Starting /dee2/code/volunteer_pipeline.sh SRR7171881 current disk space = 3089322053632 free memory = 1580033132 SRR7171881 SRAfilesize 356a5bd23af3165b720f76bb35719c80 SRR7171881.sra SRR7171881.sra file validated SRR7171881 is paired end SRR7171881 is conventional basespace SRR7171881 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171881_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.19275 32.0 25.0 33.0 18.0 33.0 2 28.78975 31.0 28.0 33.0 18.0 33.0 3 31.81225 33.0 31.0 33.0 29.0 33.0 4 32.77025 33.0 33.0 33.0 32.0 34.0 5 32.906 33.0 33.0 34.0 32.0 34.0 6 36.32625 38.0 36.0 38.0 34.0 38.0 7 37.238 38.0 38.0 38.0 36.0 38.0 8 37.4445 38.0 38.0 38.0 37.0 38.0 9 37.55825 38.0 38.0 38.0 37.0 38.0 10-14 37.5741 38.0 38.0 38.0 37.6 38.0 15-19 37.552 38.0 38.0 38.0 37.6 38.0 20-24 37.55854999999999 38.0 38.0 38.0 38.0 38.0 25-29 37.523849999999996 38.0 38.0 38.0 37.6 38.0 30-34 37.4867 38.0 38.0 38.0 37.4 38.0 35-39 37.45739999999999 38.0 38.0 38.0 37.0 38.0 40-44 37.4148 38.0 38.0 38.0 37.0 38.0 45-49 37.3834 38.0 38.0 38.0 37.0 38.0 50-54 37.34625 38.0 38.0 38.0 37.0 38.0 55-59 37.2673 38.0 38.0 38.0 37.0 38.0 60-64 37.2194 38.0 38.0 38.0 36.0 38.0 65-69 37.161 38.0 38.0 38.0 36.0 38.0 70-74 37.1368 38.0 38.0 38.0 36.0 38.0 75-79 37.05715 38.0 38.0 38.0 36.0 38.0 80-84 37.016450000000006 38.0 38.0 38.0 36.0 38.0 85-89 36.94845 38.0 38.0 38.0 35.8 38.0 90-94 36.79855 38.0 38.0 38.0 35.0 38.0 95-99 36.696749999999994 38.0 38.0 38.0 34.6 38.0 100-104 36.559900000000006 38.0 38.0 38.0 34.0 38.0 105-109 36.4565 38.0 38.0 38.0 34.0 38.0 110-114 36.2925 38.0 37.4 38.0 33.6 38.0 115-119 36.252 38.0 37.4 38.0 33.8 38.0 120-124 36.00234999999999 38.0 37.0 38.0 32.6 38.0 125-129 35.74495 38.0 36.4 38.0 31.8 38.0 130-134 35.5685 38.0 36.2 38.0 30.8 38.0 135-139 35.132349999999995 38.0 35.8 38.0 28.4 38.0 140-144 34.78275 38.0 35.0 38.0 28.0 38.0 145-149 34.34694999999999 38.0 35.0 38.0 27.2 38.0 150-151 31.00075 36.5 31.0 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 1.0 10 0.0 11 1.0 12 0.0 13 0.0 14 1.0 15 1.0 16 3.0 17 1.0 18 1.0 19 1.0 20 3.0 21 5.0 22 9.0 23 2.0 24 5.0 25 8.0 26 9.0 27 18.0 28 20.0 29 28.0 30 33.0 31 55.0 32 52.0 33 85.0 34 129.0 35 269.0 36 772.0 37 2487.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.65 13.200000000000001 10.625 33.525 2 18.554638659664917 19.129782445611404 39.184796199049764 23.13078269567392 3 18.6 25.775 28.225 27.400000000000002 4 23.175 33.050000000000004 22.725 21.05 5 21.475 36.575 23.925 18.025 6 17.775 36.175000000000004 25.2 20.849999999999998 7 13.775 21.475 45.125 19.625 8 17.65 20.674999999999997 31.2 30.475 9 17.95 22.45 32.375 27.224999999999998 10-14 20.61 28.845 26.815 23.73 15-19 19.685 28.21 27.595 24.51 20-24 19.665 28.67 28.46 23.205000000000002 25-29 20.805 28.189999999999998 27.73 23.275000000000002 30-34 20.29 28.515 27.215 23.98 35-39 20.11 27.765 27.93 24.195 40-44 20.255000000000003 28.335 27.955000000000002 23.455000000000002 45-49 20.405 27.805000000000003 27.755000000000003 24.035 50-54 20.465 28.415000000000003 27.66 23.46 55-59 20.369999999999997 28.095 27.71 23.825 60-64 20.185 28.625 27.07 24.12 65-69 20.575 27.82 27.77 23.835 70-74 20.085 27.794999999999998 28.22 23.9 75-79 20.805 28.199999999999996 27.250000000000004 23.745 80-84 19.950000000000003 28.24 28.205000000000002 23.605 85-89 20.105 27.775 27.694999999999997 24.425 90-94 20.16 28.02 27.744999999999997 24.075 95-99 20.395 28.465 27.169999999999998 23.97 100-104 20.65 28.249999999999996 27.615000000000002 23.485 105-109 20.31 28.015 27.884999999999998 23.79 110-114 21.005 28.139999999999997 27.725 23.13 115-119 20.84 28.544999999999998 27.034999999999997 23.580000000000002 120-124 21.154999999999998 28.560000000000002 26.77 23.515 125-129 20.535 27.800000000000004 27.900000000000002 23.765 130-134 21.325 27.79 27.334999999999997 23.549999999999997 135-139 20.685000000000002 28.075 27.529999999999998 23.71 140-144 20.905 27.92 27.77 23.405 145-149 21.04 28.389999999999997 26.8 23.77 150-151 20.75 27.987499999999997 26.650000000000002 24.6125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 0.5 21 0.5 22 1.5 23 1.0 24 1.0 25 4.0 26 4.0 27 4.0 28 6.5 29 13.5 30 18.0 31 20.5 32 27.0 33 35.5 34 44.5 35 62.5 36 78.5 37 92.5 38 120.0 39 156.5 40 182.0 41 209.0 42 244.5 43 275.5 44 304.5 45 301.5 46 287.5 47 252.5 48 222.0 49 209.0 50 170.5 51 142.0 52 124.5 53 104.5 54 76.0 55 49.0 56 37.0 57 32.5 58 24.5 59 13.5 60 8.5 61 8.5 62 6.0 63 4.5 64 4.5 65 3.5 66 3.0 67 0.5 68 1.0 69 1.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79954898521673 99.575 2 0.17539463793535454 0.35000000000000003 3 0.025056376847907794 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1375 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.2875 0.0 0.0 0.0 0.0 102-103 0.375 0.0 0.0 0.0 0.0 104-105 0.42500000000000004 0.0 0.0 0.0 0.0 106-107 0.4625 0.0 0.0 0.0 0.0 108-109 0.525 0.0 0.0 0.0 0.0 110-111 0.6625 0.0 0.0 0.0 0.0 112-113 0.725 0.0 0.0 0.0 0.0 114-115 0.825 0.0 0.0 0.0 0.0 116-117 1.0 0.0 0.0 0.0 0.0 118-119 1.1625 0.0 0.0 0.0 0.0 120-121 1.275 0.0 0.0 0.0 0.0 122-123 1.4375 0.0 0.0 0.0 0.0 124-125 1.6124999999999998 0.0 0.0 0.0 0.0 126-127 1.7125 0.0 0.0 0.0 0.0 128-129 1.8375 0.0 0.0 0.0 0.0 130-131 2.0999999999999996 0.0 0.0 0.0 0.0 132-133 2.35 0.0 0.0 0.0 0.0 134-135 2.4875 0.0 0.0 0.0 0.0 136-137 2.7875 0.0 0.0 0.0 0.0 138-139 3.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTAAGGG 10 0.006830828 145.0 2 GGTAAGG 10 0.006830828 145.0 1 >>END_MODULE SRR7171881 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171881_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.00075 33.0 33.0 34.0 32.0 34.0 2 33.068 34.0 33.0 34.0 33.0 34.0 3 33.14075 34.0 33.0 34.0 33.0 34.0 4 33.132 34.0 33.0 34.0 33.0 34.0 5 33.0635 34.0 33.0 34.0 33.0 34.0 6 37.369 38.0 38.0 38.0 38.0 38.0 7 37.382 38.0 38.0 38.0 37.0 38.0 8 37.322 38.0 38.0 38.0 38.0 38.0 9 37.37425 38.0 38.0 38.0 38.0 38.0 10-14 37.305600000000005 38.0 38.0 38.0 37.2 38.0 15-19 37.227 38.0 38.0 38.0 37.0 38.0 20-24 37.22835 38.0 38.0 38.0 37.0 38.0 25-29 37.2202 38.0 38.0 38.0 37.0 38.0 30-34 37.1746 38.0 38.0 38.0 37.0 38.0 35-39 36.94785 38.0 38.0 38.0 37.0 38.0 40-44 36.612399999999994 38.0 38.0 38.0 36.6 38.0 45-49 37.09374999999999 38.0 38.0 38.0 36.6 38.0 50-54 37.05965 38.0 38.0 38.0 36.6 38.0 55-59 37.06185000000001 38.0 38.0 38.0 36.4 38.0 60-64 36.9746 38.0 38.0 38.0 36.2 38.0 65-69 36.920899999999996 38.0 38.0 38.0 36.0 38.0 70-74 36.880900000000004 38.0 38.0 38.0 36.0 38.0 75-79 36.82965 38.0 38.0 38.0 36.0 38.0 80-84 36.757600000000004 38.0 38.0 38.0 35.6 38.0 85-89 36.66865 38.0 38.0 38.0 35.4 38.0 90-94 36.4679 38.0 38.0 38.0 34.2 38.0 95-99 36.43865 38.0 38.0 38.0 34.0 38.0 100-104 36.32925 38.0 38.0 38.0 34.0 38.0 105-109 36.1902 38.0 38.0 38.0 34.0 38.0 110-114 35.99435 38.0 37.8 38.0 33.0 38.0 115-119 36.012899999999995 38.0 37.6 38.0 33.4 38.0 120-124 35.81304999999999 38.0 37.0 38.0 32.4 38.0 125-129 35.524 38.0 36.8 38.0 31.0 38.0 130-134 35.0866 38.0 36.0 38.0 28.8 38.0 135-139 35.05485 38.0 36.0 38.0 29.4 38.0 140-144 34.61025 38.0 35.0 38.0 27.8 38.0 145-149 34.265 38.0 35.0 38.0 26.6 38.0 150-151 30.624000000000002 35.5 28.5 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 7.0 4 2.0 5 1.0 6 3.0 7 1.0 8 0.0 9 4.0 10 1.0 11 1.0 12 1.0 13 1.0 14 0.0 15 1.0 16 1.0 17 3.0 18 0.0 19 5.0 20 4.0 21 5.0 22 8.0 23 8.0 24 10.0 25 8.0 26 11.0 27 17.0 28 22.0 29 27.0 30 35.0 31 56.0 32 67.0 33 79.0 34 119.0 35 244.0 36 623.0 37 2616.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.25 17.150000000000002 14.625 26.974999999999998 2 23.799999999999997 23.825 34.25 18.125 3 21.375 27.150000000000002 30.9 20.575 4 24.275 35.55 20.8 19.375 5 23.7 37.7 20.7 17.9 6 18.35 37.7 23.5 20.45 7 18.9 17.65 41.8 21.65 8 21.224999999999998 22.400000000000002 28.225 28.15 9 23.025000000000002 24.075 27.575 25.324999999999996 10-14 23.150000000000002 28.655 26.424999999999997 21.77 15-19 22.925 28.165000000000003 27.775 21.135 20-24 22.62 28.544999999999998 27.43 21.404999999999998 25-29 22.650000000000002 28.105000000000004 27.88 21.365000000000002 30-34 22.869865412518138 28.108270375744233 27.677990693951067 21.34387351778656 35-39 22.68155300744317 28.812110239388456 27.011667672500504 21.494669080667876 40-44 23.41460941856339 27.966746084047244 27.672732802757643 20.94591169463172 45-49 22.62 27.860000000000003 27.67 21.85 50-54 23.49 28.54 27.04 20.93 55-59 23.59 27.565 27.639999999999997 21.205 60-64 23.715 27.295 27.615000000000002 21.375 65-69 23.24 27.775 27.74 21.245 70-74 23.785 27.765 27.99 20.46 75-79 23.32 28.465 27.185 21.029999999999998 80-84 23.82 28.02 27.26 20.9 85-89 23.845 27.735 27.195000000000004 21.224999999999998 90-94 23.28 28.275 27.700000000000003 20.745 95-99 23.419999999999998 27.939999999999998 27.88 20.76 100-104 24.05 27.400000000000002 27.845 20.705000000000002 105-109 24.065 27.900000000000002 27.589999999999996 20.445 110-114 24.04 27.334999999999997 27.675 20.95 115-119 23.5 28.044999999999998 27.589999999999996 20.865000000000002 120-124 23.810000000000002 27.445000000000004 27.860000000000003 20.885 125-129 23.695 28.299999999999997 27.62 20.385 130-134 24.39 27.565 27.1 20.945 135-139 24.25 28.28 27.195000000000004 20.275000000000002 140-144 23.805 28.08 27.435 20.68 145-149 24.645 28.275 26.68 20.4 150-151 23.549999999999997 28.462500000000002 27.1 20.8875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 1.0 25 1.0 26 1.5 27 2.0 28 3.5 29 6.5 30 13.0 31 16.5 32 17.0 33 23.5 34 38.0 35 53.0 36 72.5 37 96.0 38 125.5 39 163.0 40 194.5 41 224.0 42 253.0 43 262.5 44 287.5 45 304.5 46 290.0 47 272.0 48 230.0 49 202.5 50 189.5 51 156.0 52 124.5 53 93.5 54 72.0 55 60.5 56 38.5 57 31.0 58 28.0 59 15.0 60 8.0 61 7.5 62 4.5 63 3.5 64 4.5 65 3.0 66 1.5 67 1.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.065 35-39 0.58 40-44 1.365 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62321024868123 99.15 2 0.3265511178095956 0.65 3 0.025119316754584273 0.075 4 0.0 0.0 5 0.025119316754584273 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTTGAGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTTATCC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.3375 0.0 0.0 0.0 0.0 102-103 0.425 0.0 0.0 0.0 0.0 104-105 0.475 0.0 0.0 0.0 0.0 106-107 0.5375000000000001 0.0 0.0 0.0 0.0 108-109 0.6125 0.0 0.0 0.0 0.0 110-111 0.7749999999999999 0.0 0.0 0.0 0.0 112-113 0.85 0.0 0.0 0.0 0.0 114-115 0.95 0.0 0.0 0.0 0.0 116-117 1.125 0.0 0.0 0.0 0.0 118-119 1.275 0.0 0.0 0.0 0.0 120-121 1.3875 0.0 0.0 0.0 0.0 122-123 1.5625 0.0 0.0 0.0 0.0 124-125 1.725 0.0 0.0 0.0 0.0 126-127 1.8125 0.0 0.0 0.0 0.0 128-129 1.95 0.0 0.0 0.0 0.0 130-131 2.2 0.0 0.0 0.0 0.0 132-133 2.45 0.0 0.0 0.0 0.0 134-135 2.5625 0.0 0.0 0.0 0.0 136-137 2.8625 0.0 0.0 0.0 0.0 138-139 3.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGTGAC 10 0.0068785893 144.66249 5 >>END_MODULE Read 924047 spots for SRR7171881.sra Written 924047 spots for SRR7171881.sra Read 924047 spots for SRR7171881.sra Written 924047 spots for SRR7171881.sra Read 924047 spots for SRR7171881.sra Written 924047 spots for SRR7171881.sra Read 924047 spots for SRR7171881.sra Written 924047 spots for SRR7171881.sra Read 924047 spots for SRR7171881.sra Written 924047 spots for SRR7171881.sra Read 924047 spots for SRR7171881.sra Written 924047 spots for SRR7171881.sra Read 924047 spots for SRR7171881.sra Written 924047 spots for SRR7171881.sra Read 924047 spots for SRR7171881.sra Written 924047 spots for SRR7171881.sra Read 924047 spots for SRR7171881.sra Written 924047 spots for SRR7171881.sra Read 924047 spots for SRR7171881.sra Written 924047 spots for SRR7171881.sra Read 924047 spots for SRR7171881.sra Written 924047 spots for SRR7171881.sra Read 924047 spots for SRR7171881.sra Written 924047 spots for SRR7171881.sra Read 924047 spots for SRR7171881.sra Written 924047 spots for SRR7171881.sra Read 924047 spots for SRR7171881.sra Written 924047 spots for SRR7171881.sra Read 924047 spots for SRR7171881.sra Written 924047 spots for SRR7171881.sra Read 924047 spots for SRR7171881.sra Written 924047 spots for SRR7171881.sra Read 924056 spots for SRR7171881.sra Written 924056 spots for SRR7171881.sra Read 924047 spots for SRR7171881.sra Written 924047 spots for SRR7171881.sra Read 924047 spots for SRR7171881.sra Written 924047 spots for SRR7171881.sra Read 924047 spots for SRR7171881.sra Written 924047 spots for SRR7171881.sra SRR ids: ['SRR7171881.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9r27hn8t SRR7171881.sra spots: 18480949 blocks: [[1, 924047], [924048, 1848094], [1848095, 2772141], [2772142, 3696188], [3696189, 4620235], [4620236, 5544282], [5544283, 6468329], [6468330, 7392376], [7392377, 8316423], [8316424, 9240470], [9240471, 10164517], [10164518, 11088564], [11088565, 12012611], [12012612, 12936658], [12936659, 13860705], [13860706, 14784752], [14784753, 15708799], [15708800, 16632846], [16632847, 17556893], [17556894, 18480949]] SRR7171881 file size 6240886 SRR7171881 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171881 SRR7171881_1.fastq SRR7171881_2.fastq Input file: SRR7171881_1.fastq Paired file: SRR7171881_2.fastq trimmed: SRR7171881-trimmed-pair1.fastq, SRR7171881-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 23:16:54 2025 >> started Thu Feb 13 23:17:15 2025 >> done (20.240s) 18480949 read pairs processed; of these: 21586 ( 0.12%) short read pairs filtered out after trimming by size control 34711 ( 0.19%) empty read pairs filtered out after trimming by size control 18424652 (99.70%) read pairs available; of these: 7813831 (42.41%) trimmed read pairs available after processing 10610821 (57.59%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 6 0.00% 20 4 0.00% 21 7 0.00% 22 4 0.00% 23 6 0.00% 24 5 0.00% 25 2 0.00% 26 8 0.00% 27 8 0.00% 28 3 0.00% 29 12 0.00% 30 8 0.00% 31 9 0.00% 32 2 0.00% 33 6 0.00% 34 11 0.00% 35 5 0.00% 36 7 0.00% 37 7 0.00% 38 6 0.00% 39 6 0.00% 40 7 0.00% 41 11 0.00% 42 15 0.00% 43 18 0.00% 44 11 0.00% 45 14 0.00% 46 14 0.00% 47 24 0.00% 48 18 0.00% 49 34 0.00% 50 31 0.00% 51 29 0.00% 52 30 0.00% 53 49 0.00% 54 63 0.00% 55 49 0.00% 56 74 0.00% 57 64 0.00% 58 72 0.00% 59 79 0.00% 60 84 0.00% 61 109 0.00% 62 111 0.00% 63 132 0.00% 64 125 0.00% 65 156 0.00% 66 172 0.00% 67 189 0.00% 68 245 0.00% 69 276 0.00% 70 282 0.00% 71 387 0.00% 72 400 0.00% 73 471 0.00% 74 549 0.00% 75 631 0.00% 76 795 0.00% 77 756 0.00% 78 813 0.00% 79 916 0.00% 80 1048 0.01% 81 1235 0.01% 82 1423 0.01% 83 1653 0.01% 84 2473 0.01% 85 3207 0.02% 86 3447 0.02% 87 3621 0.02% 88 3912 0.02% 89 4057 0.02% 90 4317 0.02% 91 4471 0.02% 92 4764 0.03% 93 5015 0.03% 94 5214 0.03% 95 5655 0.03% 96 6001 0.03% 97 6506 0.04% 98 6709 0.04% 99 7076 0.04% 100 7365 0.04% 101 8050 0.04% 102 8727 0.05% 103 9273 0.05% 104 9792 0.05% 105 10172 0.06% 106 10817 0.06% 107 11601 0.06% 108 12154 0.07% 109 12825 0.07% 110 13643 0.07% 111 14212 0.08% 112 15237 0.08% 113 15809 0.09% 114 16905 0.09% 115 17870 0.10% 116 18531 0.10% 117 19327 0.10% 118 19981 0.11% 119 20940 0.11% 120 21639 0.12% 121 22518 0.12% 122 23665 0.13% 123 25232 0.14% 124 26637 0.14% 125 27711 0.15% 126 29367 0.16% 127 30450 0.17% 128 32234 0.17% 129 34044 0.18% 130 35689 0.19% 131 37783 0.21% 132 40033 0.22% 133 42855 0.23% 134 45431 0.25% 135 48765 0.26% 136 52172 0.28% 137 55527 0.30% 138 60876 0.33% 139 65431 0.36% 140 71240 0.39% 141 78727 0.43% 142 89593 0.49% 143 102964 0.56% 144 121223 0.66% 145 147832 0.80% 146 189406 1.03% 147 264737 1.44% 148 420523 2.28% 149 871303 4.73% 150 4334747 23.53% 151 10610821 57.59% 18424652 reads passed initial QC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=3.03 fanout-score-rank=26 prefix-density=0.54 prefix-fanout=2.0 sequence=CACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.05 sequence-density-rank=35 fanout-score=89.84 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=15.9 sequence=TTCTTGATAAAGTCACGATGTCCAGGGGCATCAATGACAGTGCAGTAGTACCTGGTGGTCTCAAACTTCCACAGGGCAATATCAATGGTAATTCCACGCTCGCGCTCAGCCTTGAGCTTGTCGAGCACCCAGGCATACTTGAATGACCTCTTGTTCATCTCAGCAGCTTCCTTCTCGAACCTCTCAATGACACGCTT criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=2.30 fanout-score-rank=34 prefix-density=0.57 prefix-fanout=2.2 sequence=ATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.07 sequence-density-rank=33 fanout-score=262.79 fanout-score-rank=1 prefix-density=0.78 prefix-fanout=22.6 sequence=AGAAGAAGAGAGG SRR7171881 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 23:18:02 Started mapping on | Feb 13 23:18:02 Finished on | Feb 13 23:20:28 Mapping speed, Million of reads per hour | 454.31 Number of input reads | 18424652 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 17147470 Uniquely mapped reads % | 93.07% Average mapped length | 296.49 Number of splices: Total | 18109173 Number of splices: Annotated (sjdb) | 17803437 Number of splices: GT/AG | 17831065 Number of splices: GC/AG | 225720 Number of splices: AT/AC | 13754 Number of splices: Non-canonical | 38634 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.74 Insertion rate per base | 0.02% Insertion average length | 2.56 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 451038 % of reads mapped to multiple loci | 2.45% Number of reads mapped to too many loci | 54398 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.13% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 843562 843562 843562 N_multimapping 451038 451038 451038 N_noFeature 384323 16989676 460018 N_ambiguous 175854 1090 93138 UnstrandedReadsAssigned:16587293 PositiveStrandReadsAssigned:156704 NegativeStrandReadsAssigned:16594314 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7171881 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171881-trimmed-pair1.fastq SRR7171881-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,424,652 reads, 16,425,385 reads pseudoaligned [quant] estimated average fragment length: 266.026 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,021 rounds 52401 SRR7171881.ke.tsv 34699 SRR7171881.se.tsv 87100 total ==> SRR7171881.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1752.97 1130 36.4271 Potri.005G024800.1.v4.1 1035 769.974 203 14.8985 Potri.004G059700.1.v4.1 961 696.031 18 1.46139 Potri.007G009000.2.v4.1 1416 1150.97 0 0 Potri.003G141000.2.v4.1 2943 2677.97 627 13.2307 Potri.016G087400.1.v4.1 270 68.7637 1187 975.469 Potri.015G069301.1.v4.1 564 305.779 0 0 Potri.010G195200.1.v4.1 1773 1507.97 412 15.4392 Potri.012G127500.1.v4.1 977 711.997 3781 300.089 ==> SRR7171881.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 53 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 363 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 275 SRR7171881 completed mapping pipeline successfully