Starting /dee2/code/volunteer_pipeline.sh SRR7171883 current disk space = 3089290608640 free memory = 1472265320 SRR7171883 SRAfilesize ce68d39b7b8bb4277d26b02ef4009684 SRR7171883.sra SRR7171883.sra file validated SRR7171883 is paired end SRR7171883 is conventional basespace SRR7171883 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171883_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9685 33.0 33.0 34.0 32.0 34.0 2 33.20575 34.0 33.0 34.0 33.0 34.0 3 32.36275 33.0 33.0 33.0 31.0 34.0 4 32.65675 33.0 33.0 33.0 31.0 34.0 5 33.13825 33.0 33.0 34.0 33.0 34.0 6 36.56475 38.0 37.0 38.0 34.0 38.0 7 36.981 38.0 37.0 38.0 35.0 38.0 8 37.012 38.0 38.0 38.0 35.0 38.0 9 37.361 38.0 38.0 38.0 37.0 38.0 10-14 37.53805 38.0 38.0 38.0 37.2 38.0 15-19 37.5679 38.0 38.0 38.0 37.2 38.0 20-24 37.56845 38.0 38.0 38.0 37.4 38.0 25-29 37.556400000000004 38.0 38.0 38.0 38.0 38.0 30-34 37.52975 38.0 38.0 38.0 37.6 38.0 35-39 37.52675 38.0 38.0 38.0 37.2 38.0 40-44 37.46735 38.0 38.0 38.0 37.0 38.0 45-49 37.4023 38.0 38.0 38.0 37.0 38.0 50-54 37.3996 38.0 38.0 38.0 37.0 38.0 55-59 37.347449999999995 38.0 38.0 38.0 37.0 38.0 60-64 37.27995 38.0 38.0 38.0 36.8 38.0 65-69 37.2665 38.0 38.0 38.0 36.6 38.0 70-74 37.15560000000001 38.0 38.0 38.0 36.0 38.0 75-79 37.1262 38.0 38.0 38.0 36.0 38.0 80-84 37.0817 38.0 38.0 38.0 36.0 38.0 85-89 37.059 38.0 38.0 38.0 36.0 38.0 90-94 36.92635 38.0 38.0 38.0 35.4 38.0 95-99 36.8219 38.0 38.0 38.0 35.2 38.0 100-104 36.65145 38.0 38.0 38.0 34.2 38.0 105-109 36.56835 38.0 38.0 38.0 34.0 38.0 110-114 36.3618 38.0 37.6 38.0 34.0 38.0 115-119 36.251149999999996 38.0 37.0 38.0 33.6 38.0 120-124 36.1092 38.0 37.0 38.0 33.2 38.0 125-129 36.0327 38.0 37.0 38.0 33.0 38.0 130-134 35.71665 38.0 36.0 38.0 31.2 38.0 135-139 35.4203 38.0 36.0 38.0 30.6 38.0 140-144 35.09245 38.0 35.4 38.0 28.6 38.0 145-149 34.642250000000004 38.0 35.0 38.0 27.8 38.0 150-151 31.309375000000003 36.5 31.5 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 0.0 14 0.0 15 1.0 16 0.0 17 2.0 18 0.0 19 1.0 20 3.0 21 1.0 22 3.0 23 3.0 24 6.0 25 7.0 26 11.0 27 9.0 28 11.0 29 22.0 30 27.0 31 49.0 32 66.0 33 89.0 34 122.0 35 269.0 36 706.0 37 2590.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.56014003500875 14.628657164291074 10.677669417354338 34.133533383345835 2 19.375 18.55 36.125 25.95 3 19.400000000000002 26.85 26.450000000000003 27.3 4 23.325000000000003 32.375 22.650000000000002 21.65 5 20.849999999999998 37.475 23.375 18.3 6 17.549999999999997 36.1 26.625 19.725 7 14.149999999999999 21.8 44.525 19.525000000000002 8 17.95 21.5 30.65 29.9 9 17.125 24.275 31.724999999999998 26.875 10-14 19.759999999999998 29.705 26.765 23.77 15-19 20.035 28.044999999999998 28.28 23.64 20-24 19.994999999999997 27.91 28.335 23.76 25-29 19.555 28.42 28.189999999999998 23.835 30-34 19.61 29.14 27.355 23.895 35-39 19.985 28.37 27.589999999999996 24.055 40-44 20.085 28.535 27.705000000000002 23.674999999999997 45-49 19.735 28.139999999999997 28.02 24.104999999999997 50-54 20.18 27.705000000000002 28.335 23.78 55-59 20.330000000000002 28.555000000000003 27.900000000000002 23.215 60-64 20.27 28.365000000000002 27.474999999999998 23.89 65-69 20.445 27.97 27.415 24.169999999999998 70-74 19.965 28.63 27.51 23.895 75-79 20.244999999999997 27.83 27.735 24.19 80-84 20.18 27.57 27.93 24.32 85-89 20.11 28.13 27.650000000000002 24.11 90-94 20.44 27.66 27.800000000000004 24.099999999999998 95-99 20.415 28.275 27.750000000000004 23.56 100-104 20.5 27.875 27.91 23.715 105-109 20.765 27.41 27.884999999999998 23.94 110-114 20.06 27.810000000000002 28.075 24.055 115-119 20.580000000000002 27.98 27.894999999999996 23.544999999999998 120-124 20.525 27.91 27.87 23.695 125-129 21.29 27.88 27.055 23.775 130-134 21.0 27.860000000000003 27.589999999999996 23.549999999999997 135-139 20.8 27.965 27.36 23.875 140-144 20.815 27.555000000000003 27.495000000000005 24.135 145-149 20.75 28.225 27.315 23.71 150-151 20.1 29.125 27.05 23.724999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.5 20 1.0 21 2.0 22 2.5 23 2.0 24 1.0 25 1.5 26 2.5 27 6.0 28 8.5 29 13.0 30 17.0 31 20.0 32 28.0 33 29.0 34 43.0 35 72.5 36 98.5 37 102.0 38 125.5 39 154.0 40 178.0 41 211.5 42 237.0 43 271.0 44 295.0 45 285.5 46 269.5 47 266.5 48 257.5 49 224.0 50 177.5 51 144.5 52 116.0 53 89.0 54 59.0 55 43.0 56 38.0 57 26.0 58 24.0 59 19.0 60 7.5 61 7.5 62 6.0 63 4.0 64 3.5 65 3.0 66 1.5 67 1.0 68 1.0 69 0.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0125 0.0 0.0 0.0 46-47 0.0 0.025 0.0 0.0 0.0 48-49 0.0 0.025 0.0 0.0 0.0 50-51 0.0 0.025 0.0 0.0 0.0 52-53 0.0 0.025 0.0 0.0 0.0 54-55 0.0 0.025 0.0 0.0 0.0 56-57 0.0 0.025 0.0 0.0 0.0 58-59 0.0 0.025 0.0 0.0 0.0 60-61 0.0 0.025 0.0 0.0 0.0 62-63 0.0 0.025 0.0 0.0 0.0 64-65 0.0 0.025 0.0 0.0 0.0 66-67 0.0 0.025 0.0 0.0 0.0 68-69 0.0 0.025 0.0 0.0 0.0 70-71 0.0 0.025 0.0 0.0 0.0 72-73 0.0 0.025 0.0 0.0 0.0 74-75 0.0 0.025 0.0 0.0 0.0 76-77 0.0 0.025 0.0 0.0 0.0 78-79 0.025 0.025 0.0 0.0 0.0 80-81 0.037500000000000006 0.025 0.0 0.0 0.0 82-83 0.0875 0.025 0.0 0.0 0.0 84-85 0.1 0.025 0.0 0.0 0.0 86-87 0.1 0.025 0.0 0.0 0.0 88-89 0.1375 0.025 0.0 0.0 0.0 90-91 0.15 0.025 0.0 0.0 0.0 92-93 0.15 0.025 0.0 0.0 0.0 94-95 0.175 0.025 0.0 0.0 0.0 96-97 0.21250000000000002 0.025 0.0 0.0 0.0 98-99 0.225 0.025 0.0 0.0 0.0 100-101 0.2875 0.025 0.0 0.0 0.0 102-103 0.325 0.025 0.0 0.0 0.0 104-105 0.325 0.025 0.0 0.0 0.0 106-107 0.325 0.025 0.0 0.0 0.0 108-109 0.38749999999999996 0.025 0.0 0.0 0.0 110-111 0.4625 0.025 0.0 0.0 0.0 112-113 0.525 0.025 0.0 0.0 0.0 114-115 0.5874999999999999 0.025 0.0 0.0 0.0 116-117 0.675 0.025 0.0 0.0 0.0 118-119 0.825 0.025 0.0 0.0 0.0 120-121 0.9125000000000001 0.025 0.0 0.0 0.0 122-123 0.975 0.025 0.0 0.0 0.0 124-125 1.05 0.025 0.0 0.0 0.0 126-127 1.15 0.025 0.0 0.0 0.0 128-129 1.3125 0.025 0.0 0.0 0.0 130-131 1.575 0.025 0.0 0.0 0.0 132-133 1.7375 0.025 0.0 0.0 0.0 134-135 2.05 0.025 0.0 0.0 0.0 136-137 2.4 0.025 0.0 0.0 0.0 138-139 2.675 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCAGAT 10 0.006830828 145.0 1 >>END_MODULE SRR7171883 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171883_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.96025 33.0 33.0 34.0 32.0 34.0 2 33.04775 34.0 33.0 34.0 32.0 34.0 3 33.09475 34.0 33.0 34.0 33.0 34.0 4 33.021 34.0 33.0 34.0 32.0 34.0 5 33.011 34.0 33.0 34.0 33.0 34.0 6 37.1085 38.0 38.0 38.0 37.0 38.0 7 37.24075 38.0 38.0 38.0 37.0 38.0 8 37.181 38.0 38.0 38.0 37.0 38.0 9 37.22525 38.0 38.0 38.0 37.0 38.0 10-14 37.11475 38.0 38.0 38.0 36.6 38.0 15-19 37.0721 38.0 38.0 38.0 36.6 38.0 20-24 37.0847 38.0 38.0 38.0 37.0 38.0 25-29 37.01765 38.0 38.0 38.0 36.6 38.0 30-34 36.977199999999996 38.0 38.0 38.0 36.8 38.0 35-39 36.5561 38.0 38.0 38.0 36.0 38.0 40-44 36.40955 38.0 38.0 38.0 35.2 38.0 45-49 36.89489999999999 38.0 38.0 38.0 36.0 38.0 50-54 36.88099999999999 38.0 38.0 38.0 36.0 38.0 55-59 36.83815 38.0 38.0 38.0 36.0 38.0 60-64 36.801 38.0 38.0 38.0 35.6 38.0 65-69 36.718900000000005 38.0 38.0 38.0 35.6 38.0 70-74 36.722500000000004 38.0 38.0 38.0 35.0 38.0 75-79 36.682249999999996 38.0 38.0 38.0 35.0 38.0 80-84 36.65475 38.0 38.0 38.0 34.8 38.0 85-89 36.440099999999994 38.0 38.0 38.0 34.0 38.0 90-94 36.338699999999996 38.0 38.0 38.0 34.0 38.0 95-99 36.282000000000004 38.0 38.0 38.0 34.0 38.0 100-104 36.086400000000005 38.0 37.6 38.0 33.4 38.0 105-109 36.0037 38.0 37.0 38.0 33.0 38.0 110-114 35.86685 38.0 37.0 38.0 33.0 38.0 115-119 35.809450000000005 38.0 37.0 38.0 32.6 38.0 120-124 35.35725 38.0 36.2 38.0 30.0 38.0 125-129 35.2079 38.0 36.0 38.0 29.4 38.0 130-134 35.013400000000004 38.0 36.0 38.0 28.6 38.0 135-139 34.708299999999994 38.0 35.2 38.0 27.6 38.0 140-144 34.33675 38.0 35.0 38.0 25.8 38.0 145-149 33.828 38.0 34.6 38.0 23.0 38.0 150-151 30.077624999999998 36.5 28.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 1.0 4 4.0 5 3.0 6 0.0 7 1.0 8 1.0 9 1.0 10 3.0 11 0.0 12 1.0 13 2.0 14 1.0 15 1.0 16 9.0 17 2.0 18 7.0 19 6.0 20 9.0 21 8.0 22 4.0 23 6.0 24 9.0 25 11.0 26 16.0 27 23.0 28 24.0 29 36.0 30 46.0 31 49.0 32 73.0 33 95.0 34 167.0 35 296.0 36 666.0 37 2411.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.4 16.7 14.625 26.275 2 23.625 24.775 33.25 18.35 3 21.825 27.575 30.3 20.3 4 25.3 34.175 21.15 19.375 5 24.95 37.225 22.125 15.7 6 20.175 36.775000000000006 24.55 18.5 7 19.45 18.45 41.55 20.549999999999997 8 20.974999999999998 22.825 28.725 27.474999999999998 9 23.075000000000003 25.2 28.549999999999997 23.175 10-14 22.509999999999998 29.175 26.555 21.759999999999998 15-19 22.8 28.07 28.23 20.9 20-24 23.095 28.860000000000003 27.065 20.979999999999997 25-29 22.705000000000002 28.310000000000002 27.700000000000003 21.285 30-34 23.128194848150745 28.485516688383285 27.43309612107848 20.953192342387492 35-39 22.63663967611336 27.74291497975708 28.05668016194332 21.563765182186234 40-44 22.738101272238836 27.968979674590706 27.882812104009325 21.410106949161133 45-49 23.119999999999997 27.875 27.66 21.345 50-54 23.200000000000003 27.950000000000003 27.49 21.36 55-59 23.315 28.58 27.235 20.87 60-64 23.125 27.715 28.175 20.985 65-69 23.200000000000003 28.060000000000002 27.63 21.11 70-74 23.665 27.639999999999997 27.715 20.979999999999997 75-79 23.880000000000003 28.439999999999998 27.529999999999998 20.150000000000002 80-84 23.895 27.71 27.915 20.48 85-89 23.72 28.055000000000003 27.625 20.599999999999998 90-94 23.185 28.595 27.295 20.925 95-99 23.695 27.650000000000002 27.855 20.8 100-104 23.995 27.735 27.825 20.445 105-109 23.905 27.415 28.095 20.585 110-114 23.715 27.694999999999997 27.77 20.82 115-119 23.945 28.050000000000004 27.615000000000002 20.39 120-124 24.044999999999998 27.515 27.77 20.669999999999998 125-129 23.805 27.839999999999996 27.88 20.474999999999998 130-134 23.885 27.66 27.975 20.48 135-139 23.905 28.050000000000004 27.735 20.31 140-144 24.42 27.52 27.715 20.345 145-149 24.135 27.889999999999997 27.83 20.145 150-151 24.1375 27.762500000000003 27.9125 20.1875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 1.5 22 2.0 23 1.5 24 1.5 25 2.5 26 4.0 27 4.0 28 4.5 29 5.5 30 10.0 31 14.5 32 18.0 33 27.0 34 37.5 35 56.5 36 78.5 37 100.0 38 137.0 39 175.5 40 203.5 41 220.5 42 244.0 43 286.5 44 292.5 45 300.5 46 303.0 47 268.0 48 224.5 49 200.5 50 177.0 51 129.0 52 103.0 53 86.0 54 68.0 55 49.0 56 37.5 57 34.5 58 24.5 59 14.5 60 10.5 61 7.0 62 5.0 63 6.0 64 6.5 65 3.5 66 2.0 67 2.5 68 2.0 69 0.5 70 0.5 71 0.5 72 0.5 73 0.5 74 1.0 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.22999999999999998 35-39 1.2 40-44 1.355 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67369477911646 99.275 2 0.30120481927710846 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0251004016064257 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTTGAGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTTATCC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.1875 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.2375 0.0 0.0 0.0 0.0 102-103 0.275 0.0 0.0 0.0 0.0 104-105 0.275 0.0 0.0 0.0 0.0 106-107 0.275 0.0 0.0 0.0 0.0 108-109 0.3375 0.0 0.0 0.0 0.0 110-111 0.4125 0.0 0.0 0.0 0.0 112-113 0.5 0.0 0.0 0.0 0.0 114-115 0.5625 0.0 0.0 0.0 0.0 116-117 0.65 0.0 0.0 0.0 0.0 118-119 0.8 0.0 0.0 0.0 0.0 120-121 0.8875 0.0 0.0 0.0 0.0 122-123 0.95 0.0 0.0 0.0 0.0 124-125 1.025 0.0 0.0 0.0 0.0 126-127 1.1 0.0 0.0 0.0 0.0 128-129 1.2374999999999998 0.0 0.0 0.0 0.0 130-131 1.5 0.0 0.0 0.0 0.0 132-133 1.6875 0.0 0.0 0.0 0.0 134-135 2.0 0.0 0.0 0.0 0.0 136-137 2.3625 0.0 0.0 0.0 0.0 138-139 2.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGAATCC 10 0.006883923 144.625 6 TTTTTTT 40 0.0077702245 18.078125 140-144 >>END_MODULE Read 766304 spots for SRR7171883.sra Written 766304 spots for SRR7171883.sra Read 766304 spots for SRR7171883.sra Written 766304 spots for SRR7171883.sra Read 766304 spots for SRR7171883.sra Written 766304 spots for SRR7171883.sra Read 766304 spots for SRR7171883.sra Written 766304 spots for SRR7171883.sra Read 766304 spots for SRR7171883.sra Written 766304 spots for SRR7171883.sra Read 766304 spots for SRR7171883.sra Written 766304 spots for SRR7171883.sra Read 766304 spots for SRR7171883.sra Written 766304 spots for SRR7171883.sra Read 766304 spots for SRR7171883.sra Written 766304 spots for SRR7171883.sra Read 766304 spots for SRR7171883.sra Written 766304 spots for SRR7171883.sra Read 766304 spots for SRR7171883.sra Written 766304 spots for SRR7171883.sra Read 766304 spots for SRR7171883.sra Written 766304 spots for SRR7171883.sra Read 766304 spots for SRR7171883.sra Written 766304 spots for SRR7171883.sra Read 766304 spots for SRR7171883.sra Written 766304 spots for SRR7171883.sra Read 766304 spots for SRR7171883.sra Written 766304 spots for SRR7171883.sra Read 766304 spots for SRR7171883.sra Written 766304 spots for SRR7171883.sra Read 766304 spots for SRR7171883.sra Written 766304 spots for SRR7171883.sra Read 766304 spots for SRR7171883.sra Written 766304 spots for SRR7171883.sra Read 766304 spots for SRR7171883.sra Written 766304 spots for SRR7171883.sra Read 766306 spots for SRR7171883.sra Written 766306 spots for SRR7171883.sra Read 766304 spots for SRR7171883.sra Written 766304 spots for SRR7171883.sra SRR ids: ['SRR7171883.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ke3q6ua0 SRR7171883.sra spots: 15326082 blocks: [[1, 766304], [766305, 1532608], [1532609, 2298912], [2298913, 3065216], [3065217, 3831520], [3831521, 4597824], [4597825, 5364128], [5364129, 6130432], [6130433, 6896736], [6896737, 7663040], [7663041, 8429344], [8429345, 9195648], [9195649, 9961952], [9961953, 10728256], [10728257, 11494560], [11494561, 12260864], [12260865, 13027168], [13027169, 13793472], [13793473, 14559776], [14559777, 15326082]] SRR7171883 file size 5171805 SRR7171883 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171883 SRR7171883_1.fastq SRR7171883_2.fastq Input file: SRR7171883_1.fastq Paired file: SRR7171883_2.fastq trimmed: SRR7171883-trimmed-pair1.fastq, SRR7171883-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 22:44:51 2025 >> started Thu Feb 13 22:45:09 2025 >> done (18.042s) 15326082 read pairs processed; of these: 20111 ( 0.13%) short read pairs filtered out after trimming by size control 14453 ( 0.09%) empty read pairs filtered out after trimming by size control 15291518 (99.77%) read pairs available; of these: 6281352 (41.08%) trimmed read pairs available after processing 9010166 (58.92%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 1 0.00% 21 2 0.00% 22 6 0.00% 23 3 0.00% 24 4 0.00% 25 4 0.00% 26 2 0.00% 27 5 0.00% 28 5 0.00% 29 4 0.00% 30 4 0.00% 31 2 0.00% 32 5 0.00% 33 7 0.00% 34 3 0.00% 35 2 0.00% 36 5 0.00% 37 3 0.00% 38 4 0.00% 39 5 0.00% 40 4 0.00% 41 7 0.00% 42 3 0.00% 43 3 0.00% 44 6 0.00% 45 4 0.00% 46 10 0.00% 47 7 0.00% 48 9 0.00% 49 9 0.00% 50 16 0.00% 51 15 0.00% 52 25 0.00% 53 16 0.00% 54 20 0.00% 55 32 0.00% 56 41 0.00% 57 31 0.00% 58 41 0.00% 59 49 0.00% 60 50 0.00% 61 42 0.00% 62 55 0.00% 63 60 0.00% 64 84 0.00% 65 82 0.00% 66 121 0.00% 67 131 0.00% 68 137 0.00% 69 135 0.00% 70 168 0.00% 71 194 0.00% 72 200 0.00% 73 275 0.00% 74 285 0.00% 75 318 0.00% 76 416 0.00% 77 435 0.00% 78 458 0.00% 79 541 0.00% 80 623 0.00% 81 721 0.00% 82 878 0.01% 83 971 0.01% 84 1909 0.01% 85 2521 0.02% 86 2455 0.02% 87 2854 0.02% 88 2880 0.02% 89 2969 0.02% 90 3063 0.02% 91 3312 0.02% 92 3455 0.02% 93 3694 0.02% 94 3892 0.03% 95 4031 0.03% 96 4264 0.03% 97 4548 0.03% 98 4971 0.03% 99 5150 0.03% 100 5460 0.04% 101 5862 0.04% 102 6357 0.04% 103 6732 0.04% 104 7093 0.05% 105 7508 0.05% 106 8003 0.05% 107 8597 0.06% 108 9097 0.06% 109 9461 0.06% 110 10159 0.07% 111 10665 0.07% 112 11456 0.07% 113 12237 0.08% 114 13014 0.09% 115 13710 0.09% 116 14193 0.09% 117 14908 0.10% 118 15403 0.10% 119 16554 0.11% 120 17020 0.11% 121 17764 0.12% 122 18868 0.12% 123 20147 0.13% 124 21179 0.14% 125 22251 0.15% 126 23227 0.15% 127 24664 0.16% 128 26037 0.17% 129 27245 0.18% 130 28331 0.19% 131 30053 0.20% 132 32361 0.21% 133 34476 0.23% 134 36937 0.24% 135 39303 0.26% 136 42375 0.28% 137 45657 0.30% 138 49718 0.33% 139 54053 0.35% 140 59164 0.39% 141 65626 0.43% 142 73474 0.48% 143 84448 0.55% 144 99605 0.65% 145 121016 0.79% 146 154478 1.01% 147 215994 1.41% 148 341143 2.23% 149 695406 4.55% 150 3489088 22.82% 151 9010166 58.92% 15291518 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=3.58 fanout-score-rank=29 prefix-density=0.34 prefix-fanout=3.1 sequence=CCACATTTGCAGCCACTGCCACACTTGCA criterion=fanout-score sequence-density=0.02 sequence-density-rank=35 fanout-score=56.42 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=10.4 sequence=CAAAGCAGCAGGAAATACAAGACACTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCAT criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=4.70 fanout-score-rank=22 prefix-density=0.46 prefix-fanout=3.2 sequence=AAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCCTTCGATGATGAGAACAAGATCATAACTCTTAATGGTTTGGAAGGAGATGTCATGAAAATTTACAAGGTCTATAGGCCCGTCTGGCAGCTTACACCAAAAGGCTCGGGCTGCTTGGCAAAACTGACCATTGAATACGAAAAACTCCATCCTGAAGTCCCGGTTCCAGAGATTTATGTTGATCTTATGGTTCATATGACTAAAGACATCGACGAAGCCCTTAGCACGGAGTAATAGAAGGGGTCATCGATCTCGACCAATAAGCATCACATGTTTGTGATCATGCTAGTACTTGTATAATATATATCTAAGCGCTTTCGTGCAACGAGTTCAGTACTGCATCAATGTGTGTGATT criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=60.12 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=7.9 sequence=TTTTCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTAC SRR7171883 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 22:45:54 Started mapping on | Feb 13 22:45:54 Finished on | Feb 13 22:47:32 Mapping speed, Million of reads per hour | 561.73 Number of input reads | 15291518 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 14374378 Uniquely mapped reads % | 94.00% Average mapped length | 296.73 Number of splices: Total | 14064315 Number of splices: Annotated (sjdb) | 13791422 Number of splices: GT/AG | 13827653 Number of splices: GC/AG | 184040 Number of splices: AT/AC | 10848 Number of splices: Non-canonical | 41774 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.46 Insertion rate per base | 0.02% Insertion average length | 2.62 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 360270 % of reads mapped to multiple loci | 2.36% Number of reads mapped to too many loci | 41236 % of reads mapped to too many loci | 0.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.31% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 575253 575253 575253 N_multimapping 360270 360270 360270 N_noFeature 381415 14246871 442592 N_ambiguous 139169 1083 72064 UnstrandedReadsAssigned:13853794 PositiveStrandReadsAssigned:126424 NegativeStrandReadsAssigned:13859722 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7171883 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171883-trimmed-pair1.fastq SRR7171883-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,291,518 reads, 13,728,493 reads pseudoaligned [quant] estimated average fragment length: 259.779 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,157 rounds 52401 SRR7171883.ke.tsv 34699 SRR7171883.se.tsv 87100 total ==> SRR7171883.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1759.22 1263 52.0349 Potri.005G024800.1.v4.1 1035 776.221 205 19.1417 Potri.004G059700.1.v4.1 961 702.238 12 1.23854 Potri.007G009000.2.v4.1 1416 1157.22 0 0 Potri.003G141000.2.v4.1 2943 2684.22 536.354 14.4825 Potri.016G087400.1.v4.1 270 67.6175 686 735.32 Potri.015G069301.1.v4.1 564 309.525 0 0 Potri.010G195200.1.v4.1 1773 1514.22 394.87 18.9006 Potri.012G127500.1.v4.1 977 718.238 17727 1788.87 ==> SRR7171883.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 71 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 322 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 523 SRR7171883 completed mapping pipeline successfully