >> started Thu Feb 13 23:02:27 2025 >> done (15.184s) 14019374 read pairs processed; of these: 7242 ( 0.05%) short read pairs filtered out after trimming by size control 5918 ( 0.04%) empty read pairs filtered out after trimming by size control 14006214 (99.91%) read pairs available; of these: 5738715 (40.97%) trimmed read pairs available after processing 8267499 (59.03%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 2 0.00% 20 1 0.00% 21 4 0.00% 22 4 0.00% 23 2 0.00% 24 3 0.00% 25 5 0.00% 26 8 0.00% 27 2 0.00% 28 4 0.00% 29 5 0.00% 30 5 0.00% 31 1 0.00% 32 5 0.00% 33 5 0.00% 34 4 0.00% 35 3 0.00% 36 6 0.00% 37 1 0.00% 38 6 0.00% 39 7 0.00% 40 5 0.00% 41 2 0.00% 42 4 0.00% 43 5 0.00% 44 5 0.00% 45 11 0.00% 46 6 0.00% 47 14 0.00% 48 10 0.00% 49 11 0.00% 50 9 0.00% 51 19 0.00% 52 20 0.00% 53 14 0.00% 54 25 0.00% 55 19 0.00% 56 30 0.00% 57 38 0.00% 58 30 0.00% 59 37 0.00% 60 42 0.00% 61 58 0.00% 62 60 0.00% 63 79 0.00% 64 71 0.00% 65 67 0.00% 66 67 0.00% 67 92 0.00% 68 122 0.00% 69 103 0.00% 70 166 0.00% 71 155 0.00% 72 168 0.00% 73 236 0.00% 74 265 0.00% 75 266 0.00% 76 331 0.00% 77 396 0.00% 78 438 0.00% 79 458 0.00% 80 545 0.00% 81 603 0.00% 82 706 0.01% 83 805 0.01% 84 1224 0.01% 85 1584 0.01% 86 1560 0.01% 87 1813 0.01% 88 1842 0.01% 89 2038 0.01% 90 2189 0.02% 91 2349 0.02% 92 2581 0.02% 93 2735 0.02% 94 2931 0.02% 95 3077 0.02% 96 3175 0.02% 97 3389 0.02% 98 3534 0.03% 99 3917 0.03% 100 4172 0.03% 101 4385 0.03% 102 4817 0.03% 103 5251 0.04% 104 5441 0.04% 105 5792 0.04% 106 6121 0.04% 107 6479 0.05% 108 6873 0.05% 109 7198 0.05% 110 7547 0.05% 111 7829 0.06% 112 8512 0.06% 113 9144 0.07% 114 9543 0.07% 115 10142 0.07% 116 10661 0.08% 117 11130 0.08% 118 11721 0.08% 119 12157 0.09% 120 12872 0.09% 121 13678 0.10% 122 14290 0.10% 123 15313 0.11% 124 15982 0.11% 125 17091 0.12% 126 17844 0.13% 127 18733 0.13% 128 19746 0.14% 129 20527 0.15% 130 22071 0.16% 131 23471 0.17% 132 25177 0.18% 133 27231 0.19% 134 29176 0.21% 135 31025 0.22% 136 33426 0.24% 137 36490 0.26% 138 39797 0.28% 139 43836 0.31% 140 47884 0.34% 141 53904 0.38% 142 61399 0.44% 143 70575 0.50% 144 84453 0.60% 145 104423 0.75% 146 136417 0.97% 147 192584 1.37% 148 311826 2.23% 149 663500 4.74% 150 3332422 23.79% 151 8267499 59.03% 14006214 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.37 fanout-score-rank=33 prefix-density=0.25 prefix-fanout=2.2 sequence=CAGGTGCAGTTTGATCC criterion=fanout-score sequence-density=0.08 sequence-density-rank=22 fanout-score=359.49 fanout-score-rank=1 prefix-density=0.93 prefix-fanout=32.7 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=5.10 fanout-score-rank=16 prefix-density=0.41 prefix-fanout=3.6 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.07 sequence-density-rank=25 fanout-score=242.51 fanout-score-rank=1 prefix-density=0.85 prefix-fanout=21.3 sequence=AGAAGAAGAGAGG SRR7171875 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 23:03:15 Started mapping on | Feb 13 23:03:15 Finished on | Feb 13 23:04:38 Mapping speed, Million of reads per hour | 607.50 Number of input reads | 14006214 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 13325810 Uniquely mapped reads % | 95.14% Average mapped length | 297.40 Number of splices: Total | 14050780 Number of splices: Annotated (sjdb) | 13836090 Number of splices: GT/AG | 13834101 Number of splices: GC/AG | 176031 Number of splices: AT/AC | 10439 Number of splices: Non-canonical | 30209 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.70 Insertion rate per base | 0.02% Insertion average length | 2.68 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 340314 % of reads mapped to multiple loci | 2.43% Number of reads mapped to too many loci | 30065 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.17% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 347996 347996 347996 N_multimapping 340314 340314 340314 N_noFeature 262457 13206210 323145 N_ambiguous 133499 919 73901 UnstrandedReadsAssigned:12929854 PositiveStrandReadsAssigned:118681 NegativeStrandReadsAssigned:12928764 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7171875 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171875-trimmed-pair1.fastq SRR7171875-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,006,214 reads, 12,733,780 reads pseudoaligned [quant] estimated average fragment length: 270.691 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,154 rounds 52401 SRR7171875.ke.tsv 34699 SRR7171875.se.tsv 87100 total ==> SRR7171875.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1748.31 625 27.442 Potri.005G024800.1.v4.1 1035 765.309 157 15.7477 Potri.004G059700.1.v4.1 961 691.334 14 1.55451 Potri.007G009000.2.v4.1 1416 1146.31 0 0 Potri.003G141000.2.v4.1 2943 2673.31 439.233 12.6125 Potri.016G087400.1.v4.1 270 65.0333 1018.53 1202.24 Potri.015G069301.1.v4.1 564 299.912 0 0 Potri.010G195200.1.v4.1 1773 1503.31 98 5.00417 Potri.012G127500.1.v4.1 977 707.321 1953 211.953 ==> SRR7171875.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 31 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 268 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 152 SRR7171875 completed mapping pipeline successfully