Starting /dee2/code/volunteer_pipeline.sh SRR7171878 current disk space = 3111397888000 free memory = 1302008996 SRR7171878 SRAfilesize 05a66b6b1967decc288a855f2fece9a0 SRR7171878.sra SRR7171878.sra file validated SRR7171878 is paired end SRR7171878 is conventional basespace SRR7171878 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171878_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.1755 32.0 25.0 33.0 18.0 33.0 2 29.69725 31.0 29.0 33.0 25.0 34.0 3 31.0615 32.0 32.0 33.0 27.0 33.0 4 31.43175 33.0 32.0 33.0 27.0 33.0 5 32.47825 33.0 32.0 33.0 32.0 33.0 6 36.4855 38.0 37.0 38.0 34.0 38.0 7 37.0085 38.0 37.0 38.0 35.0 38.0 8 37.422 38.0 38.0 38.0 37.0 38.0 9 37.603 38.0 38.0 38.0 38.0 38.0 10-14 37.64694999999999 38.0 38.0 38.0 38.0 38.0 15-19 37.62605 38.0 38.0 38.0 38.0 38.0 20-24 37.61659999999999 38.0 38.0 38.0 38.0 38.0 25-29 37.61749999999999 38.0 38.0 38.0 38.0 38.0 30-34 37.5952 38.0 38.0 38.0 38.0 38.0 35-39 37.55884999999999 38.0 38.0 38.0 37.8 38.0 40-44 37.54725 38.0 38.0 38.0 37.6 38.0 45-49 37.47175 38.0 38.0 38.0 37.0 38.0 50-54 37.4788 38.0 38.0 38.0 37.0 38.0 55-59 37.427299999999995 38.0 38.0 38.0 37.0 38.0 60-64 37.356649999999995 38.0 38.0 38.0 37.0 38.0 65-69 37.3224 38.0 38.0 38.0 36.4 38.0 70-74 37.27735 38.0 38.0 38.0 36.4 38.0 75-79 37.204750000000004 38.0 38.0 38.0 36.0 38.0 80-84 37.14135 38.0 38.0 38.0 36.0 38.0 85-89 37.05285 38.0 38.0 38.0 36.0 38.0 90-94 36.99635 38.0 38.0 38.0 36.0 38.0 95-99 36.9505 38.0 38.0 38.0 35.4 38.0 100-104 36.86895 38.0 38.0 38.0 35.0 38.0 105-109 36.6981 38.0 38.0 38.0 34.6 38.0 110-114 36.623900000000006 38.0 38.0 38.0 34.4 38.0 115-119 36.37865 38.0 37.6 38.0 34.0 38.0 120-124 36.299350000000004 38.0 37.8 38.0 34.0 38.0 125-129 36.045249999999996 38.0 37.0 38.0 32.8 38.0 130-134 35.753499999999995 38.0 36.0 38.0 31.8 38.0 135-139 35.6193 38.0 36.0 38.0 31.2 38.0 140-144 35.40894999999999 38.0 36.0 38.0 31.0 38.0 145-149 34.97045 38.0 35.2 38.0 29.8 38.0 150-151 31.87325 36.5 31.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 0.0 15 0.0 16 1.0 17 0.0 18 1.0 19 1.0 20 4.0 21 4.0 22 3.0 23 4.0 24 6.0 25 5.0 26 3.0 27 10.0 28 13.0 29 15.0 30 32.0 31 47.0 32 47.0 33 91.0 34 105.0 35 256.0 36 717.0 37 2634.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.575 11.899999999999999 11.899999999999999 35.625 2 22.5 16.075 36.125 25.3 3 19.825 23.025000000000002 26.650000000000002 30.5 4 21.85 29.275000000000002 23.95 24.925 5 21.0 32.574999999999996 25.6 20.825 6 18.875 34.725 25.974999999999998 20.424999999999997 7 14.149999999999999 23.9 43.275000000000006 18.675 8 18.425 23.974999999999998 30.7 26.900000000000002 9 19.0 23.525 32.75 24.725 10-14 19.98 29.665000000000003 27.275 23.080000000000002 15-19 20.225 28.315 27.925 23.535 20-24 20.51 28.46 27.525 23.505000000000003 25-29 20.45 28.655 28.04 22.855 30-34 20.419999999999998 28.15 27.66 23.77 35-39 20.724999999999998 28.64 27.26 23.375 40-44 20.505000000000003 28.575 27.62 23.3 45-49 20.630000000000003 28.945 27.6 22.825 50-54 20.585 28.415000000000003 27.325 23.674999999999997 55-59 20.005 28.625 27.58 23.79 60-64 20.585 28.165000000000003 27.700000000000003 23.549999999999997 65-69 20.43 28.749999999999996 26.939999999999998 23.880000000000003 70-74 20.41 27.55 28.16 23.880000000000003 75-79 20.52 28.595 27.63 23.255 80-84 20.36 28.000000000000004 27.500000000000004 24.14 85-89 20.77 27.73 28.38 23.119999999999997 90-94 20.71 27.905 27.639999999999997 23.745 95-99 21.245 28.060000000000002 28.035 22.66 100-104 20.794999999999998 28.110000000000003 27.595 23.5 105-109 20.765 27.465 28.189999999999998 23.580000000000002 110-114 20.925 28.215 27.38 23.48 115-119 21.0 27.639999999999997 27.994999999999997 23.365 120-124 20.775 27.985 27.834999999999997 23.405 125-129 20.630000000000003 27.950000000000003 27.544999999999998 23.875 130-134 21.195 28.235 27.205000000000002 23.365 135-139 20.86 27.284999999999997 27.85 24.005000000000003 140-144 21.279999999999998 27.884999999999998 27.48 23.355 145-149 21.265 27.825 27.500000000000004 23.41 150-151 20.8875 28.6125 26.35 24.15 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 0.5 21 0.5 22 1.5 23 2.5 24 3.0 25 2.0 26 2.0 27 4.5 28 11.5 29 18.0 30 20.0 31 27.5 32 34.5 33 39.5 34 47.0 35 60.0 36 91.0 37 113.0 38 126.0 39 149.5 40 183.0 41 217.5 42 231.5 43 249.5 44 268.0 45 289.5 46 291.0 47 253.5 48 231.5 49 200.0 50 159.5 51 147.5 52 127.0 53 84.0 54 63.0 55 59.0 56 46.5 57 32.5 58 25.0 59 23.0 60 15.0 61 11.5 62 9.0 63 6.5 64 8.5 65 4.5 66 0.5 67 1.0 68 1.0 69 1.5 70 2.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.92494370778083 99.85000000000001 2 0.07505629221916438 0.15 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.2625 0.0 0.0 0.0 0.0 98-99 0.30000000000000004 0.0 0.0 0.0 0.0 100-101 0.3375 0.0 0.0 0.0 0.0 102-103 0.3875 0.0 0.0 0.0 0.0 104-105 0.475 0.0 0.0 0.0 0.0 106-107 0.5625 0.0 0.0 0.0 0.0 108-109 0.6125 0.0 0.0 0.0 0.0 110-111 0.75 0.0 0.0 0.0 0.0 112-113 0.9125 0.0 0.0 0.0 0.0 114-115 1.025 0.0 0.0 0.0 0.0 116-117 1.1625 0.0 0.0 0.0 0.0 118-119 1.25 0.0 0.0 0.0 0.0 120-121 1.425 0.0 0.0 0.0 0.0 122-123 1.6625 0.0 0.0 0.0 0.0 124-125 1.9375 0.0 0.0 0.0 0.0 126-127 2.3 0.0 0.0 0.0 0.0 128-129 2.5999999999999996 0.0 0.0 0.0 0.0 130-131 2.8 0.0 0.0 0.0 0.0 132-133 3.0999999999999996 0.0 0.0 0.0 0.0 134-135 3.3625 0.0 0.0 0.0 0.0 136-137 3.7375 0.0 0.0 0.0 0.0 138-139 4.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGTCAG 10 0.006830828 145.0 2 >>END_MODULE SRR7171878 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171878_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.14475 33.0 33.0 34.0 33.0 34.0 2 33.199 34.0 33.0 34.0 33.0 34.0 3 33.25975 34.0 33.0 34.0 33.0 34.0 4 33.21625 34.0 33.0 34.0 33.0 34.0 5 33.18875 34.0 33.0 34.0 33.0 34.0 6 37.38475 38.0 38.0 38.0 38.0 38.0 7 37.398 38.0 38.0 38.0 37.0 38.0 8 37.3475 38.0 38.0 38.0 37.0 38.0 9 37.4025 38.0 38.0 38.0 37.0 38.0 10-14 37.331 38.0 38.0 38.0 37.4 38.0 15-19 37.3399 38.0 38.0 38.0 37.0 38.0 20-24 37.32785 38.0 38.0 38.0 37.0 38.0 25-29 37.33015 38.0 38.0 38.0 37.0 38.0 30-34 37.26655 38.0 38.0 38.0 37.0 38.0 35-39 37.10515 38.0 38.0 38.0 37.0 38.0 40-44 37.030150000000006 38.0 38.0 38.0 37.0 38.0 45-49 37.2064 38.0 38.0 38.0 37.0 38.0 50-54 37.172399999999996 38.0 38.0 38.0 36.8 38.0 55-59 37.174400000000006 38.0 38.0 38.0 36.8 38.0 60-64 37.106100000000005 38.0 38.0 38.0 36.6 38.0 65-69 37.08585 38.0 38.0 38.0 36.2 38.0 70-74 37.035000000000004 38.0 38.0 38.0 36.0 38.0 75-79 36.975049999999996 38.0 38.0 38.0 36.0 38.0 80-84 36.88565 38.0 38.0 38.0 35.8 38.0 85-89 36.786249999999995 38.0 38.0 38.0 35.0 38.0 90-94 36.7382 38.0 38.0 38.0 35.0 38.0 95-99 36.61795000000001 38.0 38.0 38.0 34.8 38.0 100-104 36.41565 38.0 38.0 38.0 34.2 38.0 105-109 36.299400000000006 38.0 38.0 38.0 34.0 38.0 110-114 36.22625 38.0 38.0 38.0 34.0 38.0 115-119 36.0742 38.0 37.2 38.0 33.4 38.0 120-124 35.808299999999996 38.0 37.0 38.0 32.2 38.0 125-129 35.58565 38.0 36.2 38.0 31.0 38.0 130-134 35.354749999999996 38.0 36.0 38.0 31.0 38.0 135-139 35.09565 38.0 36.0 38.0 29.0 38.0 140-144 34.88595 38.0 35.2 38.0 28.2 38.0 145-149 34.384750000000004 38.0 34.8 38.0 27.6 38.0 150-151 30.762875 36.5 29.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 1.0 4 0.0 5 2.0 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 0.0 15 3.0 16 4.0 17 5.0 18 3.0 19 3.0 20 6.0 21 8.0 22 3.0 23 8.0 24 5.0 25 15.0 26 9.0 27 17.0 28 21.0 29 17.0 30 34.0 31 35.0 32 50.0 33 94.0 34 139.0 35 265.0 36 605.0 37 2638.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.25 17.599999999999998 16.950000000000003 28.199999999999996 2 23.3 25.45 33.6 17.65 3 22.375 27.725 29.275000000000002 20.625 4 24.099999999999998 34.125 22.2 19.575 5 24.125 35.85 23.599999999999998 16.425 6 20.9 37.35 23.974999999999998 17.775 7 18.85 19.25 41.775 20.125 8 22.0 22.05 27.35 28.599999999999998 9 22.15 26.5 27.500000000000004 23.849999999999998 10-14 22.645 29.175 26.435 21.745 15-19 23.615 27.625 27.485 21.275 20-24 23.165 28.360000000000003 27.644999999999996 20.830000000000002 25-29 22.81 28.24 27.675 21.275 30-34 22.90748898678414 28.053664397276734 27.718261914297155 21.32058470164197 35-39 22.92032292032292 28.125156696585268 27.703956275384844 21.250564107706964 40-44 23.423604481736422 27.478269607596843 27.634025021353565 21.46410088931317 45-49 23.485 28.655 26.995 20.865000000000002 50-54 23.315 28.199999999999996 27.889999999999997 20.595 55-59 23.16 27.73 27.82 21.29 60-64 23.119999999999997 27.800000000000004 27.565 21.515 65-69 23.945 27.905 27.685 20.465 70-74 23.175 27.665 27.894999999999996 21.265 75-79 23.65 27.68 27.48 21.19 80-84 23.905 28.375 27.125 20.595 85-89 23.465 27.750000000000004 27.295 21.490000000000002 90-94 23.189999999999998 29.03 27.205000000000002 20.575 95-99 23.630000000000003 28.235 27.334999999999997 20.8 100-104 24.474999999999998 28.08 27.150000000000002 20.294999999999998 105-109 23.48 28.12 27.644999999999996 20.755000000000003 110-114 22.975 28.38 27.715 20.93 115-119 23.724999999999998 28.24 27.450000000000003 20.585 120-124 23.79 27.639999999999997 27.839999999999996 20.73 125-129 24.185000000000002 28.26 27.24 20.315 130-134 23.91 28.199999999999996 27.88 20.01 135-139 24.560000000000002 28.215 26.86 20.365 140-144 24.175 27.839999999999996 27.474999999999998 20.51 145-149 24.845 27.625 27.21 20.32 150-151 24.6125 27.85 27.212500000000002 20.325 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.0 23 0.5 24 2.0 25 1.5 26 3.0 27 6.5 28 6.0 29 10.5 30 14.0 31 15.5 32 19.0 33 27.0 34 42.5 35 51.5 36 70.0 37 96.5 38 129.5 39 152.5 40 184.0 41 228.0 42 268.0 43 284.5 44 284.0 45 298.0 46 281.0 47 258.0 48 233.5 49 196.0 50 173.0 51 145.0 52 111.0 53 89.5 54 78.0 55 64.5 56 49.5 57 37.0 58 25.0 59 15.0 60 12.5 61 11.5 62 7.0 63 5.0 64 2.0 65 2.0 66 2.5 67 1.0 68 1.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.12 35-39 0.28500000000000003 40-44 0.485 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49748743718592 99.0 2 0.5025125628140703 1.0 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0125 0.0 28-29 0.0 0.0 0.0 0.025 0.0 30-31 0.0 0.0 0.0 0.025 0.0 32-33 0.0 0.0 0.0 0.025 0.0 34-35 0.0 0.0 0.0 0.025 0.0 36-37 0.0 0.0 0.0 0.025 0.0 38-39 0.0 0.0 0.0 0.025 0.0 40-41 0.0 0.0 0.0 0.025 0.0 42-43 0.0 0.0 0.0 0.025 0.0 44-45 0.0 0.0 0.0 0.025 0.0 46-47 0.0 0.0 0.0 0.025 0.0 48-49 0.0 0.0 0.0 0.025 0.0 50-51 0.0 0.0 0.0 0.025 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.025 0.0 0.0 0.025 0.0 60-61 0.025 0.0 0.0 0.025 0.0 62-63 0.025 0.0 0.0 0.025 0.0 64-65 0.025 0.0 0.0 0.025 0.0 66-67 0.05 0.0 0.0 0.025 0.0 68-69 0.05 0.0 0.0 0.025 0.0 70-71 0.05 0.0 0.0 0.025 0.0 72-73 0.05 0.0 0.0 0.025 0.0 74-75 0.05 0.0 0.0 0.025 0.0 76-77 0.05 0.0 0.0 0.025 0.0 78-79 0.05 0.0 0.0 0.025 0.0 80-81 0.05 0.0 0.0 0.025 0.0 82-83 0.05 0.0 0.0 0.025 0.0 84-85 0.075 0.0 0.0 0.025 0.0 86-87 0.1125 0.0 0.0 0.025 0.0 88-89 0.175 0.0 0.0 0.025 0.0 90-91 0.2 0.0 0.0 0.025 0.0 92-93 0.21250000000000002 0.0 0.0 0.025 0.0 94-95 0.225 0.0 0.0 0.025 0.0 96-97 0.25 0.0 0.0 0.025 0.0 98-99 0.275 0.0 0.0 0.025 0.0 100-101 0.3125 0.0 0.0 0.025 0.0 102-103 0.3625 0.0 0.0 0.025 0.0 104-105 0.45 0.0 0.0 0.025 0.0 106-107 0.5375000000000001 0.0 0.0 0.025 0.0 108-109 0.5875 0.0 0.0 0.025 0.0 110-111 0.7250000000000001 0.0 0.0 0.025 0.0 112-113 0.8875 0.0 0.0 0.025 0.0 114-115 1.0125 0.0 0.0 0.025 0.0 116-117 1.1625 0.0 0.0 0.025 0.0 118-119 1.25 0.0 0.0 0.025 0.0 120-121 1.425 0.0 0.0 0.025 0.0 122-123 1.6625 0.0 0.0 0.025 0.0 124-125 1.9625 0.0 0.0 0.025 0.0 126-127 2.325 0.0 0.0 0.025 0.0 128-129 2.6500000000000004 0.0 0.0 0.025 0.0 130-131 2.825 0.0 0.0 0.025 0.0 132-133 3.0999999999999996 0.0 0.0 0.025 0.0 134-135 3.3375000000000004 0.0 0.0 0.025 0.0 136-137 3.7375 0.0 0.0 0.025 0.0 138-139 4.050000000000001 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 782977 spots for SRR7171878.sra Written 782977 spots for SRR7171878.sra Read 782977 spots for SRR7171878.sra Written 782977 spots for SRR7171878.sra Read 782977 spots for SRR7171878.sra Written 782977 spots for SRR7171878.sra Read 782977 spots for SRR7171878.sra Written 782977 spots for SRR7171878.sra Read 782977 spots for SRR7171878.sra Written 782977 spots for SRR7171878.sra Read 782977 spots for SRR7171878.sra Written 782977 spots for SRR7171878.sra Read 782977 spots for SRR7171878.sra Written 782977 spots for SRR7171878.sra Read 782977 spots for SRR7171878.sra Written 782977 spots for SRR7171878.sra Read 782977 spots for SRR7171878.sra Written 782977 spots for SRR7171878.sra Read 782977 spots for SRR7171878.sra Written 782977 spots for SRR7171878.sra Read 782977 spots for SRR7171878.sra Written 782977 spots for SRR7171878.sra Read 782977 spots for SRR7171878.sra Written 782977 spots for SRR7171878.sra Read 782977 spots for SRR7171878.sra Written 782977 spots for SRR7171878.sra Read 782977 spots for SRR7171878.sra Written 782977 spots for SRR7171878.sra Read 782977 spots for SRR7171878.sra Written 782977 spots for SRR7171878.sra Read 782977 spots for SRR7171878.sra Written 782977 spots for SRR7171878.sra Read 782977 spots for SRR7171878.sra Written 782977 spots for SRR7171878.sra Read 782977 spots for SRR7171878.sra Written 782977 spots for SRR7171878.sra Read 782981 spots for SRR7171878.sra Written 782981 spots for SRR7171878.sra Read 782977 spots for SRR7171878.sra Written 782977 spots for SRR7171878.sra SRR ids: ['SRR7171878.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ilq97u0q SRR7171878.sra spots: 15659544 blocks: [[1, 782977], [782978, 1565954], [1565955, 2348931], [2348932, 3131908], [3131909, 3914885], [3914886, 4697862], [4697863, 5480839], [5480840, 6263816], [6263817, 7046793], [7046794, 7829770], [7829771, 8612747], [8612748, 9395724], [9395725, 10178701], [10178702, 10961678], [10961679, 11744655], [11744656, 12527632], [12527633, 13310609], [13310610, 14093586], [14093587, 14876563], [14876564, 15659544]] SRR7171878 file size 5284805 SRR7171878 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171878 SRR7171878_1.fastq SRR7171878_2.fastq Input file: SRR7171878_1.fastq Paired file: SRR7171878_2.fastq trimmed: SRR7171878-trimmed-pair1.fastq, SRR7171878-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 12:31:53 2025 >> started Fri Feb 14 12:32:12 2025 >> done (19.445s) 15659544 read pairs processed; of these: 13998 ( 0.09%) short read pairs filtered out after trimming by size control 10461 ( 0.07%) empty read pairs filtered out after trimming by size control 15635085 (99.84%) read pairs available; of these: 6611904 (42.29%) trimmed read pairs available after processing 9023181 (57.71%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 1 0.00% 20 3 0.00% 21 4 0.00% 22 3 0.00% 23 2 0.00% 24 5 0.00% 25 3 0.00% 26 7 0.00% 27 8 0.00% 28 2 0.00% 29 6 0.00% 30 4 0.00% 31 3 0.00% 32 4 0.00% 33 3 0.00% 34 4 0.00% 35 4 0.00% 36 5 0.00% 37 8 0.00% 38 13 0.00% 39 8 0.00% 40 8 0.00% 41 11 0.00% 42 14 0.00% 43 13 0.00% 44 12 0.00% 45 11 0.00% 46 13 0.00% 47 23 0.00% 48 21 0.00% 49 21 0.00% 50 32 0.00% 51 23 0.00% 52 25 0.00% 53 31 0.00% 54 39 0.00% 55 39 0.00% 56 50 0.00% 57 55 0.00% 58 60 0.00% 59 71 0.00% 60 75 0.00% 61 80 0.00% 62 81 0.00% 63 83 0.00% 64 103 0.00% 65 128 0.00% 66 145 0.00% 67 155 0.00% 68 204 0.00% 69 211 0.00% 70 233 0.00% 71 271 0.00% 72 291 0.00% 73 359 0.00% 74 370 0.00% 75 433 0.00% 76 555 0.00% 77 560 0.00% 78 625 0.00% 79 747 0.00% 80 796 0.01% 81 891 0.01% 82 1076 0.01% 83 1279 0.01% 84 1996 0.01% 85 2548 0.02% 86 2695 0.02% 87 2858 0.02% 88 3149 0.02% 89 3268 0.02% 90 3445 0.02% 91 3776 0.02% 92 4084 0.03% 93 4303 0.03% 94 4849 0.03% 95 5053 0.03% 96 5410 0.03% 97 5647 0.04% 98 6010 0.04% 99 6403 0.04% 100 6881 0.04% 101 7201 0.05% 102 7893 0.05% 103 8737 0.06% 104 9100 0.06% 105 9862 0.06% 106 10334 0.07% 107 10818 0.07% 108 11477 0.07% 109 12109 0.08% 110 12646 0.08% 111 13415 0.09% 112 14258 0.09% 113 15199 0.10% 114 15845 0.10% 115 16652 0.11% 116 17707 0.11% 117 18419 0.12% 118 19134 0.12% 119 19803 0.13% 120 20758 0.13% 121 21633 0.14% 122 22914 0.15% 123 23635 0.15% 124 25064 0.16% 125 26599 0.17% 126 28063 0.18% 127 28904 0.18% 128 30381 0.19% 129 31745 0.20% 130 33201 0.21% 131 34735 0.22% 132 36754 0.24% 133 39309 0.25% 134 42088 0.27% 135 44229 0.28% 136 46852 0.30% 137 49895 0.32% 138 53699 0.34% 139 57703 0.37% 140 61652 0.39% 141 67997 0.43% 142 76178 0.49% 143 86301 0.55% 144 101036 0.65% 145 121969 0.78% 146 155409 0.99% 147 215789 1.38% 148 340806 2.18% 149 713859 4.57% 150 3639335 23.28% 151 9023181 57.71% 15635085 reads passed initial QC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=2.20 fanout-score-rank=29 prefix-density=0.38 prefix-fanout=2.1 sequence=CAGGTGCAGTTTGATCCACA criterion=fanout-score sequence-density=0.19 sequence-density-rank=5 fanout-score=11.62 fanout-score-rank=1 prefix-density=0.73 prefix-fanout=3.1 sequence=TTGCAGCCACTGCC criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=2.61 fanout-score-rank=23 prefix-density=0.47 prefix-fanout=2.6 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.11 sequence-density-rank=24 fanout-score=27.77 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=9.8 sequence=GAGGTTGAGTACAGGTGCTTTGTTGG SRR7171878 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 12:33:42 Started mapping on | Feb 14 12:33:42 Finished on | Feb 14 12:36:46 Mapping speed, Million of reads per hour | 305.90 Number of input reads | 15635085 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 14100217 Uniquely mapped reads % | 90.18% Average mapped length | 296.27 Number of splices: Total | 13606848 Number of splices: Annotated (sjdb) | 13316907 Number of splices: GT/AG | 13378460 Number of splices: GC/AG | 179729 Number of splices: AT/AC | 11907 Number of splices: Non-canonical | 36752 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.58 Insertion rate per base | 0.02% Insertion average length | 2.59 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 379893 % of reads mapped to multiple loci | 2.43% Number of reads mapped to too many loci | 80222 % of reads mapped to too many loci | 0.51% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.75% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1168593 1168593 1168593 N_multimapping 379893 379893 379893 N_noFeature 409842 13951000 487610 N_ambiguous 156079 1061 83885 UnstrandedReadsAssigned:13534296 PositiveStrandReadsAssigned:148156 NegativeStrandReadsAssigned:13528722 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7171878 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171878-trimmed-pair1.fastq SRR7171878-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,635,085 reads, 13,433,502 reads pseudoaligned [quant] estimated average fragment length: 246.307 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,137 rounds 52401 SRR7171878.ke.tsv 34699 SRR7171878.se.tsv 87100 total ==> SRR7171878.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1772.69 1503 59.8352 Potri.005G024800.1.v4.1 1035 789.693 242 21.6266 Potri.004G059700.1.v4.1 961 715.704 27 2.66233 Potri.007G009000.2.v4.1 1416 1170.69 0 0 Potri.003G141000.2.v4.1 2943 2697.69 569.2 14.8903 Potri.016G087400.1.v4.1 270 71.3884 662 654.428 Potri.015G069301.1.v4.1 564 321.239 0 0 Potri.010G195200.1.v4.1 1773 1527.69 827.935 38.2465 Potri.012G127500.1.v4.1 977 731.698 10996 1060.56 ==> SRR7171878.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 31 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 435 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 234 SRR7171878 completed mapping pipeline successfully