Starting /dee2/code/volunteer_pipeline.sh SRR7171877 current disk space = 3110324318208 free memory = 1577879656 SRR7171877 SRAfilesize fc2bcdc29bf17080874c18ac46cefa83 SRR7171877.sra SRR7171877.sra file validated SRR7171877 is paired end SRR7171877 is conventional basespace SRR7171877 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171877_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.40975 33.0 33.0 33.0 32.0 34.0 2 30.139 31.0 29.0 33.0 18.0 34.0 3 30.65725 31.0 31.0 33.0 27.0 33.0 4 30.9375 33.0 31.0 33.0 27.0 33.0 5 32.1165 33.0 33.0 33.0 30.0 34.0 6 35.4295 37.0 35.0 38.0 31.0 38.0 7 36.68425 38.0 37.0 38.0 34.0 38.0 8 37.121 38.0 38.0 38.0 36.0 38.0 9 37.25225 38.0 38.0 38.0 37.0 38.0 10-14 37.36595 38.0 38.0 38.0 37.0 38.0 15-19 37.354549999999996 38.0 38.0 38.0 37.0 38.0 20-24 37.3898 38.0 38.0 38.0 37.0 38.0 25-29 37.33825 38.0 38.0 38.0 37.0 38.0 30-34 37.30155 38.0 38.0 38.0 37.0 38.0 35-39 37.28685 38.0 38.0 38.0 37.0 38.0 40-44 37.29235 38.0 38.0 38.0 37.0 38.0 45-49 37.2039 38.0 38.0 38.0 36.6 38.0 50-54 37.16075 38.0 38.0 38.0 36.2 38.0 55-59 37.1488 38.0 38.0 38.0 36.0 38.0 60-64 37.07885 38.0 38.0 38.0 36.0 38.0 65-69 37.06385 38.0 38.0 38.0 36.0 38.0 70-74 36.9694 38.0 38.0 38.0 35.8 38.0 75-79 36.93605 38.0 38.0 38.0 35.6 38.0 80-84 36.90785 38.0 38.0 38.0 35.6 38.0 85-89 36.799150000000004 38.0 38.0 38.0 35.0 38.0 90-94 36.7047 38.0 38.0 38.0 34.8 38.0 95-99 36.62935 38.0 38.0 38.0 34.4 38.0 100-104 36.53235 38.0 38.0 38.0 34.0 38.0 105-109 36.4371 38.0 38.0 38.0 34.0 38.0 110-114 36.25915 38.0 37.2 38.0 34.0 38.0 115-119 36.1484 38.0 37.0 38.0 33.2 38.0 120-124 36.03985 38.0 37.0 38.0 32.8 38.0 125-129 35.871300000000005 38.0 36.8 38.0 32.6 38.0 130-134 35.58075 38.0 36.0 38.0 31.0 38.0 135-139 35.30695 38.0 36.0 38.0 30.0 38.0 140-144 35.009 38.0 35.6 38.0 28.0 38.0 145-149 34.5886 38.0 35.0 38.0 27.8 38.0 150-151 31.652375 36.5 31.5 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 1.0 15 1.0 16 1.0 17 0.0 18 3.0 19 2.0 20 6.0 21 3.0 22 6.0 23 2.0 24 5.0 25 9.0 26 12.0 27 16.0 28 36.0 29 36.0 30 48.0 31 61.0 32 65.0 33 108.0 34 137.0 35 261.0 36 621.0 37 2558.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.275 17.0 8.975 39.75 2 23.275000000000002 26.275 24.474999999999998 25.974999999999998 3 28.549999999999997 32.475 21.125 17.849999999999998 4 32.4 33.550000000000004 15.75 18.3 5 23.05 38.5 20.8 17.65 6 17.925 39.725 23.275000000000002 19.075 7 13.675 23.025000000000002 43.625 19.675 8 18.2 23.05 29.45 29.299999999999997 9 17.925 22.725 33.050000000000004 26.3 10-14 20.325 29.315 26.435 23.925 15-19 20.535 28.935 27.42 23.11 20-24 20.330000000000002 28.38 27.54 23.75 25-29 20.175 28.7 28.04 23.085 30-34 20.03 29.075 27.725 23.169999999999998 35-39 20.59 28.625 27.229999999999997 23.555 40-44 20.49 28.884999999999998 27.49 23.135 45-49 20.27 28.945 27.534999999999997 23.25 50-54 20.155 28.685 28.03 23.13 55-59 20.705000000000002 29.195 27.089999999999996 23.01 60-64 19.98 28.22 28.244999999999997 23.555 65-69 20.585 28.075 27.845 23.494999999999997 70-74 20.25 28.144999999999996 28.285 23.32 75-79 20.565 28.205000000000002 27.63 23.599999999999998 80-84 20.51 28.645 27.55 23.294999999999998 85-89 20.175 28.435 27.88 23.51 90-94 19.79 28.63 28.294999999999998 23.285 95-99 20.775 28.694999999999997 26.965 23.565 100-104 20.810000000000002 28.23 27.665 23.294999999999998 105-109 20.495 28.43 27.655 23.419999999999998 110-114 20.875 28.315 27.61 23.200000000000003 115-119 21.535 28.505000000000003 27.395000000000003 22.564999999999998 120-124 21.065 28.425 27.450000000000003 23.06 125-129 21.19 28.335 27.200000000000003 23.275000000000002 130-134 19.814999999999998 28.28 28.485 23.419999999999998 135-139 21.195 27.750000000000004 27.525 23.53 140-144 20.465 28.605000000000004 27.37 23.56 145-149 20.630000000000003 28.439999999999998 27.229999999999997 23.7 150-151 20.65 29.062500000000004 26.825 23.4625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 0.0 22 0.0 23 0.5 24 1.0 25 2.0 26 3.5 27 8.0 28 12.5 29 9.5 30 15.5 31 27.0 32 31.0 33 44.5 34 56.5 35 68.0 36 82.5 37 108.0 38 144.0 39 159.5 40 181.5 41 222.5 42 245.5 43 258.0 44 278.0 45 284.5 46 274.0 47 272.5 48 242.5 49 197.5 50 166.5 51 145.5 52 114.5 53 79.5 54 68.5 55 52.5 56 38.0 57 26.5 58 19.0 59 15.0 60 9.5 61 6.0 62 5.0 63 4.5 64 4.5 65 4.0 66 4.5 67 3.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.2375 0.0 0.0 0.0 0.0 100-101 0.2875 0.0 0.0 0.0 0.0 102-103 0.32499999999999996 0.0 0.0 0.0 0.0 104-105 0.35 0.0 0.0 0.0 0.0 106-107 0.3875 0.0 0.0 0.0 0.0 108-109 0.425 0.0 0.0 0.0 0.0 110-111 0.525 0.0 0.0 0.0 0.0 112-113 0.6 0.0 0.0 0.0 0.0 114-115 0.6625000000000001 0.0 0.0 0.0 0.0 116-117 0.8375 0.0 0.0 0.0 0.0 118-119 1.0875 0.0 0.0 0.0 0.0 120-121 1.2375 0.0 0.0 0.0 0.0 122-123 1.4 0.0 0.0 0.0 0.0 124-125 1.5125000000000002 0.0 0.0 0.0 0.0 126-127 1.7125 0.0 0.0 0.0 0.0 128-129 1.9 0.0 0.0 0.0 0.0 130-131 2.0875 0.0 0.0 0.0 0.0 132-133 2.225 0.0 0.0 0.0 0.0 134-135 2.275 0.0 0.0 0.0 0.0 136-137 2.5 0.0 0.0 0.0 0.0 138-139 2.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7171877 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171877_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.82175 33.0 33.0 34.0 32.0 34.0 2 32.85675 33.0 33.0 34.0 32.0 34.0 3 32.899 34.0 33.0 34.0 32.0 34.0 4 32.82625 34.0 33.0 34.0 32.0 34.0 5 32.8735 34.0 33.0 34.0 32.0 34.0 6 36.94075 38.0 38.0 38.0 36.0 38.0 7 36.984 38.0 38.0 38.0 36.0 38.0 8 37.02175 38.0 38.0 38.0 36.0 38.0 9 36.938 38.0 38.0 38.0 36.0 38.0 10-14 36.8615 38.0 38.0 38.0 36.0 38.0 15-19 36.915800000000004 38.0 38.0 38.0 36.0 38.0 20-24 36.896 38.0 38.0 38.0 36.0 38.0 25-29 36.829049999999995 38.0 38.0 38.0 36.0 38.0 30-34 36.79195 38.0 38.0 38.0 35.8 38.0 35-39 36.5371 38.0 38.0 38.0 35.0 38.0 40-44 36.351350000000004 38.0 38.0 38.0 34.2 38.0 45-49 36.5685 38.0 38.0 38.0 34.6 38.0 50-54 36.605599999999995 38.0 38.0 38.0 35.0 38.0 55-59 36.6031 38.0 38.0 38.0 34.8 38.0 60-64 36.57805 38.0 38.0 38.0 35.0 38.0 65-69 36.461800000000004 38.0 38.0 38.0 34.4 38.0 70-74 36.37705 38.0 38.0 38.0 34.0 38.0 75-79 36.36125 38.0 38.0 38.0 34.0 38.0 80-84 36.332899999999995 38.0 38.0 38.0 34.0 38.0 85-89 36.1669 38.0 38.0 38.0 33.6 38.0 90-94 36.0268 38.0 37.8 38.0 33.0 38.0 95-99 35.963899999999995 38.0 37.4 38.0 33.0 38.0 100-104 35.85315 38.0 37.4 38.0 32.2 38.0 105-109 35.75575 38.0 37.0 38.0 31.2 38.0 110-114 35.5067 38.0 37.0 38.0 30.8 38.0 115-119 35.4049 38.0 37.0 38.0 30.6 38.0 120-124 35.2303 38.0 36.2 38.0 29.2 38.0 125-129 34.86215 38.0 36.0 38.0 27.8 38.0 130-134 34.4251 38.0 35.0 38.0 25.0 38.0 135-139 34.286500000000004 38.0 35.0 38.0 24.6 38.0 140-144 33.97705 38.0 35.0 38.0 23.0 38.0 145-149 33.189099999999996 38.0 34.4 38.0 15.8 38.0 150-151 29.471 36.0 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 5.0 4 2.0 5 2.0 6 0.0 7 2.0 8 3.0 9 1.0 10 1.0 11 2.0 12 5.0 13 2.0 14 0.0 15 5.0 16 6.0 17 7.0 18 2.0 19 11.0 20 12.0 21 8.0 22 10.0 23 14.0 24 12.0 25 14.0 26 25.0 27 32.0 28 35.0 29 37.0 30 67.0 31 64.0 32 81.0 33 112.0 34 169.0 35 275.0 36 649.0 37 2324.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.675 16.35 17.75 28.225 2 24.525 22.85 33.6 19.025 3 19.85 27.825 31.45 20.875 4 24.4 35.075 21.9 18.625 5 23.225 36.625 21.825 18.325 6 19.6 36.25 24.3 19.85 7 18.45 18.375 42.85 20.325 8 21.4 21.3 28.225 29.075 9 22.575 24.55 27.775 25.1 10-14 22.57 29.04 26.935 21.455 15-19 22.46 28.235 28.005000000000003 21.3 20-24 22.509999999999998 28.525 28.265 20.7 25-29 22.68 28.24 27.694999999999997 21.385 30-34 23.119247699079633 28.361344537815125 28.056222488995598 20.463185274109644 35-39 22.485563645493347 27.978910369068544 28.701983429575694 20.833542555862415 40-44 23.430645893208286 27.69122170120506 28.245852871476835 20.632279534109816 45-49 23.47 28.000000000000004 28.060000000000002 20.47 50-54 22.575 27.944999999999997 28.15 21.33 55-59 23.035 28.189999999999998 28.315 20.46 60-64 23.1 27.92 28.43 20.549999999999997 65-69 23.095 28.04 27.810000000000002 21.055 70-74 23.810000000000002 28.03 27.544999999999998 20.615 75-79 23.41 27.634999999999998 28.065 20.89 80-84 23.49 27.485 27.72 21.305 85-89 23.315 27.855 28.01 20.82 90-94 23.34 28.12 27.905 20.635 95-99 23.455000000000002 28.48 27.67 20.395 100-104 23.47 27.615000000000002 28.125 20.79 105-109 23.28 28.03 27.97 20.72 110-114 23.62 27.83 27.805000000000003 20.745 115-119 23.485 28.425 27.61 20.48 120-124 23.03 28.275 28.15 20.544999999999998 125-129 23.09 27.955000000000002 28.349999999999998 20.605 130-134 23.445 27.515 28.265 20.775 135-139 23.669999999999998 27.55 27.655 21.125 140-144 24.26 28.625 27.185 19.93 145-149 24.115000000000002 27.655 27.975 20.255000000000003 150-151 23.7375 27.925 27.425 20.9125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 0.5 20 0.5 21 0.0 22 0.5 23 1.0 24 1.0 25 2.0 26 3.5 27 4.0 28 5.0 29 7.0 30 12.0 31 14.5 32 24.0 33 36.0 34 40.0 35 52.0 36 75.0 37 103.5 38 150.0 39 186.5 40 216.5 41 246.5 42 258.0 43 274.5 44 293.0 45 289.5 46 283.0 47 270.0 48 221.0 49 187.0 50 166.5 51 135.0 52 109.5 53 84.0 54 64.0 55 44.5 56 31.0 57 29.0 58 24.0 59 17.0 60 11.0 61 5.5 62 4.0 63 5.0 64 2.5 65 1.5 66 1.5 67 1.5 68 1.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.04 35-39 0.42500000000000004 40-44 0.835 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.7743795437453 99.5 2 0.2005515166708448 0.4 3 0.0 0.0 4 0.0250689395838556 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.2375 0.0 0.0 0.0 0.0 100-101 0.2875 0.0 0.0 0.0 0.0 102-103 0.32499999999999996 0.0 0.0 0.0 0.0 104-105 0.35 0.0 0.0 0.0 0.0 106-107 0.3875 0.0 0.0 0.0 0.0 108-109 0.425 0.0 0.0 0.0 0.0 110-111 0.5375 0.0 0.0 0.0 0.0 112-113 0.625 0.0 0.0 0.0 0.0 114-115 0.6875 0.0 0.0 0.0 0.0 116-117 0.8625 0.0 0.0 0.0 0.0 118-119 1.1125 0.0 0.0 0.0 0.0 120-121 1.2625 0.0 0.0 0.0 0.0 122-123 1.3875 0.0 0.0 0.0 0.0 124-125 1.4874999999999998 0.0 0.0 0.0 0.0 126-127 1.6875 0.0 0.0 0.0 0.0 128-129 1.875 0.0 0.0 0.0 0.0 130-131 2.0625 0.0 0.0 0.0 0.0 132-133 2.2 0.0 0.0 0.0 0.0 134-135 2.25 0.0 0.0 0.0 0.0 136-137 2.4749999999999996 0.0 0.0 0.0 0.0 138-139 2.7874999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTCATC 10 0.0068519996 144.85 5 >>END_MODULE Read 818403 spots for SRR7171877.sra Written 818403 spots for SRR7171877.sra Read 818403 spots for SRR7171877.sra Written 818403 spots for SRR7171877.sra Read 818403 spots for SRR7171877.sra Written 818403 spots for SRR7171877.sra Read 818403 spots for SRR7171877.sra Written 818403 spots for SRR7171877.sra Read 818403 spots for SRR7171877.sra Written 818403 spots for SRR7171877.sra Read 818403 spots for SRR7171877.sra Written 818403 spots for SRR7171877.sra Read 818403 spots for SRR7171877.sra Written 818403 spots for SRR7171877.sra Read 818403 spots for SRR7171877.sra Written 818403 spots for SRR7171877.sra Read 818403 spots for SRR7171877.sra Written 818403 spots for SRR7171877.sra Read 818403 spots for SRR7171877.sra Written 818403 spots for SRR7171877.sra Read 818403 spots for SRR7171877.sra Written 818403 spots for SRR7171877.sra Read 818410 spots for SRR7171877.sra Written 818410 spots for SRR7171877.sra Read 818403 spots for SRR7171877.sra Written 818403 spots for SRR7171877.sra Read 818403 spots for SRR7171877.sra Written 818403 spots for SRR7171877.sra Read 818403 spots for SRR7171877.sra Written 818403 spots for SRR7171877.sra Read 818403 spots for SRR7171877.sra Written 818403 spots for SRR7171877.sra Read 818403 spots for SRR7171877.sra Written 818403 spots for SRR7171877.sra Read 818403 spots for SRR7171877.sra Written 818403 spots for SRR7171877.sra Read 818403 spots for SRR7171877.sra Written 818403 spots for SRR7171877.sra Read 818403 spots for SRR7171877.sra Written 818403 spots for SRR7171877.sra SRR ids: ['SRR7171877.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8ettjesa SRR7171877.sra spots: 16368067 blocks: [[1, 818403], [818404, 1636806], [1636807, 2455209], [2455210, 3273612], [3273613, 4092015], [4092016, 4910418], [4910419, 5728821], [5728822, 6547224], [6547225, 7365627], [7365628, 8184030], [8184031, 9002433], [9002434, 9820836], [9820837, 10639239], [10639240, 11457642], [11457643, 12276045], [12276046, 13094448], [13094449, 13912851], [13912852, 14731254], [14731255, 15549657], [15549658, 16368067]] SRR7171877 file size 5524900 SRR7171877 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171877 SRR7171877_1.fastq SRR7171877_2.fastq Input file: SRR7171877_1.fastq Paired file: SRR7171877_2.fastq trimmed: SRR7171877-trimmed-pair1.fastq, SRR7171877-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 13:26:54 2025 >> started Fri Feb 14 13:27:11 2025 >> done (17.204s) 16368067 read pairs processed; of these: 16941 ( 0.10%) short read pairs filtered out after trimming by size control 10946 ( 0.07%) empty read pairs filtered out after trimming by size control 16340180 (99.83%) read pairs available; of these: 6517907 (39.89%) trimmed read pairs available after processing 9822273 (60.11%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 1 0.00% 20 2 0.00% 21 3 0.00% 22 4 0.00% 23 5 0.00% 24 4 0.00% 25 6 0.00% 26 3 0.00% 27 3 0.00% 28 5 0.00% 29 1 0.00% 30 3 0.00% 31 2 0.00% 32 3 0.00% 33 3 0.00% 34 2 0.00% 35 5 0.00% 36 5 0.00% 37 2 0.00% 38 6 0.00% 39 5 0.00% 40 4 0.00% 41 7 0.00% 42 3 0.00% 43 6 0.00% 44 10 0.00% 45 12 0.00% 46 15 0.00% 47 12 0.00% 48 12 0.00% 49 12 0.00% 50 19 0.00% 51 28 0.00% 52 22 0.00% 53 32 0.00% 54 31 0.00% 55 36 0.00% 56 36 0.00% 57 46 0.00% 58 45 0.00% 59 56 0.00% 60 73 0.00% 61 61 0.00% 62 74 0.00% 63 96 0.00% 64 105 0.00% 65 121 0.00% 66 146 0.00% 67 120 0.00% 68 156 0.00% 69 184 0.00% 70 226 0.00% 71 223 0.00% 72 282 0.00% 73 293 0.00% 74 376 0.00% 75 467 0.00% 76 509 0.00% 77 557 0.00% 78 604 0.00% 79 663 0.00% 80 732 0.00% 81 904 0.01% 82 1059 0.01% 83 1202 0.01% 84 2101 0.01% 85 2643 0.02% 86 2927 0.02% 87 3530 0.02% 88 3517 0.02% 89 3366 0.02% 90 3649 0.02% 91 3837 0.02% 92 4049 0.02% 93 4364 0.03% 94 4465 0.03% 95 4897 0.03% 96 5067 0.03% 97 5316 0.03% 98 5550 0.03% 99 6244 0.04% 100 6538 0.04% 101 6884 0.04% 102 7502 0.05% 103 8011 0.05% 104 8539 0.05% 105 9008 0.06% 106 9420 0.06% 107 10021 0.06% 108 10604 0.06% 109 11234 0.07% 110 11901 0.07% 111 12882 0.08% 112 13443 0.08% 113 14103 0.09% 114 15158 0.09% 115 15750 0.10% 116 16554 0.10% 117 17393 0.11% 118 18074 0.11% 119 18785 0.11% 120 19765 0.12% 121 20585 0.13% 122 21743 0.13% 123 22857 0.14% 124 23977 0.15% 125 25483 0.16% 126 26418 0.16% 127 27746 0.17% 128 29295 0.18% 129 30935 0.19% 130 32992 0.20% 131 34190 0.21% 132 36590 0.22% 133 38982 0.24% 134 41493 0.25% 135 44055 0.27% 136 48076 0.29% 137 50960 0.31% 138 54868 0.34% 139 59352 0.36% 140 65116 0.40% 141 72114 0.44% 142 80616 0.49% 143 92950 0.57% 144 107817 0.66% 145 130258 0.80% 146 164266 1.01% 147 225446 1.38% 148 347829 2.13% 149 702923 4.30% 150 3521129 21.55% 151 9822273 60.11% 16340180 reads passed initial QC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=2.43 fanout-score-rank=23 prefix-density=0.35 prefix-fanout=2.2 sequence=AGTTCATCTCAGACCTCTC criterion=fanout-score sequence-density=0.13 sequence-density-rank=10 fanout-score=26.91 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=9.5 sequence=CCTTCCTTGTCCTGGATCTTGGCCTT criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=2.94 fanout-score-rank=22 prefix-density=0.56 prefix-fanout=2.9 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=39.58 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=7.0 sequence=ACCAGCTTGAGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTTATCCTATTTT SRR7171877 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 13:28:11 Started mapping on | Feb 14 13:28:11 Finished on | Feb 14 13:31:19 Mapping speed, Million of reads per hour | 312.90 Number of input reads | 16340180 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 14669817 Uniquely mapped reads % | 89.78% Average mapped length | 295.70 Number of splices: Total | 14752393 Number of splices: Annotated (sjdb) | 14447969 Number of splices: GT/AG | 14505491 Number of splices: GC/AG | 185518 Number of splices: AT/AC | 11612 Number of splices: Non-canonical | 49772 Mismatch rate per base, % | 0.76% Deletion rate per base | 0.06% Deletion average length | 3.06 Insertion rate per base | 0.04% Insertion average length | 2.79 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 461540 % of reads mapped to multiple loci | 2.82% Number of reads mapped to too many loci | 31960 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.13% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1225332 1225332 1225332 N_multimapping 461540 461540 461540 N_noFeature 372319 14540312 425424 N_ambiguous 170307 703 93656 UnstrandedReadsAssigned:14127191 PositiveStrandReadsAssigned:128802 NegativeStrandReadsAssigned:14150737 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7171877 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171877-trimmed-pair1.fastq SRR7171877-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,340,180 reads, 13,719,510 reads pseudoaligned [quant] estimated average fragment length: 257.163 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,024 rounds 52401 SRR7171877.ke.tsv 34699 SRR7171877.se.tsv 87100 total ==> SRR7171877.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1761.84 1304 54.244 Potri.005G024800.1.v4.1 1035 778.837 600 56.4604 Potri.004G059700.1.v4.1 961 704.859 15 1.55966 Potri.007G009000.2.v4.1 1416 1159.84 0 0 Potri.003G141000.2.v4.1 2943 2686.84 859.759 23.4517 Potri.016G087400.1.v4.1 270 68.974 829.566 881.466 Potri.015G069301.1.v4.1 564 311.811 0 0 Potri.010G195200.1.v4.1 1773 1516.84 247 11.9343 Potri.012G127500.1.v4.1 977 720.843 4031 409.838 ==> SRR7171877.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 84 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 209 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 138 SRR7171877 completed mapping pipeline successfully