Starting /dee2/code/volunteer_pipeline.sh SRR7171880 current disk space = 3088752472064 free memory = 1424373112 SRR7171880 SRAfilesize 9e83fd97ab747b2772ec6ef44a59356c SRR7171880.sra SRR7171880.sra file validated SRR7171880 is paired end SRR7171880 is conventional basespace SRR7171880 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171880_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.73175 33.0 33.0 34.0 32.0 34.0 2 33.06625 33.0 33.0 34.0 31.0 34.0 3 32.481 33.0 33.0 34.0 31.0 34.0 4 32.534 33.0 33.0 34.0 31.0 34.0 5 31.91925 33.0 32.0 33.0 31.0 34.0 6 36.389 38.0 36.0 38.0 34.0 38.0 7 36.5735 38.0 37.0 38.0 34.0 38.0 8 37.45125 38.0 38.0 38.0 37.0 38.0 9 37.574 38.0 38.0 38.0 37.0 38.0 10-14 37.52935 38.0 38.0 38.0 37.0 38.0 15-19 37.56545 38.0 38.0 38.0 37.4 38.0 20-24 37.53405 38.0 38.0 38.0 37.4 38.0 25-29 37.491 38.0 38.0 38.0 37.0 38.0 30-34 37.4914 38.0 38.0 38.0 37.0 38.0 35-39 37.45465 38.0 38.0 38.0 37.0 38.0 40-44 37.4054 38.0 38.0 38.0 37.0 38.0 45-49 37.3777 38.0 38.0 38.0 37.0 38.0 50-54 37.3091 38.0 38.0 38.0 37.0 38.0 55-59 37.25034999999999 38.0 38.0 38.0 37.0 38.0 60-64 37.1836 38.0 38.0 38.0 36.0 38.0 65-69 37.08565 38.0 38.0 38.0 36.0 38.0 70-74 37.077999999999996 38.0 38.0 38.0 36.0 38.0 75-79 36.998450000000005 38.0 38.0 38.0 36.0 38.0 80-84 36.97425 38.0 38.0 38.0 35.8 38.0 85-89 36.89135 38.0 38.0 38.0 35.2 38.0 90-94 36.79675 38.0 38.0 38.0 35.0 38.0 95-99 36.70425 38.0 38.0 38.0 34.8 38.0 100-104 36.536649999999995 38.0 38.0 38.0 34.0 38.0 105-109 36.4118 38.0 38.0 38.0 34.0 38.0 110-114 36.20625 38.0 37.2 38.0 33.8 38.0 115-119 36.076499999999996 38.0 37.0 38.0 33.2 38.0 120-124 35.849849999999996 38.0 37.0 38.0 31.6 38.0 125-129 35.90415 38.0 37.0 38.0 32.6 38.0 130-134 35.503600000000006 38.0 36.0 38.0 31.0 38.0 135-139 35.17955 38.0 35.8 38.0 29.4 38.0 140-144 34.7786 38.0 35.2 38.0 27.8 38.0 145-149 34.38439999999999 38.0 35.0 38.0 27.6 38.0 150-151 31.280749999999998 36.5 31.5 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 1.0 18 3.0 19 3.0 20 5.0 21 4.0 22 3.0 23 6.0 24 9.0 25 11.0 26 10.0 27 16.0 28 18.0 29 27.0 30 28.0 31 41.0 32 66.0 33 86.0 34 148.0 35 279.0 36 702.0 37 2530.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.03400850212553 15.95398849712428 11.852963240810203 36.159039759939986 2 21.2 21.65 34.849999999999994 22.3 3 19.6 27.55 25.275 27.575 4 23.0 34.025 21.45 21.525 5 22.275 35.825 23.95 17.95 6 17.95 36.7 24.325 21.025 7 13.4 22.45 43.675000000000004 20.474999999999998 8 18.2 22.5 29.825000000000003 29.475 9 19.2 22.15 30.175 28.475 10-14 19.68 29.635 27.145000000000003 23.54 15-19 19.405 28.615000000000002 27.485 24.495 20-24 19.705000000000002 28.075 28.095 24.125 25-29 19.55 28.84 27.74 23.87 30-34 19.455 28.910000000000004 27.62 24.015 35-39 19.485 28.64 28.075 23.799999999999997 40-44 19.68 28.955 27.650000000000002 23.715 45-49 19.625 28.425 28.060000000000002 23.89 50-54 19.455 29.294999999999998 27.52 23.73 55-59 19.67 28.749999999999996 27.894999999999996 23.685000000000002 60-64 19.77 28.055000000000003 28.544999999999998 23.630000000000003 65-69 20.395 28.025 27.675 23.905 70-74 19.895 28.125 27.944999999999997 24.035 75-79 20.115 28.465 28.199999999999996 23.22 80-84 20.31 27.755000000000003 28.275 23.66 85-89 19.98 28.59 27.884999999999998 23.544999999999998 90-94 20.035 28.29 27.589999999999996 24.085 95-99 20.14 28.345 27.79 23.724999999999998 100-104 20.4 27.85 28.125 23.625 105-109 19.905 27.72 28.549999999999997 23.825 110-114 20.09 28.71 27.315 23.885 115-119 20.655 28.735 27.189999999999998 23.419999999999998 120-124 20.330000000000002 28.155 27.755000000000003 23.76 125-129 20.22 28.34 27.965 23.474999999999998 130-134 21.029999999999998 27.765 27.57 23.635 135-139 20.79 27.935 27.915 23.36 140-144 20.895 28.04 27.58 23.485 145-149 20.44 28.475 27.295 23.79 150-151 20.75 28.050000000000004 26.737499999999997 24.462500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.5 21 1.5 22 1.0 23 1.0 24 1.5 25 1.0 26 2.5 27 5.5 28 7.0 29 9.0 30 15.5 31 19.5 32 25.0 33 37.5 34 59.5 35 76.5 36 91.5 37 114.5 38 143.0 39 180.5 40 213.5 41 237.0 42 248.0 43 274.5 44 286.5 45 273.0 46 264.5 47 253.0 48 221.5 49 186.0 50 164.5 51 136.5 52 115.5 53 95.5 54 68.5 55 45.5 56 34.5 57 25.5 58 17.5 59 13.0 60 8.5 61 6.5 62 6.0 63 4.5 64 1.0 65 0.0 66 1.5 67 1.5 68 1.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79954898521673 99.575 2 0.17539463793535454 0.35000000000000003 3 0.025056376847907794 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.1625 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.21250000000000002 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.3375 0.0 0.0 0.0 0.0 106-107 0.3625 0.0 0.0 0.0 0.0 108-109 0.4 0.0 0.0 0.0 0.0 110-111 0.425 0.0 0.0 0.0 0.0 112-113 0.5125 0.0 0.0 0.0 0.0 114-115 0.625 0.0 0.0 0.0 0.0 116-117 0.8125 0.0 0.0 0.0 0.0 118-119 0.9625 0.0 0.0 0.0 0.0 120-121 1.075 0.0 0.0 0.0 0.0 122-123 1.3 0.0 0.0 0.0 0.0 124-125 1.5125 0.0 0.0 0.0 0.0 126-127 1.6875 0.0 0.0 0.0 0.0 128-129 1.85 0.0 0.0 0.0 0.0 130-131 2.025 0.0 0.0 0.0 0.0 132-133 2.3125 0.0 0.0 0.0 0.0 134-135 2.4749999999999996 0.0 0.0 0.0 0.0 136-137 2.6875 0.0 0.0 0.0 0.0 138-139 2.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATACTA 10 0.006830828 145.0 2 CTCAGTC 10 0.006830828 145.0 1 CTAAATC 10 0.006830828 145.0 7 >>END_MODULE SRR7171880 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171880_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.96325 33.0 33.0 34.0 32.0 34.0 2 33.00675 33.0 33.0 34.0 32.0 34.0 3 33.14025 34.0 33.0 34.0 33.0 34.0 4 33.07475 34.0 33.0 34.0 33.0 34.0 5 33.105 34.0 33.0 34.0 33.0 34.0 6 37.18275 38.0 38.0 38.0 37.0 38.0 7 37.2565 38.0 38.0 38.0 37.0 38.0 8 37.2565 38.0 38.0 38.0 37.0 38.0 9 37.28475 38.0 38.0 38.0 37.0 38.0 10-14 37.188449999999996 38.0 38.0 38.0 36.8 38.0 15-19 37.14775000000001 38.0 38.0 38.0 37.0 38.0 20-24 37.20045 38.0 38.0 38.0 36.8 38.0 25-29 37.152550000000005 38.0 38.0 38.0 37.0 38.0 30-34 37.105450000000005 38.0 38.0 38.0 37.0 38.0 35-39 36.72070000000001 38.0 38.0 38.0 36.0 38.0 40-44 36.5904 38.0 38.0 38.0 35.8 38.0 45-49 36.963350000000005 38.0 38.0 38.0 36.0 38.0 50-54 37.0082 38.0 38.0 38.0 36.0 38.0 55-59 36.95975 38.0 38.0 38.0 36.0 38.0 60-64 36.90965 38.0 38.0 38.0 35.8 38.0 65-69 36.859500000000004 38.0 38.0 38.0 35.8 38.0 70-74 36.76585 38.0 38.0 38.0 35.4 38.0 75-79 36.750099999999996 38.0 38.0 38.0 35.0 38.0 80-84 36.6936 38.0 38.0 38.0 35.2 38.0 85-89 36.51825 38.0 38.0 38.0 34.2 38.0 90-94 36.44175 38.0 38.0 38.0 34.0 38.0 95-99 36.335 38.0 38.0 38.0 34.0 38.0 100-104 36.2128 38.0 38.0 38.0 33.8 38.0 105-109 36.016 38.0 37.2 38.0 33.2 38.0 110-114 35.88365 38.0 37.0 38.0 33.0 38.0 115-119 35.77095 38.0 37.0 38.0 31.8 38.0 120-124 35.28705000000001 38.0 36.0 38.0 29.8 38.0 125-129 34.97735 38.0 35.8 38.0 28.2 38.0 130-134 34.8163 38.0 35.8 38.0 27.8 38.0 135-139 34.5405 38.0 35.0 38.0 26.6 38.0 140-144 34.4092 38.0 35.0 38.0 27.2 38.0 145-149 33.90814999999999 38.0 34.6 38.0 23.4 38.0 150-151 30.365000000000002 36.5 29.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 1.0 4 0.0 5 0.0 6 1.0 7 2.0 8 1.0 9 2.0 10 2.0 11 1.0 12 0.0 13 2.0 14 4.0 15 3.0 16 2.0 17 6.0 18 4.0 19 6.0 20 6.0 21 7.0 22 9.0 23 8.0 24 9.0 25 15.0 26 30.0 27 19.0 28 21.0 29 30.0 30 32.0 31 43.0 32 89.0 33 103.0 34 163.0 35 315.0 36 664.0 37 2397.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.625 16.55 16.6 27.224999999999998 2 24.45 24.5 33.725 17.325 3 21.275 26.625 30.975 21.125 4 24.2 33.625 22.05 20.125 5 24.575 34.8 22.900000000000002 17.724999999999998 6 19.225 36.475 24.4 19.900000000000002 7 17.724999999999998 17.375 43.05 21.85 8 20.375 23.35 27.825 28.449999999999996 9 21.575 24.175 28.675 25.575 10-14 22.415 28.035 27.229999999999997 22.32 15-19 22.6 27.55 28.235 21.615000000000002 20-24 23.244999999999997 28.415000000000003 27.500000000000004 20.84 25-29 23.085 28.38 27.67 20.865000000000002 30-34 23.024502680763643 27.38387533196372 28.636568622538455 20.955053364734177 35-39 23.31700419170749 28.023837179940408 27.640018180899954 21.01914044745215 40-44 23.104145601617795 27.472194135490398 28.03842264914055 21.385237613751265 45-49 23.61 27.68 28.055000000000003 20.655 50-54 23.085 28.249999999999996 28.189999999999998 20.474999999999998 55-59 23.405 27.98 27.694999999999997 20.919999999999998 60-64 23.205000000000002 27.955000000000002 27.994999999999997 20.845 65-69 23.26 28.26 28.21 20.27 70-74 23.435 27.74 28.255000000000003 20.57 75-79 23.315 28.12 27.785 20.78 80-84 23.375 27.42 28.43 20.775 85-89 23.380000000000003 27.644999999999996 28.42 20.555 90-94 24.115000000000002 26.96 28.285 20.64 95-99 23.43 28.375 27.810000000000002 20.385 100-104 24.240000000000002 28.249999999999996 27.415 20.095 105-109 23.56 27.82 27.884999999999998 20.735 110-114 24.48 27.765 27.6 20.155 115-119 24.27 27.750000000000004 27.83 20.150000000000002 120-124 24.32 28.17 27.384999999999998 20.125 125-129 23.794999999999998 28.189999999999998 27.810000000000002 20.205000000000002 130-134 24.295 27.839999999999996 27.345000000000002 20.52 135-139 24.185000000000002 27.93 28.33 19.555 140-144 24.455 28.13 27.51 19.905 145-149 24.834999999999997 27.73 27.634999999999998 19.8 150-151 23.9375 28.125 28.275 19.662499999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.5 21 1.5 22 1.0 23 0.0 24 1.0 25 3.0 26 4.0 27 3.5 28 4.5 29 4.5 30 5.5 31 13.5 32 20.5 33 29.5 34 40.0 35 56.0 36 70.0 37 94.0 38 141.0 39 178.5 40 204.5 41 234.5 42 254.0 43 285.5 44 304.0 45 298.5 46 293.5 47 262.5 48 241.0 49 202.5 50 160.0 51 144.0 52 115.0 53 83.5 54 65.5 55 46.5 56 26.0 57 21.5 58 23.0 59 16.0 60 9.5 61 8.5 62 6.5 63 6.5 64 5.0 65 1.5 66 1.0 67 2.0 68 1.5 69 0.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.215 35-39 0.9950000000000001 40-44 1.0999999999999999 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64859437751004 99.25 2 0.30120481927710846 0.6 3 0.0502008032128514 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.1625 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.21250000000000002 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.3375 0.0 0.0 0.0 0.0 106-107 0.3625 0.0 0.0 0.0 0.0 108-109 0.4 0.0 0.0 0.0 0.0 110-111 0.425 0.0 0.0 0.0 0.0 112-113 0.5125 0.0 0.0 0.0 0.0 114-115 0.625 0.0 0.0 0.0 0.0 116-117 0.8374999999999999 0.0 0.0 0.0 0.0 118-119 1.025 0.0 0.0 0.0 0.0 120-121 1.15 0.0 0.0 0.0 0.0 122-123 1.35 0.0 0.0 0.0 0.0 124-125 1.5625 0.0 0.0 0.0 0.0 126-127 1.7625 0.0 0.0 0.0 0.0 128-129 1.925 0.0 0.0 0.0 0.0 130-131 2.1125 0.0 0.0 0.0 0.0 132-133 2.3875 0.0 0.0 0.0 0.0 134-135 2.575 0.0 0.0 0.0 0.0 136-137 2.8125 0.0 0.0 0.0 0.0 138-139 2.9375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGGGTTC 10 0.0068768123 144.675 5 TTTAGGG 10 0.0068768123 144.675 2 TTAGGGT 10 0.0068768123 144.675 3 TAGGGTT 10 0.0068768123 144.675 4 CTTGACC 10 0.0068768123 144.675 2 >>END_MODULE Read 785378 spots for SRR7171880.sra Written 785378 spots for SRR7171880.sra Read 785378 spots for SRR7171880.sra Written 785378 spots for SRR7171880.sra Read 785378 spots for SRR7171880.sra Written 785378 spots for SRR7171880.sra Read 785378 spots for SRR7171880.sra Written 785378 spots for SRR7171880.sra Read 785378 spots for SRR7171880.sra Written 785378 spots for SRR7171880.sra Read 785378 spots for SRR7171880.sra Written 785378 spots for SRR7171880.sra Read 785378 spots for SRR7171880.sra Written 785378 spots for SRR7171880.sra Read 785378 spots for SRR7171880.sra Written 785378 spots for SRR7171880.sra Read 785378 spots for SRR7171880.sra Written 785378 spots for SRR7171880.sra Read 785378 spots for SRR7171880.sra Written 785378 spots for SRR7171880.sra Read 785378 spots for SRR7171880.sra Written 785378 spots for SRR7171880.sra Read 785378 spots for SRR7171880.sra Written 785378 spots for SRR7171880.sra Read 785390 spots for SRR7171880.sra Written 785390 spots for SRR7171880.sra Read 785378 spots for SRR7171880.sra Written 785378 spots for SRR7171880.sra Read 785378 spots for SRR7171880.sra Written 785378 spots for SRR7171880.sra Read 785378 spots for SRR7171880.sra Written 785378 spots for SRR7171880.sra Read 785378 spots for SRR7171880.sra Written 785378 spots for SRR7171880.sra Read 785378 spots for SRR7171880.sra Written 785378 spots for SRR7171880.sra Read 785378 spots for SRR7171880.sra Written 785378 spots for SRR7171880.sra Read 785378 spots for SRR7171880.sra Written 785378 spots for SRR7171880.sra SRR ids: ['SRR7171880.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_s4s4l5tm SRR7171880.sra spots: 15707572 blocks: [[1, 785378], [785379, 1570756], [1570757, 2356134], [2356135, 3141512], [3141513, 3926890], [3926891, 4712268], [4712269, 5497646], [5497647, 6283024], [6283025, 7068402], [7068403, 7853780], [7853781, 8639158], [8639159, 9424536], [9424537, 10209914], [10209915, 10995292], [10995293, 11780670], [11780671, 12566048], [12566049, 13351426], [13351427, 14136804], [14136805, 14922182], [14922183, 15707572]] SRR7171880 file size 5301080 SRR7171880 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171880 SRR7171880_1.fastq SRR7171880_2.fastq Input file: SRR7171880_1.fastq Paired file: SRR7171880_2.fastq trimmed: SRR7171880-trimmed-pair1.fastq, SRR7171880-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 22:31:32 2025 >> started Thu Feb 13 22:31:51 2025 >> done (18.791s) 15707572 read pairs processed; of these: 14601 ( 0.09%) short read pairs filtered out after trimming by size control 10258 ( 0.07%) empty read pairs filtered out after trimming by size control 15682713 (99.84%) read pairs available; of these: 6299758 (40.17%) trimmed read pairs available after processing 9382955 (59.83%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 2 0.00% 21 2 0.00% 22 3 0.00% 23 3 0.00% 24 5 0.00% 25 1 0.00% 26 2 0.00% 27 4 0.00% 28 5 0.00% 29 2 0.00% 30 8 0.00% 31 0 0.00% 32 1 0.00% 33 3 0.00% 34 1 0.00% 35 3 0.00% 36 4 0.00% 37 5 0.00% 38 4 0.00% 39 2 0.00% 40 7 0.00% 41 1 0.00% 42 6 0.00% 43 7 0.00% 44 12 0.00% 45 8 0.00% 46 3 0.00% 47 20 0.00% 48 6 0.00% 49 14 0.00% 50 16 0.00% 51 18 0.00% 52 12 0.00% 53 14 0.00% 54 28 0.00% 55 27 0.00% 56 23 0.00% 57 35 0.00% 58 49 0.00% 59 39 0.00% 60 47 0.00% 61 49 0.00% 62 54 0.00% 63 62 0.00% 64 78 0.00% 65 93 0.00% 66 113 0.00% 67 104 0.00% 68 129 0.00% 69 172 0.00% 70 163 0.00% 71 208 0.00% 72 231 0.00% 73 262 0.00% 74 315 0.00% 75 362 0.00% 76 407 0.00% 77 462 0.00% 78 460 0.00% 79 535 0.00% 80 637 0.00% 81 786 0.01% 82 840 0.01% 83 1039 0.01% 84 1674 0.01% 85 2200 0.01% 86 2367 0.02% 87 2556 0.02% 88 2815 0.02% 89 2833 0.02% 90 3011 0.02% 91 3145 0.02% 92 3280 0.02% 93 3478 0.02% 94 3709 0.02% 95 3902 0.02% 96 4101 0.03% 97 4494 0.03% 98 4650 0.03% 99 5089 0.03% 100 5267 0.03% 101 5775 0.04% 102 6005 0.04% 103 6648 0.04% 104 6911 0.04% 105 7541 0.05% 106 7763 0.05% 107 8146 0.05% 108 8804 0.06% 109 9174 0.06% 110 9764 0.06% 111 10305 0.07% 112 10879 0.07% 113 11557 0.07% 114 12413 0.08% 115 13163 0.08% 116 13708 0.09% 117 14275 0.09% 118 14933 0.10% 119 15633 0.10% 120 16446 0.10% 121 17232 0.11% 122 18022 0.11% 123 19075 0.12% 124 20296 0.13% 125 21337 0.14% 126 22465 0.14% 127 23276 0.15% 128 24513 0.16% 129 26134 0.17% 130 27495 0.18% 131 28840 0.18% 132 30628 0.20% 133 33134 0.21% 134 35149 0.22% 135 37778 0.24% 136 40627 0.26% 137 43496 0.28% 138 47532 0.30% 139 51780 0.33% 140 56984 0.36% 141 62820 0.40% 142 70501 0.45% 143 81478 0.52% 144 96166 0.61% 145 118279 0.75% 146 150421 0.96% 147 212018 1.35% 148 337446 2.15% 149 693879 4.42% 150 3574529 22.79% 151 9382955 59.83% 15682713 reads passed initial QC criterion=sequence-density sequence-density=0.66 sequence-density-rank=1 fanout-score=2.79 fanout-score-rank=25 prefix-density=0.91 prefix-fanout=2.0 sequence=CACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=106.79 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=6.3 sequence=AGCAACACTACCATTTTAATTATACATGAAAGATAAACAGGACGACAAGCAGCTAACACGACTTGAGACTTGATACTTGATACTAGAGAGGAAGCCCCAGAGCTGCAAATCCAAGAAGATTTGCAGAAAACAAGCCATGAATATATACTAGCTACTTTATTGAAACTTGTTGAAGACAAGAGACAACCCTTATAAACGCCTAGTAGATGAAATATTATTTCTTGTCAATCCGTCGATGCGATGATCATTTCTTGAATCAACGCAGCCAGCGGATCGCTCTCATTTACAAGTGCAAGGATCGCAGGTACAGTTGGCTCCACACTTGC criterion=sequence-density sequence-density=0.93 sequence-density-rank=1 fanout-score=2.83 fanout-score-rank=16 prefix-density=0.95 prefix-fanout=2.8 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=25 fanout-score=95.37 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=15.6 sequence=AAGCAAAGAACAACTTCGTATTTAGTTCATCCATTTGCTTCATCAATCAATCACCATGTCTAGCACCTGCGACAACTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGACATCGTTGAGACTGAGAAGAGCCATGTCTACACTGGAGTCATGGAGGTTCCAGCAACCGAGAACGATGGCAAGTGCAAGTGCGG SRR7171880 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 22:32:33 Started mapping on | Feb 13 22:32:33 Finished on | Feb 13 22:34:25 Mapping speed, Million of reads per hour | 504.09 Number of input reads | 15682713 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 14768989 Uniquely mapped reads % | 94.17% Average mapped length | 297.04 Number of splices: Total | 15400681 Number of splices: Annotated (sjdb) | 15109368 Number of splices: GT/AG | 15156807 Number of splices: GC/AG | 195771 Number of splices: AT/AC | 11607 Number of splices: Non-canonical | 36496 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.76 Insertion rate per base | 0.02% Insertion average length | 2.53 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 344450 % of reads mapped to multiple loci | 2.20% Number of reads mapped to too many loci | 34631 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.36% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 583381 583381 583381 N_multimapping 344450 344450 344450 N_noFeature 372589 14629004 429267 N_ambiguous 155298 657 71681 UnstrandedReadsAssigned:14241102 PositiveStrandReadsAssigned:139328 NegativeStrandReadsAssigned:14268041 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7171880 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171880-trimmed-pair1.fastq SRR7171880-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,682,713 reads, 14,118,438 reads pseudoaligned [quant] estimated average fragment length: 264.026 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,184 rounds 52401 SRR7171880.ke.tsv 34699 SRR7171880.se.tsv 87100 total ==> SRR7171880.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1754.97 1458 49.9903 Potri.005G024800.1.v4.1 1035 771.974 421 32.8154 Potri.004G059700.1.v4.1 961 697.974 17 1.46558 Potri.007G009000.2.v4.1 1416 1152.97 0 0 Potri.003G141000.2.v4.1 2943 2679.97 892 20.0278 Potri.016G087400.1.v4.1 270 66.5077 1015 918.317 Potri.015G069301.1.v4.1 564 305.476 0 0 Potri.010G195200.1.v4.1 1773 1509.97 485 19.3273 Potri.012G127500.1.v4.1 977 713.974 5663 477.268 ==> SRR7171880.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 45 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 406 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 229 SRR7171880 completed mapping pipeline successfully