Starting /dee2/code/volunteer_pipeline.sh SRR7171879 current disk space = 3110891995136 free memory = 1574001324 SRR7171879 SRAfilesize 75ef338077d1733761680104e76547c8 SRR7171879.sra SRR7171879.sra file validated SRR7171879 is paired end SRR7171879 is conventional basespace SRR7171879 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171879_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.0705 33.0 32.0 33.0 31.0 33.0 2 29.408 31.0 28.0 33.0 18.0 34.0 3 29.92125 31.0 29.0 33.0 25.0 33.0 4 30.22075 31.0 29.0 33.0 25.0 33.0 5 31.83825 33.0 31.0 33.0 29.0 33.0 6 35.8475 37.0 36.0 38.0 31.0 38.0 7 36.842 38.0 37.0 38.0 35.0 38.0 8 37.0645 38.0 38.0 38.0 36.0 38.0 9 37.32875 38.0 38.0 38.0 37.0 38.0 10-14 37.38735 38.0 38.0 38.0 37.0 38.0 15-19 37.4074 38.0 38.0 38.0 37.0 38.0 20-24 37.4116 38.0 38.0 38.0 37.0 38.0 25-29 37.3741 38.0 38.0 38.0 37.0 38.0 30-34 37.34705 38.0 38.0 38.0 37.0 38.0 35-39 37.33245 38.0 38.0 38.0 37.0 38.0 40-44 37.30565 38.0 38.0 38.0 37.0 38.0 45-49 37.25295 38.0 38.0 38.0 37.0 38.0 50-54 37.2109 38.0 38.0 38.0 36.6 38.0 55-59 37.14125 38.0 38.0 38.0 36.0 38.0 60-64 37.105149999999995 38.0 38.0 38.0 36.0 38.0 65-69 37.0634 38.0 38.0 38.0 36.0 38.0 70-74 37.00205 38.0 38.0 38.0 36.0 38.0 75-79 36.97595 38.0 38.0 38.0 36.0 38.0 80-84 36.923199999999994 38.0 38.0 38.0 35.6 38.0 85-89 36.88844999999999 38.0 38.0 38.0 35.4 38.0 90-94 36.82084999999999 38.0 38.0 38.0 35.0 38.0 95-99 36.759 38.0 38.0 38.0 35.0 38.0 100-104 36.57275 38.0 38.0 38.0 34.4 38.0 105-109 36.4899 38.0 38.0 38.0 34.0 38.0 110-114 36.32424999999999 38.0 37.4 38.0 34.0 38.0 115-119 36.22775 38.0 37.2 38.0 33.6 38.0 120-124 36.06570000000001 38.0 37.0 38.0 33.0 38.0 125-129 35.8752 38.0 36.8 38.0 32.6 38.0 130-134 35.63615 38.0 36.0 38.0 31.0 38.0 135-139 35.416700000000006 38.0 36.0 38.0 30.6 38.0 140-144 35.079449999999994 38.0 35.8 38.0 29.2 38.0 145-149 34.66615 38.0 35.2 38.0 27.8 38.0 150-151 31.89675 36.5 32.0 38.0 14.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 0.0 7 1.0 8 0.0 9 1.0 10 0.0 11 1.0 12 0.0 13 1.0 14 0.0 15 0.0 16 0.0 17 0.0 18 2.0 19 1.0 20 7.0 21 1.0 22 5.0 23 2.0 24 8.0 25 14.0 26 13.0 27 24.0 28 19.0 29 31.0 30 39.0 31 60.0 32 59.0 33 97.0 34 137.0 35 249.0 36 660.0 37 2567.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.075 17.549999999999997 6.950000000000001 38.425 2 21.275 29.099999999999998 23.05 26.575 3 30.25 29.675 18.5 21.575 4 32.925 32.375 13.575000000000001 21.125 5 23.425 39.175 21.025 16.375 6 17.65 38.05 24.55 19.75 7 13.675 22.900000000000002 42.95 20.474999999999998 8 18.975 21.725 29.875 29.425 9 19.05 22.625 31.624999999999996 26.700000000000003 10-14 20.165 29.65 25.979999999999997 24.205 15-19 20.200000000000003 28.744999999999997 27.389999999999997 23.665 20-24 20.325 28.27 27.365000000000002 24.04 25-29 20.175 28.64 27.91 23.275000000000002 30-34 20.18 29.095 27.439999999999998 23.285 35-39 19.72 29.035 27.400000000000002 23.845 40-44 20.615 28.854999999999997 27.185 23.345 45-49 20.31 28.810000000000002 26.93 23.95 50-54 20.615 28.15 27.07 24.165 55-59 20.27 29.095 27.075 23.56 60-64 20.09 29.43 26.8 23.68 65-69 20.175 28.43 27.595 23.799999999999997 70-74 20.155 27.77 27.98 24.095 75-79 20.895 27.994999999999997 27.435 23.674999999999997 80-84 20.505000000000003 27.439999999999998 27.744999999999997 24.310000000000002 85-89 20.34 28.050000000000004 28.294999999999998 23.315 90-94 20.62 28.310000000000002 27.650000000000002 23.419999999999998 95-99 21.065 28.1 27.139999999999997 23.695 100-104 20.91 27.975 27.224999999999998 23.89 105-109 20.68 27.529999999999998 27.975 23.815 110-114 21.29 28.16 27.435 23.115 115-119 21.060000000000002 28.13 27.575 23.235 120-124 21.265 27.245 27.465 24.025 125-129 20.794999999999998 27.35 27.725 24.13 130-134 21.135 28.349999999999998 27.005000000000003 23.51 135-139 20.805 27.905 27.165 24.125 140-144 21.38 27.82 27.01 23.79 145-149 20.53 27.82 27.63 24.02 150-151 20.6375 28.425 26.387500000000003 24.55 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 1.0 21 1.5 22 2.0 23 2.0 24 2.0 25 2.0 26 2.0 27 4.0 28 6.5 29 8.0 30 16.5 31 24.0 32 23.5 33 33.0 34 50.5 35 63.0 36 82.5 37 94.0 38 111.0 39 149.5 40 182.5 41 208.5 42 243.0 43 254.0 44 261.5 45 284.5 46 281.0 47 275.0 48 256.0 49 212.0 50 180.5 51 158.0 52 130.0 53 103.5 54 76.5 55 52.5 56 37.5 57 30.0 58 24.5 59 17.0 60 13.0 61 11.0 62 7.5 63 5.0 64 3.5 65 3.0 66 1.5 67 1.5 68 2.5 69 2.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69887076537015 99.325 2 0.27603513174404015 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.02509410288582183 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCGGGATTGAGCTTCGTTCACGGTGATGTTACGGCCATCGAGGTCCTGAC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.1125 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.3 0.0 0.0 0.0 0.0 108-109 0.4125 0.0 0.0 0.0 0.0 110-111 0.44999999999999996 0.0 0.0 0.0 0.0 112-113 0.5 0.0 0.0 0.0 0.0 114-115 0.5125 0.0 0.0 0.0 0.0 116-117 0.5875 0.0 0.0 0.0 0.0 118-119 0.7 0.0 0.0 0.0 0.0 120-121 0.85 0.0 0.0 0.0 0.0 122-123 1.0125 0.0 0.0 0.0 0.0 124-125 1.15 0.0 0.0 0.0 0.0 126-127 1.225 0.0 0.0 0.0 0.0 128-129 1.4125 0.0 0.0 0.0 0.0 130-131 1.525 0.0 0.0 0.0 0.0 132-133 1.7875 0.0 0.0 0.0 0.0 134-135 2.0125 0.0 0.0 0.0 0.0 136-137 2.2249999999999996 0.0 0.0 0.0 0.0 138-139 2.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGAATAG 10 0.006830828 145.0 1 GAATAGC 10 0.006830828 145.0 2 >>END_MODULE SRR7171879 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171879_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.94525 33.0 33.0 34.0 32.0 34.0 2 33.038 34.0 33.0 34.0 32.0 34.0 3 33.04825 34.0 33.0 34.0 32.0 34.0 4 32.9915 34.0 33.0 34.0 32.0 34.0 5 33.00425 34.0 33.0 34.0 32.0 34.0 6 37.125 38.0 38.0 38.0 37.0 38.0 7 37.1805 38.0 38.0 38.0 37.0 38.0 8 37.26925 38.0 38.0 38.0 37.0 38.0 9 37.25175 38.0 38.0 38.0 37.0 38.0 10-14 37.12195 38.0 38.0 38.0 36.4 38.0 15-19 37.085049999999995 38.0 38.0 38.0 36.2 38.0 20-24 37.120450000000005 38.0 38.0 38.0 36.4 38.0 25-29 37.121950000000005 38.0 38.0 38.0 36.6 38.0 30-34 37.04585 38.0 38.0 38.0 36.2 38.0 35-39 36.87670000000001 38.0 38.0 38.0 36.0 38.0 40-44 36.71825 38.0 38.0 38.0 35.8 38.0 45-49 36.94445 38.0 38.0 38.0 35.8 38.0 50-54 36.911699999999996 38.0 38.0 38.0 35.8 38.0 55-59 36.93205 38.0 38.0 38.0 36.0 38.0 60-64 36.845 38.0 38.0 38.0 35.8 38.0 65-69 36.7665 38.0 38.0 38.0 35.2 38.0 70-74 36.645 38.0 38.0 38.0 34.8 38.0 75-79 36.61985 38.0 38.0 38.0 34.6 38.0 80-84 36.5927 38.0 38.0 38.0 34.2 38.0 85-89 36.4974 38.0 38.0 38.0 34.0 38.0 90-94 36.38255 38.0 38.0 38.0 34.0 38.0 95-99 36.2686 38.0 38.0 38.0 33.8 38.0 100-104 36.2053 38.0 37.8 38.0 33.6 38.0 105-109 36.03175 38.0 37.0 38.0 33.2 38.0 110-114 35.8798 38.0 37.0 38.0 32.4 38.0 115-119 35.7032 38.0 37.0 38.0 31.4 38.0 120-124 35.57835 38.0 36.4 38.0 31.0 38.0 125-129 35.303450000000005 38.0 36.0 38.0 29.4 38.0 130-134 34.90865 38.0 35.4 38.0 28.0 38.0 135-139 34.6528 38.0 35.0 38.0 26.8 38.0 140-144 34.36525 38.0 35.0 38.0 25.8 38.0 145-149 33.73635 38.0 35.0 38.0 22.6 38.0 150-151 30.497625 36.5 29.5 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 2.0 6 0.0 7 1.0 8 2.0 9 0.0 10 1.0 11 0.0 12 3.0 13 1.0 14 0.0 15 2.0 16 4.0 17 4.0 18 2.0 19 4.0 20 7.0 21 4.0 22 10.0 23 11.0 24 15.0 25 14.0 26 22.0 27 30.0 28 32.0 29 35.0 30 49.0 31 68.0 32 81.0 33 102.0 34 153.0 35 291.0 36 646.0 37 2403.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.1 15.875 14.975 31.05 2 23.200000000000003 24.375 35.025 17.4 3 20.95 27.075 30.75 21.224999999999998 4 25.074999999999996 34.375 21.475 19.075 5 23.875 37.775 21.975 16.375 6 17.4 39.0 23.875 19.725 7 18.8 16.825000000000003 41.675000000000004 22.7 8 20.225 22.375 27.775 29.625 9 23.275000000000002 23.9 28.125 24.7 10-14 22.919999999999998 28.294999999999998 26.334999999999997 22.45 15-19 23.57 27.345000000000002 27.779999999999998 21.305 20-24 22.645 28.09 27.825 21.44 25-29 23.095 28.189999999999998 27.639999999999997 21.075 30-34 23.104620924184836 27.975595119023804 27.785557111422282 21.134226845369074 35-39 23.276121650105388 28.36495031616983 27.36625514403292 20.99267288969186 40-44 23.947845348368908 28.221908981071287 27.174788562223117 20.655457108336687 45-49 23.575 27.66 27.639999999999997 21.125 50-54 23.455000000000002 28.01 27.694999999999997 20.84 55-59 23.080000000000002 27.825 27.72 21.375 60-64 23.985 28.055000000000003 27.345000000000002 20.615 65-69 23.855 28.23 27.58 20.335 70-74 23.965 27.725 27.229999999999997 21.08 75-79 23.445 28.084999999999997 26.905 21.565 80-84 23.505000000000003 27.834999999999997 27.425 21.235 85-89 23.87 27.525 27.82 20.785 90-94 23.580000000000002 27.805000000000003 27.48 21.135 95-99 23.395 28.199999999999996 27.55 20.855 100-104 23.665 27.805000000000003 27.034999999999997 21.495 105-109 23.580000000000002 27.785 27.85 20.785 110-114 23.76 28.04 27.189999999999998 21.01 115-119 23.555 27.88 27.58 20.985 120-124 23.49 27.305 27.92 21.285 125-129 23.64 27.52 28.044999999999998 20.794999999999998 130-134 24.32 28.13 27.224999999999998 20.325 135-139 23.799999999999997 27.860000000000003 27.725 20.615 140-144 24.08 27.82 27.155 20.945 145-149 24.65 27.61 26.85 20.89 150-151 24.9875 27.3375 27.762500000000003 19.9125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 0.5 23 0.5 24 0.5 25 0.5 26 3.5 27 4.5 28 4.0 29 6.0 30 4.5 31 7.5 32 13.0 33 24.5 34 38.5 35 52.0 36 76.0 37 101.0 38 122.5 39 147.5 40 179.0 41 225.5 42 260.5 43 267.5 44 277.0 45 286.5 46 294.5 47 277.0 48 255.5 49 237.5 50 187.0 51 149.0 52 124.5 53 85.0 54 69.0 55 57.5 56 36.0 57 32.5 58 23.0 59 16.5 60 17.5 61 12.5 62 7.0 63 5.0 64 4.0 65 2.0 66 1.0 67 0.0 68 1.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.02 35-39 0.37 40-44 0.6799999999999999 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52261306532664 99.02499999999999 2 0.4522613065326633 0.8999999999999999 3 0.02512562814070352 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.1125 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.3 0.0 0.0 0.0 0.0 108-109 0.4125 0.0 0.0 0.0 0.0 110-111 0.44999999999999996 0.0 0.0 0.0 0.0 112-113 0.5 0.0 0.0 0.0 0.0 114-115 0.5125 0.0 0.0 0.0 0.0 116-117 0.5875 0.0 0.0 0.0 0.0 118-119 0.7 0.0 0.0 0.0 0.0 120-121 0.85 0.0 0.0 0.0 0.0 122-123 1.0 0.0 0.0 0.0 0.0 124-125 1.125 0.0 0.0 0.0 0.0 126-127 1.2000000000000002 0.0 0.0 0.0 0.0 128-129 1.3875000000000002 0.0 0.0 0.0 0.0 130-131 1.5 0.0 0.0 0.0 0.0 132-133 1.7625 0.0 0.0 0.0 0.0 134-135 1.95 0.0 0.0 0.0 0.0 136-137 2.1500000000000004 0.0 0.0 0.0 0.0 138-139 2.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCTTAT 10 0.006830828 145.0 5 >>END_MODULE Read 703438 spots for SRR7171879.sra Written 703438 spots for SRR7171879.sra Read 703438 spots for SRR7171879.sra Written 703438 spots for SRR7171879.sra Read 703438 spots for SRR7171879.sra Written 703438 spots for SRR7171879.sra Read 703438 spots for SRR7171879.sra Written 703438 spots for SRR7171879.sra Read 703438 spots for SRR7171879.sra Written 703438 spots for SRR7171879.sra Read 703438 spots for SRR7171879.sra Written 703438 spots for SRR7171879.sra Read 703438 spots for SRR7171879.sra Written 703438 spots for SRR7171879.sra Read 703438 spots for SRR7171879.sra Written 703438 spots for SRR7171879.sra Read 703438 spots for SRR7171879.sra Written 703438 spots for SRR7171879.sra Read 703438 spots for SRR7171879.sra Written 703438 spots for SRR7171879.sra Read 703438 spots for SRR7171879.sra Written 703438 spots for SRR7171879.sra Read 703438 spots for SRR7171879.sra Written 703438 spots for SRR7171879.sra Read 703438 spots for SRR7171879.sra Written 703438 spots for SRR7171879.sra Read 703438 spots for SRR7171879.sra Written 703438 spots for SRR7171879.sra Read 703438 spots for SRR7171879.sra Written 703438 spots for SRR7171879.sra Read 703438 spots for SRR7171879.sra Written 703438 spots for SRR7171879.sra Read 703438 spots for SRR7171879.sra Written 703438 spots for SRR7171879.sra Read 703438 spots for SRR7171879.sra Written 703438 spots for SRR7171879.sra Read 703438 spots for SRR7171879.sra Written 703438 spots for SRR7171879.sra Read 703438 spots for SRR7171879.sra Written 703438 spots for SRR7171879.sra SRR ids: ['SRR7171879.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_sznfl6zs SRR7171879.sra spots: 14068760 blocks: [[1, 703438], [703439, 1406876], [1406877, 2110314], [2110315, 2813752], [2813753, 3517190], [3517191, 4220628], [4220629, 4924066], [4924067, 5627504], [5627505, 6330942], [6330943, 7034380], [7034381, 7737818], [7737819, 8441256], [8441257, 9144694], [9144695, 9848132], [9848133, 10551570], [10551571, 11255008], [11255009, 11958446], [11958447, 12661884], [12661885, 13365322], [13365323, 14068760]] SRR7171879 file size 4745740 SRR7171879 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171879 SRR7171879_1.fastq SRR7171879_2.fastq Input file: SRR7171879_1.fastq Paired file: SRR7171879_2.fastq trimmed: SRR7171879-trimmed-pair1.fastq, SRR7171879-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 13:55:49 2025 >> started Fri Feb 14 13:56:06 2025 >> done (16.474s) 14068760 read pairs processed; of these: 8082 ( 0.06%) short read pairs filtered out after trimming by size control 5498 ( 0.04%) empty read pairs filtered out after trimming by size control 14055180 (99.90%) read pairs available; of these: 5496658 (39.11%) trimmed read pairs available after processing 8558522 (60.89%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 8 0.00% 21 2 0.00% 22 4 0.00% 23 3 0.00% 24 2 0.00% 25 0 0.00% 26 4 0.00% 27 2 0.00% 28 1 0.00% 29 2 0.00% 30 4 0.00% 31 4 0.00% 32 2 0.00% 33 1 0.00% 34 7 0.00% 35 1 0.00% 36 4 0.00% 37 4 0.00% 38 6 0.00% 39 5 0.00% 40 3 0.00% 41 7 0.00% 42 7 0.00% 43 10 0.00% 44 12 0.00% 45 3 0.00% 46 6 0.00% 47 11 0.00% 48 10 0.00% 49 5 0.00% 50 15 0.00% 51 15 0.00% 52 15 0.00% 53 19 0.00% 54 26 0.00% 55 18 0.00% 56 29 0.00% 57 33 0.00% 58 35 0.00% 59 44 0.00% 60 52 0.00% 61 65 0.00% 62 66 0.00% 63 95 0.00% 64 98 0.00% 65 72 0.00% 66 106 0.00% 67 94 0.00% 68 132 0.00% 69 170 0.00% 70 176 0.00% 71 166 0.00% 72 223 0.00% 73 247 0.00% 74 306 0.00% 75 315 0.00% 76 435 0.00% 77 438 0.00% 78 454 0.00% 79 511 0.00% 80 562 0.00% 81 725 0.01% 82 813 0.01% 83 915 0.01% 84 1412 0.01% 85 1784 0.01% 86 1882 0.01% 87 2561 0.02% 88 2630 0.02% 89 2436 0.02% 90 2564 0.02% 91 2650 0.02% 92 2935 0.02% 93 3120 0.02% 94 3333 0.02% 95 3513 0.02% 96 3763 0.03% 97 4048 0.03% 98 4279 0.03% 99 4393 0.03% 100 4805 0.03% 101 5115 0.04% 102 5383 0.04% 103 5762 0.04% 104 6310 0.04% 105 6546 0.05% 106 6906 0.05% 107 7373 0.05% 108 7700 0.05% 109 8269 0.06% 110 8812 0.06% 111 9372 0.07% 112 9895 0.07% 113 10304 0.07% 114 11016 0.08% 115 11806 0.08% 116 12258 0.09% 117 12831 0.09% 118 13574 0.10% 119 14105 0.10% 120 14430 0.10% 121 15471 0.11% 122 16027 0.11% 123 17087 0.12% 124 18121 0.13% 125 19045 0.14% 126 20063 0.14% 127 21180 0.15% 128 21842 0.16% 129 23146 0.16% 130 24686 0.18% 131 26307 0.19% 132 28174 0.20% 133 29719 0.21% 134 31731 0.23% 135 34149 0.24% 136 37360 0.27% 137 39641 0.28% 138 42697 0.30% 139 46816 0.33% 140 51336 0.37% 141 56340 0.40% 142 64451 0.46% 143 73756 0.52% 144 87939 0.63% 145 106095 0.75% 146 136047 0.97% 147 187297 1.33% 148 294859 2.10% 149 604764 4.30% 150 3073012 21.86% 151 8558522 60.89% 14055180 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=3.52 fanout-score-rank=28 prefix-density=0.19 prefix-fanout=2.9 sequence=GCATCTCTCATTGCCTTCTC criterion=fanout-score sequence-density=0.13 sequence-density-rank=4 fanout-score=302.98 fanout-score-rank=1 prefix-density=1.12 prefix-fanout=34.9 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=3.54 fanout-score-rank=36 prefix-density=0.22 prefix-fanout=2.9 sequence=TTTAGCCAGTACGGTGAAATCATCGATTCGAAGATTATAAA criterion=fanout-score sequence-density=0.11 sequence-density-rank=10 fanout-score=228.31 fanout-score-rank=1 prefix-density=0.91 prefix-fanout=26.6 sequence=GAAGAAGAAGAAA SRR7171879 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 13:57:45 Started mapping on | Feb 14 13:57:46 Finished on | Feb 14 13:59:17 Mapping speed, Million of reads per hour | 556.03 Number of input reads | 14055180 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 13232661 Uniquely mapped reads % | 94.15% Average mapped length | 297.09 Number of splices: Total | 14343709 Number of splices: Annotated (sjdb) | 14143972 Number of splices: GT/AG | 14123080 Number of splices: GC/AG | 178880 Number of splices: AT/AC | 9503 Number of splices: Non-canonical | 32246 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.52 Insertion rate per base | 0.02% Insertion average length | 2.65 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 347328 % of reads mapped to multiple loci | 2.47% Number of reads mapped to too many loci | 54947 % of reads mapped to too many loci | 0.39% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.90% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 484479 484479 484479 N_multimapping 347328 347328 347328 N_noFeature 222019 13123630 272654 N_ambiguous 114293 954 55128 UnstrandedReadsAssigned:12896349 PositiveStrandReadsAssigned:108077 NegativeStrandReadsAssigned:12904879 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7171879 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171879-trimmed-pair1.fastq SRR7171879-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,055,180 reads, 12,778,247 reads pseudoaligned [quant] estimated average fragment length: 260.704 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,129 rounds 52401 SRR7171879.ke.tsv 34699 SRR7171879.se.tsv 87100 total ==> SRR7171879.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1758.3 468 18.3817 Potri.005G024800.1.v4.1 1035 775.296 120 10.6892 Potri.004G059700.1.v4.1 961 701.303 19 1.87103 Potri.007G009000.2.v4.1 1416 1156.3 0 0 Potri.003G141000.2.v4.1 2943 2683.3 296 7.61824 Potri.016G087400.1.v4.1 270 66.2198 1452.51 1514.83 Potri.015G069301.1.v4.1 564 308.536 0 0 Potri.010G195200.1.v4.1 1773 1513.3 97 4.42669 Potri.012G127500.1.v4.1 977 717.303 1609 154.912 ==> SRR7171879.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 7 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 181 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 1 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 59 SRR7171879 completed mapping pipeline successfully