Starting /dee2/code/volunteer_pipeline.sh SRR7171876 current disk space = 3111800561664 free memory = 1015749200 SRR7171876 SRAfilesize f959d78574b85df3d7d42b564eb7de07 SRR7171876.sra SRR7171876.sra file validated SRR7171876 is paired end SRR7171876 is conventional basespace SRR7171876 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171876_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.936 32.0 18.0 33.0 18.0 34.0 2 32.1815 33.0 32.0 33.0 28.0 34.0 3 32.27425 33.0 33.0 33.0 30.0 34.0 4 32.938 33.0 33.0 34.0 31.0 34.0 5 33.01675 33.0 33.0 34.0 32.0 34.0 6 36.6975 38.0 37.0 38.0 34.0 38.0 7 37.3335 38.0 38.0 38.0 36.0 38.0 8 37.5395 38.0 38.0 38.0 37.0 38.0 9 37.597 38.0 38.0 38.0 38.0 38.0 10-14 37.64305 38.0 38.0 38.0 38.0 38.0 15-19 37.61024999999999 38.0 38.0 38.0 38.0 38.0 20-24 37.611599999999996 38.0 38.0 38.0 38.0 38.0 25-29 37.549400000000006 38.0 38.0 38.0 38.0 38.0 30-34 37.475249999999996 38.0 38.0 38.0 37.8 38.0 35-39 37.4804 38.0 38.0 38.0 37.6 38.0 40-44 37.47375000000001 38.0 38.0 38.0 37.4 38.0 45-49 37.4345 38.0 38.0 38.0 37.2 38.0 50-54 37.39565 38.0 38.0 38.0 37.0 38.0 55-59 37.2958 38.0 38.0 38.0 37.0 38.0 60-64 37.2279 38.0 38.0 38.0 36.8 38.0 65-69 37.19255 38.0 38.0 38.0 36.0 38.0 70-74 37.12714999999999 38.0 38.0 38.0 36.0 38.0 75-79 37.08194999999999 38.0 38.0 38.0 36.0 38.0 80-84 37.04290000000001 38.0 38.0 38.0 36.0 38.0 85-89 36.9859 38.0 38.0 38.0 35.8 38.0 90-94 36.841150000000006 38.0 38.0 38.0 35.2 38.0 95-99 36.776199999999996 38.0 38.0 38.0 35.0 38.0 100-104 36.69755 38.0 38.0 38.0 34.6 38.0 105-109 36.513450000000006 38.0 38.0 38.0 34.2 38.0 110-114 36.43235 38.0 38.0 38.0 34.0 38.0 115-119 36.27290000000001 38.0 37.8 38.0 33.8 38.0 120-124 36.1432 38.0 37.0 38.0 33.4 38.0 125-129 35.9335 38.0 37.0 38.0 33.0 38.0 130-134 35.660250000000005 38.0 36.2 38.0 31.8 38.0 135-139 35.3619 38.0 36.0 38.0 31.0 38.0 140-144 35.1197 38.0 36.0 38.0 30.6 38.0 145-149 34.6498 38.0 35.2 38.0 28.2 38.0 150-151 31.528374999999997 36.5 31.5 38.0 14.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 1.0 15 3.0 16 1.0 17 1.0 18 1.0 19 2.0 20 3.0 21 2.0 22 6.0 23 2.0 24 13.0 25 9.0 26 15.0 27 13.0 28 17.0 29 22.0 30 30.0 31 36.0 32 56.0 33 76.0 34 132.0 35 212.0 36 669.0 37 2675.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.05 11.825 11.799999999999999 34.325 2 20.810405202601302 16.18309154577289 37.89394697348674 25.11255627813907 3 20.325 22.0 27.525 30.15 4 21.85 29.7 23.1 25.35 5 21.15 33.4 25.0 20.45 6 18.2 35.025 25.6 21.175 7 14.875 23.724999999999998 42.699999999999996 18.7 8 18.05 24.3 31.724999999999998 25.924999999999997 9 18.0 24.575 33.050000000000004 24.375 10-14 19.605 30.19 27.38 22.825 15-19 19.655 28.810000000000002 28.060000000000002 23.474999999999998 20-24 19.865 28.685 27.96 23.49 25-29 20.345 28.95 27.384999999999998 23.32 30-34 20.04 29.134999999999998 27.950000000000003 22.875 35-39 20.685000000000002 28.875 27.52 22.919999999999998 40-44 20.200000000000003 29.304999999999996 27.884999999999998 22.61 45-49 19.89 28.785 28.02 23.305 50-54 20.14 28.499999999999996 27.405 23.955000000000002 55-59 20.064999999999998 28.655 27.97 23.31 60-64 20.345 28.555000000000003 27.150000000000002 23.95 65-69 20.47 28.9 27.060000000000002 23.57 70-74 20.79 28.895 27.58 22.735 75-79 20.064999999999998 28.54 27.74 23.655 80-84 20.285 28.275 27.36 24.08 85-89 20.625 28.12 28.075 23.18 90-94 20.825 28.615000000000002 27.084999999999997 23.474999999999998 95-99 20.825 28.055000000000003 27.839999999999996 23.28 100-104 20.815 28.194999999999997 27.365000000000002 23.625 105-109 21.14 27.860000000000003 27.544999999999998 23.455000000000002 110-114 21.68 27.560000000000002 27.715 23.044999999999998 115-119 20.8 27.92 27.955000000000002 23.325000000000003 120-124 20.544999999999998 27.925 27.61 23.919999999999998 125-129 20.990000000000002 28.07 27.200000000000003 23.74 130-134 20.945 27.685 27.495000000000005 23.875 135-139 21.2 27.51 28.02 23.27 140-144 21.07 27.279999999999998 27.92 23.73 145-149 21.33 27.150000000000002 27.63 23.89 150-151 21.175 29.212500000000002 26.337500000000002 23.275000000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 3.0 1 2.0 2 1.0 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 1.0 20 2.5 21 2.5 22 2.0 23 2.5 24 4.0 25 6.5 26 6.0 27 6.5 28 12.0 29 15.0 30 19.5 31 36.0 32 47.0 33 53.5 34 66.0 35 78.5 36 92.5 37 108.0 38 124.5 39 151.5 40 185.0 41 213.5 42 226.5 43 227.5 44 250.5 45 278.5 46 268.0 47 248.0 48 229.5 49 198.0 50 174.5 51 149.0 52 115.0 53 91.0 54 78.0 55 60.5 56 39.0 57 26.0 58 19.5 59 20.0 60 20.0 61 10.0 62 6.0 63 6.0 64 3.5 65 3.5 66 3.0 67 1.5 68 1.5 69 1.5 70 0.5 71 0.0 72 0.0 73 1.0 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67385850476668 99.325 2 0.3010536879076769 0.6 3 0.025087807325639738 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.3625 0.0 0.0 0.0 0.0 102-103 0.45 0.0 0.0 0.0 0.0 104-105 0.45 0.0 0.0 0.0 0.0 106-107 0.5125 0.0 0.0 0.0 0.0 108-109 0.625 0.0 0.0 0.0 0.0 110-111 0.7124999999999999 0.0 0.0 0.0 0.0 112-113 0.85 0.0 0.0 0.0 0.0 114-115 0.925 0.0 0.0 0.0 0.0 116-117 1.15 0.0 0.0 0.0 0.0 118-119 1.2875 0.0 0.0 0.0 0.0 120-121 1.5625 0.0 0.0 0.0 0.0 122-123 1.8 0.0 0.0 0.0 0.0 124-125 2.025 0.0 0.0 0.0 0.0 126-127 2.2375 0.0 0.0 0.0 0.0 128-129 2.45 0.0 0.0 0.0 0.0 130-131 2.7125 0.0 0.0 0.0 0.0 132-133 2.875 0.0 0.0 0.0 0.0 134-135 3.075 0.0 0.0 0.0 0.0 136-137 3.4125 0.0 0.0 0.0 0.0 138-139 3.7249999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATAATCT 10 0.006830828 145.0 3 >>END_MODULE SRR7171876 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171876_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.082 33.0 33.0 34.0 32.0 34.0 2 33.13625 34.0 33.0 34.0 32.0 34.0 3 33.20075 34.0 33.0 34.0 33.0 34.0 4 33.2225 34.0 33.0 34.0 33.0 34.0 5 33.23 34.0 33.0 34.0 33.0 34.0 6 37.49725 38.0 38.0 38.0 38.0 38.0 7 37.39775 38.0 38.0 38.0 38.0 38.0 8 37.4365 38.0 38.0 38.0 38.0 38.0 9 37.335 38.0 38.0 38.0 37.0 38.0 10-14 37.433899999999994 38.0 38.0 38.0 37.8 38.0 15-19 37.350300000000004 38.0 38.0 38.0 37.2 38.0 20-24 37.34475 38.0 38.0 38.0 37.2 38.0 25-29 37.35325 38.0 38.0 38.0 37.2 38.0 30-34 37.2987 38.0 38.0 38.0 37.0 38.0 35-39 37.24615 38.0 38.0 38.0 37.0 38.0 40-44 37.052800000000005 38.0 38.0 38.0 36.8 38.0 45-49 37.26395000000001 38.0 38.0 38.0 37.0 38.0 50-54 37.1948 38.0 38.0 38.0 37.0 38.0 55-59 37.13375 38.0 38.0 38.0 36.6 38.0 60-64 37.056 38.0 38.0 38.0 36.4 38.0 65-69 37.013850000000005 38.0 38.0 38.0 36.0 38.0 70-74 36.938 38.0 38.0 38.0 36.0 38.0 75-79 36.91345 38.0 38.0 38.0 36.0 38.0 80-84 36.81875 38.0 38.0 38.0 35.8 38.0 85-89 36.758399999999995 38.0 38.0 38.0 35.6 38.0 90-94 36.552200000000006 38.0 38.0 38.0 34.8 38.0 95-99 36.458099999999995 38.0 38.0 38.0 34.2 38.0 100-104 36.32345 38.0 38.0 38.0 34.0 38.0 105-109 36.145799999999994 38.0 38.0 38.0 33.8 38.0 110-114 36.1166 38.0 37.8 38.0 33.8 38.0 115-119 35.922650000000004 38.0 37.2 38.0 33.0 38.0 120-124 35.806349999999995 38.0 37.2 38.0 32.4 38.0 125-129 35.4893 38.0 36.0 38.0 31.0 38.0 130-134 35.11035 38.0 35.8 38.0 29.4 38.0 135-139 34.85455 38.0 35.8 38.0 28.0 38.0 140-144 34.650999999999996 38.0 35.2 38.0 27.8 38.0 145-149 34.00715 38.0 35.0 38.0 24.4 38.0 150-151 30.404125 36.5 29.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 1.0 4 2.0 5 0.0 6 0.0 7 0.0 8 0.0 9 2.0 10 0.0 11 0.0 12 1.0 13 4.0 14 3.0 15 8.0 16 2.0 17 1.0 18 4.0 19 5.0 20 5.0 21 11.0 22 6.0 23 8.0 24 5.0 25 10.0 26 16.0 27 21.0 28 19.0 29 26.0 30 32.0 31 49.0 32 51.0 33 88.0 34 136.0 35 231.0 36 639.0 37 2610.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.975 16.75 15.6 26.674999999999997 2 23.549999999999997 25.224999999999998 33.4 17.825 3 21.125 28.15 29.975 20.75 4 23.799999999999997 34.4 22.025 19.775000000000002 5 25.05 34.975 21.875 18.099999999999998 6 18.75 37.8 24.525 18.925 7 19.825 18.7 40.300000000000004 21.175 8 22.15 22.55 27.875 27.425 9 22.775000000000002 24.25 29.049999999999997 23.925 10-14 23.445 29.005 25.3 22.25 15-19 22.78 28.485 27.255000000000003 21.48 20-24 23.369999999999997 28.53 26.995 21.105 25-29 23.655 28.765 26.384999999999998 21.195 30-34 23.200000000000003 27.825 27.744999999999997 21.23 35-39 23.767376737673768 28.437843784378437 26.72767276727673 21.067106710671066 40-44 23.605472861223873 28.03087255049366 26.602515912394125 21.761138675888336 45-49 23.605 27.655 27.22 21.52 50-54 23.494999999999997 27.735 27.32 21.45 55-59 23.830000000000002 27.82 27.315 21.035 60-64 23.56 27.655 27.384999999999998 21.4 65-69 23.865 27.62 27.08 21.435000000000002 70-74 23.494999999999997 27.72 27.105 21.68 75-79 23.77 28.294999999999998 27.35 20.585 80-84 24.03 27.615000000000002 27.245 21.11 85-89 23.825 27.16 27.96 21.055 90-94 23.055 28.015 27.800000000000004 21.13 95-99 23.375 28.000000000000004 27.845 20.78 100-104 24.295 27.450000000000003 27.250000000000004 21.005 105-109 23.465 27.63 27.715 21.19 110-114 23.919999999999998 27.325 27.805000000000003 20.95 115-119 23.880000000000003 27.565 27.675 20.880000000000003 120-124 24.169999999999998 27.765 27.105 20.96 125-129 23.93 27.825 27.29 20.955 130-134 23.945 27.49 27.744999999999997 20.82 135-139 24.3 27.694999999999997 27.694999999999997 20.31 140-144 24.279999999999998 28.000000000000004 27.525 20.195 145-149 24.349999999999998 28.415000000000003 26.765 20.47 150-151 24.975 27.750000000000004 26.7625 20.5125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 1.0 19 1.5 20 0.5 21 0.0 22 0.0 23 1.0 24 1.5 25 0.5 26 0.0 27 1.5 28 4.5 29 6.0 30 8.5 31 14.0 32 18.5 33 22.0 34 28.5 35 40.5 36 58.5 37 86.5 38 108.0 39 142.0 40 184.5 41 207.0 42 249.0 43 283.5 44 293.0 45 315.5 46 319.0 47 273.5 48 234.5 49 219.5 50 181.0 51 145.0 52 119.0 53 103.5 54 89.5 55 59.0 56 42.0 57 29.5 58 24.5 59 23.5 60 13.0 61 6.5 62 7.0 63 6.5 64 5.0 65 4.0 66 3.5 67 3.0 68 1.5 69 1.0 70 1.0 71 0.5 72 0.5 73 1.5 74 1.0 75 0.0 76 1.0 77 1.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.01 40-44 0.23500000000000001 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72417251755266 99.425 2 0.25075225677031093 0.5 3 0.025075225677031094 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.325 0.0 0.0 0.0 0.0 98-99 0.325 0.0 0.0 0.0 0.0 100-101 0.35 0.0 0.0 0.0 0.0 102-103 0.45 0.0 0.0 0.0 0.0 104-105 0.45 0.0 0.0 0.0 0.0 106-107 0.5125 0.0 0.0 0.0 0.0 108-109 0.625 0.0 0.0 0.0 0.0 110-111 0.7124999999999999 0.0 0.0 0.0 0.0 112-113 0.825 0.0 0.0 0.0 0.0 114-115 0.8999999999999999 0.0 0.0 0.0 0.0 116-117 1.125 0.0 0.0 0.0 0.0 118-119 1.2625000000000002 0.0 0.0 0.0 0.0 120-121 1.55 0.0 0.0 0.0 0.0 122-123 1.8 0.0 0.0 0.0 0.0 124-125 2.0375 0.0 0.0 0.0 0.0 126-127 2.2625 0.0 0.0 0.0 0.0 128-129 2.4749999999999996 0.0 0.0 0.0 0.0 130-131 2.7375 0.0 0.0 0.0 0.0 132-133 2.9000000000000004 0.0 0.0 0.0 0.0 134-135 3.0999999999999996 0.0 0.0 0.0 0.0 136-137 3.4375 0.0 0.0 0.0 0.0 138-139 3.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCAGCAT 10 0.006830828 145.0 9 >>END_MODULE Read 764154 spots for SRR7171876.sra Written 764154 spots for SRR7171876.sra Read 764154 spots for SRR7171876.sra Written 764154 spots for SRR7171876.sra Read 764154 spots for SRR7171876.sra Written 764154 spots for SRR7171876.sra Read 764154 spots for SRR7171876.sra Written 764154 spots for SRR7171876.sra Read 764154 spots for SRR7171876.sra Written 764154 spots for SRR7171876.sra Read 764154 spots for SRR7171876.sra Written 764154 spots for SRR7171876.sra Read 764154 spots for SRR7171876.sra Written 764154 spots for SRR7171876.sra Read 764154 spots for SRR7171876.sra Written 764154 spots for SRR7171876.sra Read 764154 spots for SRR7171876.sra Written 764154 spots for SRR7171876.sra Read 764154 spots for SRR7171876.sra Written 764154 spots for SRR7171876.sra Read 764154 spots for SRR7171876.sra Written 764154 spots for SRR7171876.sra Read 764154 spots for SRR7171876.sra Written 764154 spots for SRR7171876.sra Read 764154 spots for SRR7171876.sra Written 764154 spots for SRR7171876.sra Read 764154 spots for SRR7171876.sra Written 764154 spots for SRR7171876.sra Read 764154 spots for SRR7171876.sra Written 764154 spots for SRR7171876.sra Read 764154 spots for SRR7171876.sra Written 764154 spots for SRR7171876.sra Read 764154 spots for SRR7171876.sra Written 764154 spots for SRR7171876.sra Read 764154 spots for SRR7171876.sra Written 764154 spots for SRR7171876.sra Read 764162 spots for SRR7171876.sra Written 764162 spots for SRR7171876.sra Read 764154 spots for SRR7171876.sra Written 764154 spots for SRR7171876.sra SRR ids: ['SRR7171876.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_h5sx1r_k SRR7171876.sra spots: 15283088 blocks: [[1, 764154], [764155, 1528308], [1528309, 2292462], [2292463, 3056616], [3056617, 3820770], [3820771, 4584924], [4584925, 5349078], [5349079, 6113232], [6113233, 6877386], [6877387, 7641540], [7641541, 8405694], [8405695, 9169848], [9169849, 9934002], [9934003, 10698156], [10698157, 11462310], [11462311, 12226464], [12226465, 12990618], [12990619, 13754772], [13754773, 14518926], [14518927, 15283088]] SRR7171876 file size 5157236 SRR7171876 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171876 SRR7171876_1.fastq SRR7171876_2.fastq Input file: SRR7171876_1.fastq Paired file: SRR7171876_2.fastq trimmed: SRR7171876-trimmed-pair1.fastq, SRR7171876-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 12:26:59 2025 >> started Fri Feb 14 12:27:27 2025 >> done (28.055s) 15283088 read pairs processed; of these: 16311 ( 0.11%) short read pairs filtered out after trimming by size control 10327 ( 0.07%) empty read pairs filtered out after trimming by size control 15256450 (99.83%) read pairs available; of these: 5905588 (38.71%) trimmed read pairs available after processing 9350862 (61.29%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 5 0.00% 20 1 0.00% 21 4 0.00% 22 6 0.00% 23 8 0.00% 24 7 0.00% 25 4 0.00% 26 8 0.00% 27 7 0.00% 28 8 0.00% 29 10 0.00% 30 5 0.00% 31 6 0.00% 32 9 0.00% 33 5 0.00% 34 6 0.00% 35 4 0.00% 36 8 0.00% 37 6 0.00% 38 9 0.00% 39 4 0.00% 40 11 0.00% 41 12 0.00% 42 4 0.00% 43 15 0.00% 44 10 0.00% 45 11 0.00% 46 16 0.00% 47 19 0.00% 48 18 0.00% 49 14 0.00% 50 33 0.00% 51 35 0.00% 52 35 0.00% 53 33 0.00% 54 30 0.00% 55 47 0.00% 56 61 0.00% 57 71 0.00% 58 68 0.00% 59 66 0.00% 60 75 0.00% 61 91 0.00% 62 109 0.00% 63 111 0.00% 64 126 0.00% 65 119 0.00% 66 156 0.00% 67 164 0.00% 68 175 0.00% 69 228 0.00% 70 233 0.00% 71 274 0.00% 72 352 0.00% 73 349 0.00% 74 365 0.00% 75 449 0.00% 76 532 0.00% 77 617 0.00% 78 628 0.00% 79 723 0.00% 80 859 0.01% 81 957 0.01% 82 1068 0.01% 83 1267 0.01% 84 2052 0.01% 85 2680 0.02% 86 2955 0.02% 87 3292 0.02% 88 3723 0.02% 89 3834 0.03% 90 3919 0.03% 91 4180 0.03% 92 4349 0.03% 93 4596 0.03% 94 4940 0.03% 95 5212 0.03% 96 5528 0.04% 97 5908 0.04% 98 6079 0.04% 99 6525 0.04% 100 6972 0.05% 101 7367 0.05% 102 8118 0.05% 103 8616 0.06% 104 9133 0.06% 105 9912 0.06% 106 10572 0.07% 107 10890 0.07% 108 11664 0.08% 109 12229 0.08% 110 13092 0.09% 111 13538 0.09% 112 14508 0.10% 113 15026 0.10% 114 15936 0.10% 115 17054 0.11% 116 17751 0.12% 117 18557 0.12% 118 19187 0.13% 119 20077 0.13% 120 21035 0.14% 121 21843 0.14% 122 22495 0.15% 123 23797 0.16% 124 24666 0.16% 125 25388 0.17% 126 27142 0.18% 127 28138 0.18% 128 29126 0.19% 129 30726 0.20% 130 32088 0.21% 131 33787 0.22% 132 35446 0.23% 133 37636 0.25% 134 39699 0.26% 135 41724 0.27% 136 44584 0.29% 137 47103 0.31% 138 50098 0.33% 139 53813 0.35% 140 57174 0.37% 141 62913 0.41% 142 69682 0.46% 143 78126 0.51% 144 90086 0.59% 145 107181 0.70% 146 134292 0.88% 147 181961 1.19% 148 284907 1.87% 149 583286 3.82% 150 3244906 21.27% 151 9350862 61.29% 15256450 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.72 fanout-score-rank=34 prefix-density=0.20 prefix-fanout=2.5 sequence=CAGGTGCAGTTTGATCC criterion=fanout-score sequence-density=0.09 sequence-density-rank=21 fanout-score=358.76 fanout-score-rank=1 prefix-density=0.93 prefix-fanout=33.8 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=6.40 fanout-score-rank=25 prefix-density=0.32 prefix-fanout=4.0 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.09 sequence-density-rank=17 fanout-score=380.98 fanout-score-rank=1 prefix-density=1.06 prefix-fanout=32.4 sequence=AAGAAGAAGAAA SRR7171876 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 12:28:28 Started mapping on | Feb 14 12:28:28 Finished on | Feb 14 12:30:34 Mapping speed, Million of reads per hour | 435.90 Number of input reads | 15256450 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 14126418 Uniquely mapped reads % | 92.59% Average mapped length | 296.26 Number of splices: Total | 13285910 Number of splices: Annotated (sjdb) | 13026944 Number of splices: GT/AG | 13071344 Number of splices: GC/AG | 165099 Number of splices: AT/AC | 10402 Number of splices: Non-canonical | 39065 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.60 Insertion rate per base | 0.02% Insertion average length | 2.58 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 511365 % of reads mapped to multiple loci | 3.35% Number of reads mapped to too many loci | 65026 % of reads mapped to too many loci | 0.43% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.49% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 636957 636957 636957 N_multimapping 511365 511365 511365 N_noFeature 300709 13980183 361220 N_ambiguous 169030 1041 82698 UnstrandedReadsAssigned:13656679 PositiveStrandReadsAssigned:145194 NegativeStrandReadsAssigned:13682500 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7171876 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171876-trimmed-pair1.fastq SRR7171876-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,256,450 reads, 13,641,344 reads pseudoaligned [quant] estimated average fragment length: 245.652 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,248 rounds 52401 SRR7171876.ke.tsv 34699 SRR7171876.se.tsv 87100 total ==> SRR7171876.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1773.35 1217 42.5284 Potri.005G024800.1.v4.1 1035 790.348 401 31.4419 Potri.004G059700.1.v4.1 961 716.353 45 3.89285 Potri.007G009000.2.v4.1 1416 1171.35 0 0 Potri.003G141000.2.v4.1 2943 2698.35 378.144 8.68443 Potri.016G087400.1.v4.1 270 70.7189 1806 1582.58 Potri.015G069301.1.v4.1 564 321.53 0 0 Potri.010G195200.1.v4.1 1773 1528.35 365.88 14.8354 Potri.012G127500.1.v4.1 977 732.348 3405 288.126 ==> SRR7171876.se.tsv <== Potri.001G166300.v4.1 2 Potri.001G448400.v4.1 30 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 363 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 159 SRR7171876 completed mapping pipeline successfully