Starting /dee2/code/volunteer_pipeline.sh SRR7171882 current disk space = 3089296420864 free memory = 1520433328 SRR7171882 SRAfilesize e2c8d99de4932b7523347ffaee185277 SRR7171882.sra SRR7171882.sra file validated SRR7171882 is paired end SRR7171882 is conventional basespace SRR7171882 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171882_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.2065 30.0 18.0 33.0 18.0 33.0 2 30.49075 31.0 29.0 33.0 27.0 33.0 3 31.787 33.0 31.0 33.0 29.0 33.0 4 31.6255 33.0 31.0 33.0 29.0 33.0 5 32.54425 33.0 33.0 33.0 32.0 34.0 6 35.41325 37.0 35.0 38.0 31.0 38.0 7 37.05275 38.0 37.0 38.0 35.0 38.0 8 37.2925 38.0 38.0 38.0 36.0 38.0 9 37.377 38.0 38.0 38.0 37.0 38.0 10-14 37.46595000000001 38.0 38.0 38.0 37.0 38.0 15-19 37.49390000000001 38.0 38.0 38.0 37.2 38.0 20-24 37.47735 38.0 38.0 38.0 37.2 38.0 25-29 37.4708 38.0 38.0 38.0 37.2 38.0 30-34 37.454049999999995 38.0 38.0 38.0 37.4 38.0 35-39 37.42835 38.0 38.0 38.0 37.0 38.0 40-44 37.3645 38.0 38.0 38.0 37.0 38.0 45-49 37.326699999999995 38.0 38.0 38.0 37.0 38.0 50-54 37.2068 38.0 38.0 38.0 36.6 38.0 55-59 37.209 38.0 38.0 38.0 36.4 38.0 60-64 37.068200000000004 38.0 38.0 38.0 36.0 38.0 65-69 37.057900000000004 38.0 38.0 38.0 36.0 38.0 70-74 36.96925 38.0 38.0 38.0 35.8 38.0 75-79 36.9042 38.0 38.0 38.0 35.4 38.0 80-84 36.759100000000004 38.0 38.0 38.0 34.8 38.0 85-89 36.797999999999995 38.0 38.0 38.0 35.0 38.0 90-94 36.677 38.0 38.0 38.0 34.6 38.0 95-99 36.519999999999996 38.0 38.0 38.0 34.2 38.0 100-104 36.3971 38.0 38.0 38.0 34.0 38.0 105-109 36.189350000000005 38.0 37.4 38.0 33.4 38.0 110-114 36.1263 38.0 37.0 38.0 33.0 38.0 115-119 36.031349999999996 38.0 37.0 38.0 33.0 38.0 120-124 35.802099999999996 38.0 37.0 38.0 32.2 38.0 125-129 35.50765 38.0 36.2 38.0 31.0 38.0 130-134 35.11465 38.0 36.0 38.0 28.4 38.0 135-139 34.938900000000004 38.0 35.4 38.0 28.2 38.0 140-144 34.42810000000001 38.0 35.0 38.0 26.2 38.0 145-149 33.81195 38.0 35.0 38.0 22.0 38.0 150-151 30.136000000000003 36.5 28.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 2.0 12 1.0 13 0.0 14 1.0 15 0.0 16 1.0 17 1.0 18 4.0 19 2.0 20 6.0 21 4.0 22 9.0 23 3.0 24 12.0 25 17.0 26 13.0 27 26.0 28 20.0 29 23.0 30 35.0 31 69.0 32 67.0 33 94.0 34 157.0 35 313.0 36 772.0 37 2347.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.025 12.425 15.049999999999999 37.5 2 20.7551887971993 17.329332333083272 36.93423355838959 24.981245311327832 3 20.0 23.724999999999998 26.3 29.975 4 22.75 33.025 21.175 23.05 5 20.7 34.375 25.3 19.625 6 17.974999999999998 34.599999999999994 26.75 20.674999999999997 7 13.875000000000002 21.9 45.1 19.125 8 18.45 22.725 30.65 28.175 9 19.175 22.625 32.525 25.674999999999997 10-14 20.169999999999998 29.270000000000003 26.56 24.0 15-19 19.845 27.96 28.155 24.04 20-24 19.645000000000003 28.205000000000002 27.52 24.63 25-29 19.105 28.244999999999997 28.665000000000003 23.985 30-34 19.495 27.775 28.075 24.654999999999998 35-39 19.919999999999998 28.18 27.79 24.11 40-44 20.080000000000002 27.98 28.035 23.905 45-49 20.330000000000002 27.555000000000003 27.534999999999997 24.58 50-54 20.49 28.32 27.195000000000004 23.995 55-59 19.805 27.755000000000003 27.88 24.560000000000002 60-64 19.725 28.165000000000003 27.884999999999998 24.224999999999998 65-69 19.78 28.265 27.66 24.295 70-74 20.565 28.165000000000003 27.860000000000003 23.41 75-79 20.395 28.000000000000004 27.339999999999996 24.265 80-84 20.19 28.035 27.49 24.285 85-89 20.74 27.634999999999998 28.21 23.415 90-94 20.3 27.994999999999997 28.084999999999997 23.62 95-99 20.18 28.15 27.950000000000003 23.72 100-104 20.080000000000002 27.96 27.82 24.14 105-109 20.13 28.07 28.189999999999998 23.61 110-114 19.525000000000002 27.994999999999997 28.27 24.21 115-119 20.669999999999998 27.73 27.74 23.86 120-124 20.615 27.750000000000004 27.495000000000005 24.14 125-129 20.72 27.994999999999997 27.485 23.799999999999997 130-134 20.525 28.244999999999997 27.834999999999997 23.395 135-139 21.04 27.939999999999998 27.3 23.72 140-144 20.96 28.075 27.065 23.9 145-149 20.89 27.944999999999997 27.095000000000002 24.07 150-151 20.674999999999997 28.6125 27.025 23.6875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.0 21 0.5 22 1.5 23 3.0 24 4.5 25 5.5 26 3.5 27 2.5 28 6.5 29 10.5 30 12.0 31 14.0 32 21.5 33 35.5 34 45.0 35 58.0 36 73.0 37 90.5 38 121.5 39 140.0 40 171.0 41 224.5 42 265.0 43 289.5 44 295.0 45 285.5 46 274.0 47 261.5 48 240.0 49 221.0 50 200.5 51 162.0 52 128.0 53 92.5 54 69.0 55 52.5 56 28.5 57 19.0 58 16.5 59 14.5 60 12.0 61 7.5 62 4.5 63 6.0 64 3.0 65 1.0 66 2.0 67 1.0 68 1.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1375 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.325 0.0 0.0 0.0 0.0 106-107 0.3375 0.0 0.0 0.0 0.0 108-109 0.475 0.0 0.0 0.0 0.0 110-111 0.55 0.0 0.0 0.0 0.0 112-113 0.6 0.0 0.0 0.0 0.0 114-115 0.7125 0.0 0.0 0.0 0.0 116-117 0.8625 0.0 0.0 0.0 0.0 118-119 0.975 0.0 0.0 0.0 0.0 120-121 1.1 0.0 0.0 0.0 0.0 122-123 1.3250000000000002 0.0 0.0 0.0 0.0 124-125 1.4375 0.0 0.0 0.0 0.0 126-127 1.5875 0.0 0.0 0.0 0.0 128-129 1.85 0.025 0.0 0.0 0.0 130-131 2.0875 0.025 0.0 0.0 0.0 132-133 2.2249999999999996 0.025 0.0 0.0 0.0 134-135 2.45 0.025 0.0 0.0 0.0 136-137 2.7 0.025 0.0 0.0 0.0 138-139 2.9625 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7171882 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171882_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.94425 33.0 33.0 34.0 32.0 34.0 2 33.12225 34.0 33.0 34.0 32.0 34.0 3 33.08525 34.0 33.0 34.0 32.0 34.0 4 33.069 34.0 33.0 34.0 33.0 34.0 5 33.04525 34.0 33.0 34.0 32.0 34.0 6 37.30775 38.0 38.0 38.0 37.0 38.0 7 37.3165 38.0 38.0 38.0 37.0 38.0 8 37.153 38.0 38.0 38.0 37.0 38.0 9 37.19775 38.0 38.0 38.0 37.0 38.0 10-14 37.266149999999996 38.0 38.0 38.0 37.0 38.0 15-19 37.303250000000006 38.0 38.0 38.0 37.0 38.0 20-24 37.2461 38.0 38.0 38.0 37.0 38.0 25-29 37.241949999999996 38.0 38.0 38.0 37.0 38.0 30-34 37.17674999999999 38.0 38.0 38.0 36.8 38.0 35-39 36.78395 38.0 38.0 38.0 36.0 38.0 40-44 36.7534 38.0 38.0 38.0 36.0 38.0 45-49 37.115899999999996 38.0 38.0 38.0 36.4 38.0 50-54 37.09845 38.0 38.0 38.0 36.2 38.0 55-59 37.05145 38.0 38.0 38.0 36.0 38.0 60-64 37.0011 38.0 38.0 38.0 36.0 38.0 65-69 36.92755 38.0 38.0 38.0 36.0 38.0 70-74 36.90005 38.0 38.0 38.0 36.0 38.0 75-79 36.8506 38.0 38.0 38.0 36.0 38.0 80-84 36.7301 38.0 38.0 38.0 35.4 38.0 85-89 36.6513 38.0 38.0 38.0 35.0 38.0 90-94 36.5282 38.0 38.0 38.0 34.4 38.0 95-99 36.360499999999995 38.0 37.8 38.0 33.8 38.0 100-104 36.38765 38.0 38.0 38.0 34.0 38.0 105-109 36.20395 38.0 38.0 38.0 34.0 38.0 110-114 36.075649999999996 38.0 38.0 38.0 33.4 38.0 115-119 35.71085000000001 38.0 37.0 38.0 31.6 38.0 120-124 35.640750000000004 38.0 37.0 38.0 31.4 38.0 125-129 35.41985 38.0 36.0 38.0 30.6 38.0 130-134 35.18715 38.0 35.8 38.0 30.4 38.0 135-139 34.775400000000005 38.0 35.6 38.0 27.8 38.0 140-144 34.42229999999999 38.0 35.0 38.0 25.8 38.0 145-149 33.8794 38.0 35.0 38.0 22.8 38.0 150-151 30.212625000000003 36.5 29.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 0.0 4 1.0 5 1.0 6 2.0 7 1.0 8 1.0 9 2.0 10 2.0 11 0.0 12 0.0 13 0.0 14 2.0 15 4.0 16 0.0 17 1.0 18 1.0 19 6.0 20 8.0 21 9.0 22 6.0 23 15.0 24 10.0 25 12.0 26 22.0 27 16.0 28 28.0 29 32.0 30 40.0 31 41.0 32 61.0 33 95.0 34 173.0 35 248.0 36 631.0 37 2524.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.675000000000004 17.075000000000003 17.9 28.349999999999998 2 25.074999999999996 23.925 34.25 16.75 3 20.775 28.725 29.125 21.375 4 25.275 35.6 21.15 17.974999999999998 5 23.525 37.425000000000004 21.375 17.675 6 19.425 36.65 24.675 19.25 7 19.525000000000002 17.424999999999997 42.225 20.825 8 21.075 23.35 27.450000000000003 28.125 9 22.875 25.174999999999997 30.175 21.775 10-14 23.185 28.395 26.405 22.015 15-19 22.814999999999998 28.560000000000002 27.575 21.05 20-24 23.285 28.52 27.575 20.62 25-29 23.035 28.694999999999997 27.13 21.14 30-34 22.84052739760365 27.94906502230912 27.558028776257082 21.65237880383015 35-39 23.35012594458438 27.843828715365238 27.58690176322418 21.2191435768262 40-44 23.66377571601452 27.853973376361434 27.21359419120613 21.26865671641791 45-49 23.035 28.03 27.99 20.945 50-54 23.68 27.884999999999998 27.325 21.11 55-59 23.07 28.310000000000002 27.655 20.965 60-64 23.69 28.26 27.565 20.485 65-69 23.26 27.93 27.92 20.89 70-74 23.89 28.04 27.295 20.775 75-79 23.16 28.249999999999996 27.555000000000003 21.035 80-84 23.825 27.810000000000002 27.26 21.105 85-89 23.625 27.839999999999996 27.63 20.905 90-94 23.435 27.925 27.765 20.875 95-99 23.455000000000002 28.065 28.01 20.47 100-104 23.665 27.77 27.71 20.855 105-109 23.810000000000002 28.01 27.67 20.51 110-114 24.55 27.185 28.060000000000002 20.205000000000002 115-119 23.77 28.16 27.405 20.665 120-124 23.75 27.474999999999998 28.155 20.62 125-129 23.669999999999998 27.884999999999998 27.855 20.59 130-134 24.884999999999998 28.044999999999998 26.834999999999997 20.235 135-139 24.02 28.115000000000002 27.63 20.235 140-144 24.37 28.189999999999998 27.195000000000004 20.244999999999997 145-149 24.415 27.77 28.02 19.794999999999998 150-151 25.575 28.7375 25.7375 19.950000000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 2.5 18 3.0 19 0.5 20 0.5 21 0.5 22 0.0 23 0.0 24 0.0 25 0.5 26 1.5 27 3.0 28 5.0 29 7.0 30 8.0 31 14.0 32 21.0 33 29.0 34 36.5 35 43.5 36 62.5 37 99.0 38 126.0 39 142.5 40 193.5 41 231.5 42 260.0 43 293.5 44 304.5 45 300.0 46 290.5 47 275.5 48 252.0 49 217.0 50 171.5 51 146.0 52 124.0 53 90.5 54 63.5 55 45.5 56 36.0 57 29.0 58 22.0 59 15.0 60 8.5 61 9.0 62 4.5 63 1.0 64 2.0 65 3.0 66 2.5 67 0.5 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.265 35-39 0.75 40-44 0.84 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57264957264957 99.02499999999999 2 0.3770739064856712 0.75 3 0.025138260432378077 0.075 4 0.0 0.0 5 0.0 0.0 6 0.025138260432378077 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTTGAGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTTATCC 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.025 0.0 60-61 0.0 0.0 0.0 0.025 0.0 62-63 0.0 0.0 0.0 0.025 0.0 64-65 0.0 0.0 0.0 0.025 0.0 66-67 0.0 0.0 0.0 0.025 0.0 68-69 0.0 0.0 0.0 0.025 0.0 70-71 0.0 0.0 0.0 0.025 0.0 72-73 0.0 0.0 0.0 0.025 0.0 74-75 0.0125 0.0 0.0 0.025 0.0 76-77 0.025 0.0 0.0 0.025 0.0 78-79 0.025 0.0 0.0 0.025 0.0 80-81 0.025 0.0 0.0 0.025 0.0 82-83 0.025 0.0 0.0 0.025 0.0 84-85 0.025 0.0 0.0 0.025 0.0 86-87 0.025 0.0 0.0 0.025 0.0 88-89 0.025 0.0 0.0 0.025 0.0 90-91 0.037500000000000006 0.0 0.0 0.025 0.0 92-93 0.05 0.0 0.0 0.025 0.0 94-95 0.0625 0.0 0.0 0.025 0.0 96-97 0.1 0.0 0.0 0.025 0.0 98-99 0.1375 0.0 0.0 0.025 0.0 100-101 0.2 0.0 0.0 0.025 0.0 102-103 0.2375 0.0 0.0 0.025 0.0 104-105 0.3 0.0 0.0 0.025 0.0 106-107 0.3125 0.0 0.0 0.025 0.0 108-109 0.45 0.0 0.0 0.025 0.0 110-111 0.525 0.0 0.0 0.025 0.0 112-113 0.5875 0.0 0.0 0.025 0.0 114-115 0.7125 0.0 0.0 0.025 0.0 116-117 0.8625 0.0 0.0 0.025 0.0 118-119 0.975 0.0 0.0 0.025 0.0 120-121 1.1625 0.0 0.0 0.025 0.0 122-123 1.4 0.0 0.0 0.025 0.0 124-125 1.525 0.0 0.0 0.025 0.0 126-127 1.7 0.0 0.0 0.025 0.0 128-129 1.975 0.0 0.0 0.025 0.0 130-131 2.2125 0.0 0.0 0.025 0.0 132-133 2.3499999999999996 0.0 0.0 0.025 0.0 134-135 2.6125 0.0 0.0 0.025 0.0 136-137 2.8875 0.0 0.0 0.025 0.0 138-139 3.175 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCCCCC 40 0.007491275 18.192526 25-29 >>END_MODULE Read 1055698 spots for SRR7171882.sra Written 1055698 spots for SRR7171882.sra Read 1055698 spots for SRR7171882.sra Written 1055698 spots for SRR7171882.sra Read 1055698 spots for SRR7171882.sra Written 1055698 spots for SRR7171882.sra Read 1055698 spots for SRR7171882.sra Written 1055698 spots for SRR7171882.sra Read 1055698 spots for SRR7171882.sra Written 1055698 spots for SRR7171882.sra Read 1055698 spots for SRR7171882.sra Written 1055698 spots for SRR7171882.sra Read 1055698 spots for SRR7171882.sra Written 1055698 spots for SRR7171882.sra Read 1055698 spots for SRR7171882.sra Written 1055698 spots for SRR7171882.sra Read 1055698 spots for SRR7171882.sra Written 1055698 spots for SRR7171882.sra Read 1055698 spots for SRR7171882.sra Written 1055698 spots for SRR7171882.sra Read 1055708 spots for SRR7171882.sra Written 1055708 spots for SRR7171882.sra Read 1055698 spots for SRR7171882.sra Written 1055698 spots for SRR7171882.sra Read 1055698 spots for SRR7171882.sra Written 1055698 spots for SRR7171882.sra Read 1055698 spots for SRR7171882.sra Written 1055698 spots for SRR7171882.sra Read 1055698 spots for SRR7171882.sra Written 1055698 spots for SRR7171882.sra Read 1055698 spots for SRR7171882.sra Written 1055698 spots for SRR7171882.sra Read 1055698 spots for SRR7171882.sra Written 1055698 spots for SRR7171882.sra Read 1055698 spots for SRR7171882.sra Written 1055698 spots for SRR7171882.sra Read 1055698 spots for SRR7171882.sra Written 1055698 spots for SRR7171882.sra Read 1055698 spots for SRR7171882.sra Written 1055698 spots for SRR7171882.sra SRR ids: ['SRR7171882.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_sftgst4l SRR7171882.sra spots: 21113970 blocks: [[1, 1055698], [1055699, 2111396], [2111397, 3167094], [3167095, 4222792], [4222793, 5278490], [5278491, 6334188], [6334189, 7389886], [7389887, 8445584], [8445585, 9501282], [9501283, 10556980], [10556981, 11612678], [11612679, 12668376], [12668377, 13724074], [13724075, 14779772], [14779773, 15835470], [15835471, 16891168], [16891169, 17946866], [17946867, 19002564], [19002565, 20058262], [20058263, 21113970]] SRR7171882 file size 7133131 SRR7171882 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171882 SRR7171882_1.fastq SRR7171882_2.fastq Input file: SRR7171882_1.fastq Paired file: SRR7171882_2.fastq trimmed: SRR7171882-trimmed-pair1.fastq, SRR7171882-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 23:00:51 2025 >> started Thu Feb 13 23:01:14 2025 >> done (22.088s) 21113970 read pairs processed; of these: 12717 ( 0.06%) short read pairs filtered out after trimming by size control 7982 ( 0.04%) empty read pairs filtered out after trimming by size control 21093271 (99.90%) read pairs available; of these: 9105125 (43.17%) trimmed read pairs available after processing 11988146 (56.83%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 2 0.00% 20 4 0.00% 21 5 0.00% 22 0 0.00% 23 2 0.00% 24 1 0.00% 25 7 0.00% 26 6 0.00% 27 4 0.00% 28 6 0.00% 29 2 0.00% 30 6 0.00% 31 4 0.00% 32 7 0.00% 33 8 0.00% 34 6 0.00% 35 5 0.00% 36 4 0.00% 37 0 0.00% 38 6 0.00% 39 5 0.00% 40 5 0.00% 41 9 0.00% 42 7 0.00% 43 16 0.00% 44 2 0.00% 45 12 0.00% 46 16 0.00% 47 16 0.00% 48 17 0.00% 49 24 0.00% 50 21 0.00% 51 24 0.00% 52 26 0.00% 53 30 0.00% 54 38 0.00% 55 49 0.00% 56 49 0.00% 57 43 0.00% 58 60 0.00% 59 51 0.00% 60 82 0.00% 61 97 0.00% 62 94 0.00% 63 112 0.00% 64 128 0.00% 65 143 0.00% 66 150 0.00% 67 175 0.00% 68 184 0.00% 69 233 0.00% 70 277 0.00% 71 321 0.00% 72 358 0.00% 73 413 0.00% 74 476 0.00% 75 499 0.00% 76 645 0.00% 77 657 0.00% 78 779 0.00% 79 791 0.00% 80 964 0.00% 81 1132 0.01% 82 1258 0.01% 83 1469 0.01% 84 2237 0.01% 85 2791 0.01% 86 2936 0.01% 87 3345 0.02% 88 3544 0.02% 89 3805 0.02% 90 4024 0.02% 91 4257 0.02% 92 4656 0.02% 93 4900 0.02% 94 5422 0.03% 95 5759 0.03% 96 6096 0.03% 97 6483 0.03% 98 6959 0.03% 99 7311 0.03% 100 8058 0.04% 101 8620 0.04% 102 8860 0.04% 103 9775 0.05% 104 10413 0.05% 105 11121 0.05% 106 11628 0.06% 107 12466 0.06% 108 13325 0.06% 109 14094 0.07% 110 14710 0.07% 111 15429 0.07% 112 16861 0.08% 113 17622 0.08% 114 19084 0.09% 115 20170 0.10% 116 20811 0.10% 117 21995 0.10% 118 25081 0.12% 119 21736 0.10% 120 25176 0.12% 121 26256 0.12% 122 27598 0.13% 123 28939 0.14% 124 30866 0.15% 125 32377 0.15% 126 34117 0.16% 127 35794 0.17% 128 37583 0.18% 129 39531 0.19% 130 41928 0.20% 131 44404 0.21% 132 47374 0.22% 133 51202 0.24% 134 54199 0.26% 135 54567 0.26% 136 58708 0.28% 137 63727 0.30% 138 68913 0.33% 139 75894 0.36% 140 83028 0.39% 141 92144 0.44% 142 105415 0.50% 143 120564 0.57% 144 142394 0.68% 145 172384 0.82% 146 224295 1.06% 147 315420 1.50% 148 500563 2.37% 149 1045814 4.96% 150 5035521 23.87% 151 11988146 56.83% 21093271 reads passed initial QC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=3.64 fanout-score-rank=28 prefix-density=0.37 prefix-fanout=3.0 sequence=CCACATTTGCAGCCACTGCCACACTTGCA criterion=fanout-score sequence-density=0.09 sequence-density-rank=23 fanout-score=61.59 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=16.1 sequence=TCATCCTCATCA criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=6.91 fanout-score-rank=16 prefix-density=0.33 prefix-fanout=4.8 sequence=GGTGCTGAGAATGGCTGCAAGTG criterion=fanout-score sequence-density=0.03 sequence-density-rank=37 fanout-score=180.02 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=17.9 sequence=TTGATTTTGTTATCTCAAAGCTTACACTGTTTATAGTTTGATTACCTGCGCAACAAAATGACACTCTTTGGTAAGATGGAGGCTGAAGTAGAGATCAAAGTTTCTGCTGAAACATTTCATGATATCTTCAGCTGCAGACCACACCACGTTTCCAATATGAGCCCTGCCAAGATACAGAATGTTGATCTGCATGAAGGTGAATGGG SRR7171882 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 23:02:05 Started mapping on | Feb 13 23:02:05 Finished on | Feb 13 23:04:40 Mapping speed, Million of reads per hour | 489.91 Number of input reads | 21093271 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 19761129 Uniquely mapped reads % | 93.68% Average mapped length | 296.57 Number of splices: Total | 19732750 Number of splices: Annotated (sjdb) | 19357152 Number of splices: GT/AG | 19402210 Number of splices: GC/AG | 257169 Number of splices: AT/AC | 16725 Number of splices: Non-canonical | 56646 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.60 Insertion rate per base | 0.02% Insertion average length | 2.63 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 540294 % of reads mapped to multiple loci | 2.56% Number of reads mapped to too many loci | 63056 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.35% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 805226 805226 805226 N_multimapping 540294 540294 540294 N_noFeature 512437 19587268 594298 N_ambiguous 208321 867 115978 UnstrandedReadsAssigned:19040371 PositiveStrandReadsAssigned:172994 NegativeStrandReadsAssigned:19050853 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7171882 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171882-trimmed-pair1.fastq SRR7171882-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,093,271 reads, 18,802,282 reads pseudoaligned [quant] estimated average fragment length: 260.24 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,116 rounds 52401 SRR7171882.ke.tsv 34699 SRR7171882.se.tsv 87100 total ==> SRR7171882.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1758.76 1844 53.6372 Potri.005G024800.1.v4.1 1035 775.76 453 29.8733 Potri.004G059700.1.v4.1 961 701.776 30 2.18693 Potri.007G009000.2.v4.1 1416 1156.76 0 0 Potri.003G141000.2.v4.1 2943 2683.76 776 14.7921 Potri.016G087400.1.v4.1 270 68.4673 982 733.737 Potri.015G069301.1.v4.1 564 309.606 0 0 Potri.010G195200.1.v4.1 1773 1513.76 402 13.5857 Potri.012G127500.1.v4.1 977 717.765 12110 863.125 ==> SRR7171882.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 21 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 389 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 460 SRR7171882 completed mapping pipeline successfully