Starting /dee2/code/volunteer_pipeline.sh SRR7171884 current disk space = 3089285455872 free memory = 1449873900 SRR7171884 SRAfilesize aa07b374badad3ce0449443edf83b615 SRR7171884.sra SRR7171884.sra file validated SRR7171884 is paired end SRR7171884 is conventional basespace SRR7171884 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171884_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.0155 30.0 18.0 33.0 18.0 33.0 2 25.1995 28.0 18.0 31.0 18.0 33.0 3 30.35725 31.0 29.0 33.0 27.0 33.0 4 31.7385 33.0 32.0 33.0 30.0 33.0 5 32.12575 33.0 32.0 33.0 31.0 33.0 6 34.67925 37.0 34.0 38.0 29.0 38.0 7 35.95425 38.0 36.0 38.0 33.0 38.0 8 37.011 38.0 38.0 38.0 35.0 38.0 9 37.164 38.0 38.0 38.0 36.0 38.0 10-14 37.4149 38.0 38.0 38.0 36.8 38.0 15-19 37.4978 38.0 38.0 38.0 37.0 38.0 20-24 37.5252 38.0 38.0 38.0 37.6 38.0 25-29 37.55485 38.0 38.0 38.0 38.0 38.0 30-34 37.50364999999999 38.0 38.0 38.0 38.0 38.0 35-39 37.48385 38.0 38.0 38.0 37.8 38.0 40-44 37.481399999999994 38.0 38.0 38.0 37.6 38.0 45-49 37.43365 38.0 38.0 38.0 37.0 38.0 50-54 37.400549999999996 38.0 38.0 38.0 37.0 38.0 55-59 37.3061 38.0 38.0 38.0 37.0 38.0 60-64 37.2361 38.0 38.0 38.0 36.6 38.0 65-69 37.22645 38.0 38.0 38.0 36.0 38.0 70-74 37.15535 38.0 38.0 38.0 36.0 38.0 75-79 37.08865 38.0 38.0 38.0 36.0 38.0 80-84 37.0375 38.0 38.0 38.0 36.0 38.0 85-89 37.027499999999996 38.0 38.0 38.0 36.0 38.0 90-94 36.961 38.0 38.0 38.0 35.8 38.0 95-99 36.77625 38.0 38.0 38.0 35.0 38.0 100-104 36.64925 38.0 38.0 38.0 34.0 38.0 105-109 36.54905 38.0 38.0 38.0 34.0 38.0 110-114 36.352999999999994 38.0 37.4 38.0 34.0 38.0 115-119 36.3172 38.0 38.0 38.0 34.0 38.0 120-124 36.124100000000006 38.0 37.0 38.0 33.4 38.0 125-129 35.80595 38.0 36.6 38.0 32.2 38.0 130-134 35.6988 38.0 36.2 38.0 31.8 38.0 135-139 35.2481 38.0 36.0 38.0 30.0 38.0 140-144 35.011 38.0 35.4 38.0 28.2 38.0 145-149 34.44755 38.0 35.0 38.0 27.4 38.0 150-151 31.273375 36.5 31.5 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 1.0 9 0.0 10 0.0 11 0.0 12 2.0 13 1.0 14 1.0 15 0.0 16 0.0 17 2.0 18 1.0 19 3.0 20 1.0 21 0.0 22 7.0 23 2.0 24 10.0 25 7.0 26 14.0 27 15.0 28 18.0 29 25.0 30 34.0 31 33.0 32 59.0 33 81.0 34 136.0 35 313.0 36 849.0 37 2383.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.475 15.6 10.725 35.199999999999996 2 18.15 21.15 36.875 23.825 3 17.849999999999998 28.075 27.200000000000003 26.875 4 21.875 34.9 22.475 20.75 5 21.55 36.625 22.6 19.225 6 17.575 36.449999999999996 24.675 21.3 7 13.675 22.7 43.525000000000006 20.1 8 18.475 23.0 29.349999999999998 29.175 9 16.675 22.85 32.65 27.825 10-14 20.145 29.459999999999997 26.51 23.885 15-19 19.415 28.365000000000002 28.194999999999997 24.025 20-24 19.535 28.804999999999996 27.825 23.835 25-29 20.09 28.194999999999997 27.98 23.735 30-34 19.564999999999998 28.475 28.000000000000004 23.96 35-39 19.759999999999998 28.535 28.105000000000004 23.599999999999998 40-44 20.330000000000002 28.64 27.279999999999998 23.75 45-49 20.27 28.24 27.915 23.575 50-54 19.7 28.185 27.985 24.13 55-59 19.885 28.199999999999996 28.17 23.745 60-64 20.22 28.525 27.955000000000002 23.3 65-69 20.26 27.810000000000002 27.87 24.060000000000002 70-74 20.04 28.51 27.71 23.74 75-79 20.04 28.435 27.644999999999996 23.880000000000003 80-84 20.755000000000003 28.065 27.445000000000004 23.735 85-89 20.29 28.24 27.955000000000002 23.515 90-94 20.125 28.58 27.525 23.77 95-99 20.34 28.084999999999997 28.155 23.419999999999998 100-104 20.375 27.994999999999997 28.035 23.595 105-109 20.355 27.99 27.91 23.745 110-114 20.54 28.18 27.72 23.56 115-119 20.49 27.834999999999997 28.044999999999998 23.630000000000003 120-124 20.445 27.93 27.73 23.895 125-129 20.77 27.889999999999997 27.83 23.51 130-134 20.165 28.12 28.04 23.674999999999997 135-139 20.605 27.935 27.615000000000002 23.845 140-144 20.78 27.73 27.325 24.165 145-149 21.08 27.450000000000003 28.03 23.44 150-151 20.75 27.825 28.487499999999997 22.9375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 1.0 18 1.0 19 0.0 20 0.0 21 0.5 22 1.5 23 2.0 24 2.5 25 1.5 26 2.0 27 6.0 28 11.0 29 13.0 30 16.0 31 23.5 32 38.0 33 48.5 34 51.0 35 60.0 36 90.0 37 120.0 38 138.5 39 167.0 40 198.5 41 228.0 42 244.0 43 254.5 44 272.5 45 265.0 46 261.0 47 263.5 48 232.5 49 202.0 50 177.5 51 152.0 52 114.0 53 80.5 54 71.0 55 52.0 56 30.5 57 22.5 58 19.5 59 15.0 60 11.0 61 9.0 62 7.5 63 6.0 64 4.5 65 4.0 66 2.5 67 1.0 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74924774322969 99.45 2 0.20060180541624875 0.4 3 0.05015045135406219 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.07500000000000001 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.21250000000000002 0.0 0.0 0.0 0.0 102-103 0.2625 0.0 0.0 0.0 0.0 104-105 0.325 0.0 0.0 0.0 0.0 106-107 0.3375 0.0 0.0 0.0 0.0 108-109 0.4 0.0 0.0 0.0 0.0 110-111 0.55 0.0 0.0 0.0 0.0 112-113 0.5625 0.0 0.0 0.0 0.0 114-115 0.6625000000000001 0.0 0.0 0.0 0.0 116-117 0.7625 0.0 0.0 0.0 0.0 118-119 0.8625 0.0 0.0 0.0 0.0 120-121 0.975 0.0 0.0 0.0 0.0 122-123 1.0625 0.0 0.0 0.0 0.0 124-125 1.1749999999999998 0.0 0.0 0.0 0.0 126-127 1.325 0.0 0.0 0.0 0.0 128-129 1.4125 0.0 0.0 0.0 0.0 130-131 1.5625 0.0 0.0 0.0 0.0 132-133 1.6625 0.0 0.0 0.0 0.0 134-135 1.8375 0.0 0.0 0.0 0.0 136-137 1.975 0.0 0.0 0.0 0.0 138-139 2.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTTTCT 10 0.006830828 145.0 1 TTTCTCT 10 0.006830828 145.0 3 TTTTCTC 10 0.006830828 145.0 2 TTCTCTG 10 0.006830828 145.0 4 >>END_MODULE SRR7171884 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171884_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.04125 33.0 33.0 34.0 32.0 34.0 2 33.1955 34.0 33.0 34.0 33.0 34.0 3 33.177 34.0 33.0 34.0 33.0 34.0 4 33.20975 34.0 33.0 34.0 33.0 34.0 5 33.187 34.0 33.0 34.0 33.0 34.0 6 37.42475 38.0 38.0 38.0 38.0 38.0 7 37.3405 38.0 38.0 38.0 37.0 38.0 8 37.332 38.0 38.0 38.0 37.0 38.0 9 37.3625 38.0 38.0 38.0 37.0 38.0 10-14 37.3416 38.0 38.0 38.0 37.0 38.0 15-19 37.3288 38.0 38.0 38.0 37.0 38.0 20-24 37.359950000000005 38.0 38.0 38.0 37.0 38.0 25-29 37.305600000000005 38.0 38.0 38.0 37.0 38.0 30-34 37.22429999999999 38.0 38.0 38.0 37.0 38.0 35-39 37.0236 38.0 38.0 38.0 36.8 38.0 40-44 36.70035 38.0 38.0 38.0 36.4 38.0 45-49 37.185050000000004 38.0 38.0 38.0 37.0 38.0 50-54 37.19035 38.0 38.0 38.0 37.0 38.0 55-59 37.150549999999996 38.0 38.0 38.0 36.8 38.0 60-64 37.10795 38.0 38.0 38.0 36.0 38.0 65-69 37.063399999999994 38.0 38.0 38.0 36.2 38.0 70-74 37.0102 38.0 38.0 38.0 36.0 38.0 75-79 37.0223 38.0 38.0 38.0 36.0 38.0 80-84 36.932399999999994 38.0 38.0 38.0 36.0 38.0 85-89 36.8101 38.0 38.0 38.0 35.6 38.0 90-94 36.71585 38.0 38.0 38.0 35.0 38.0 95-99 36.57855 38.0 38.0 38.0 34.8 38.0 100-104 36.5019 38.0 38.0 38.0 34.6 38.0 105-109 36.363949999999996 38.0 38.0 38.0 34.0 38.0 110-114 36.29045 38.0 38.0 38.0 34.0 38.0 115-119 36.1958 38.0 38.0 38.0 34.0 38.0 120-124 36.0236 38.0 37.6 38.0 33.2 38.0 125-129 35.744150000000005 38.0 37.0 38.0 32.2 38.0 130-134 35.423449999999995 38.0 36.0 38.0 31.0 38.0 135-139 35.335699999999996 38.0 36.0 38.0 31.0 38.0 140-144 34.88045 38.0 35.6 38.0 28.0 38.0 145-149 34.59285 38.0 35.4 38.0 28.0 38.0 150-151 30.923875 35.5 30.0 38.0 14.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 2.0 4 2.0 5 0.0 6 2.0 7 0.0 8 1.0 9 0.0 10 0.0 11 2.0 12 1.0 13 1.0 14 2.0 15 2.0 16 4.0 17 2.0 18 6.0 19 4.0 20 6.0 21 2.0 22 2.0 23 9.0 24 5.0 25 13.0 26 13.0 27 16.0 28 17.0 29 30.0 30 39.0 31 44.0 32 60.0 33 83.0 34 126.0 35 239.0 36 577.0 37 2686.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.375 18.475 15.925 27.224999999999998 2 23.974999999999998 23.474999999999998 33.025 19.525000000000002 3 20.674999999999997 27.075 32.35 19.900000000000002 4 24.0 35.725 21.325 18.95 5 23.125 37.1 21.425 18.35 6 18.25 38.125 24.2 19.425 7 17.974999999999998 17.974999999999998 42.325 21.725 8 21.325 23.400000000000002 26.424999999999997 28.849999999999998 9 20.200000000000003 25.2 29.525000000000002 25.074999999999996 10-14 22.5 28.34 26.895000000000003 22.264999999999997 15-19 22.770000000000003 28.1 28.310000000000002 20.82 20-24 22.75 28.439999999999998 27.85 20.96 25-29 23.330000000000002 28.92 27.165 20.585 30-34 22.77777777777778 28.588588588588586 27.78778778778779 20.845845845845844 35-39 22.783090085556115 27.65475591343734 27.92652239557121 21.63563160543533 40-44 22.855693634288613 28.151153943697693 27.613492264773015 21.37966015724068 45-49 23.16 28.305000000000003 27.6 20.935000000000002 50-54 23.21 28.08 27.74 20.97 55-59 23.11 28.110000000000003 27.58 21.2 60-64 23.255 27.615000000000002 28.24 20.89 65-69 23.435 27.79 27.839999999999996 20.935000000000002 70-74 23.75 27.775 27.97 20.505000000000003 75-79 23.71 28.23 27.915 20.145 80-84 23.830000000000002 28.27 26.590000000000003 21.310000000000002 85-89 23.75 28.28 27.384999999999998 20.585 90-94 23.055 28.275 27.755000000000003 20.915 95-99 23.785 28.54 27.215 20.46 100-104 23.51 28.225 28.105000000000004 20.16 105-109 23.73 28.04 27.689999999999998 20.54 110-114 23.605 28.389999999999997 27.46 20.544999999999998 115-119 23.97 28.675 27.04 20.315 120-124 23.674999999999997 28.43 27.325 20.57 125-129 23.44 28.34 27.72 20.5 130-134 23.880000000000003 27.72 27.91 20.49 135-139 23.345 28.244999999999997 27.534999999999997 20.875 140-144 24.54 27.88 27.345000000000002 20.235 145-149 23.990000000000002 28.075 27.855 20.080000000000002 150-151 24.375 27.900000000000002 28.175 19.55 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 0.5 22 0.0 23 1.0 24 1.0 25 1.0 26 3.0 27 5.5 28 7.0 29 6.0 30 11.0 31 19.0 32 23.5 33 23.5 34 30.5 35 58.5 36 85.0 37 100.0 38 130.5 39 165.5 40 205.0 41 231.5 42 252.5 43 281.0 44 306.5 45 319.0 46 285.5 47 253.0 48 240.0 49 206.5 50 169.0 51 136.5 52 101.5 53 83.5 54 66.5 55 53.0 56 39.5 57 25.0 58 19.0 59 17.0 60 11.5 61 4.5 62 4.5 63 4.0 64 2.0 65 1.0 66 3.0 67 2.5 68 0.5 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.1 35-39 0.65 40-44 1.425 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64815280221161 99.125 2 0.2764513696908771 0.5499999999999999 3 0.025131942699170642 0.075 4 0.025131942699170642 0.1 5 0.0 0.0 6 0.025131942699170642 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTTAATTTGAGACAGAAAACATGAAATCCTCCTACACTTTCTTCATTCT 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.1875 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.2375 0.0 0.0 0.0 0.0 102-103 0.2875 0.0 0.0 0.0 0.0 104-105 0.35 0.0 0.0 0.0 0.0 106-107 0.3625 0.0 0.0 0.0 0.0 108-109 0.42500000000000004 0.0 0.0 0.0 0.0 110-111 0.55 0.0 0.0 0.0 0.0 112-113 0.5625 0.0 0.0 0.0 0.0 114-115 0.6625000000000001 0.0 0.0 0.0 0.0 116-117 0.775 0.0 0.0 0.0 0.0 118-119 0.8875 0.0 0.0 0.0 0.0 120-121 1.0 0.0 0.0 0.0 0.0 122-123 1.0875 0.0 0.0 0.0 0.0 124-125 1.2125 0.0 0.0 0.0 0.0 126-127 1.375 0.0 0.0 0.0 0.0 128-129 1.5125 0.0 0.0 0.0 0.0 130-131 1.6625 0.0 0.0 0.0 0.0 132-133 1.7625 0.0 0.0 0.0 0.0 134-135 1.9375 0.0 0.0 0.0 0.0 136-137 2.075 0.0 0.0 0.0 0.0 138-139 2.3499999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACCAAAT 10 0.0068661636 144.75 5 AACCAAA 10 0.0068661636 144.75 4 >>END_MODULE Read 779077 spots for SRR7171884.sra Written 779077 spots for SRR7171884.sra Read 779077 spots for SRR7171884.sra Written 779077 spots for SRR7171884.sra Read 779077 spots for SRR7171884.sra Written 779077 spots for SRR7171884.sra Read 779077 spots for SRR7171884.sra Written 779077 spots for SRR7171884.sra Read 779077 spots for SRR7171884.sra Written 779077 spots for SRR7171884.sra Read 779077 spots for SRR7171884.sra Written 779077 spots for SRR7171884.sra Read 779077 spots for SRR7171884.sra Written 779077 spots for SRR7171884.sra Read 779077 spots for SRR7171884.sra Written 779077 spots for SRR7171884.sra Read 779077 spots for SRR7171884.sra Written 779077 spots for SRR7171884.sra Read 779077 spots for SRR7171884.sra Written 779077 spots for SRR7171884.sra Read 779077 spots for SRR7171884.sra Written 779077 spots for SRR7171884.sra Read 779077 spots for SRR7171884.sra Written 779077 spots for SRR7171884.sra Read 779077 spots for SRR7171884.sra Written 779077 spots for SRR7171884.sra Read 779077 spots for SRR7171884.sra Written 779077 spots for SRR7171884.sra Read 779092 spots for SRR7171884.sra Written 779092 spots for SRR7171884.sra Read 779077 spots for SRR7171884.sra Written 779077 spots for SRR7171884.sra Read 779077 spots for SRR7171884.sra Written 779077 spots for SRR7171884.sra Read 779077 spots for SRR7171884.sra Written 779077 spots for SRR7171884.sra Read 779077 spots for SRR7171884.sra Written 779077 spots for SRR7171884.sra Read 779077 spots for SRR7171884.sra Written 779077 spots for SRR7171884.sra SRR ids: ['SRR7171884.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_i9uprq1m SRR7171884.sra spots: 15581555 blocks: [[1, 779077], [779078, 1558154], [1558155, 2337231], [2337232, 3116308], [3116309, 3895385], [3895386, 4674462], [4674463, 5453539], [5453540, 6232616], [6232617, 7011693], [7011694, 7790770], [7790771, 8569847], [8569848, 9348924], [9348925, 10128001], [10128002, 10907078], [10907079, 11686155], [11686156, 12465232], [12465233, 13244309], [13244310, 14023386], [14023387, 14802463], [14802464, 15581555]] SRR7171884 file size 5258377 SRR7171884 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171884 SRR7171884_1.fastq SRR7171884_2.fastq Input file: SRR7171884_1.fastq Paired file: SRR7171884_2.fastq trimmed: SRR7171884-trimmed-pair1.fastq, SRR7171884-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 22:46:26 2025 >> started Thu Feb 13 22:46:43 2025 >> done (17.220s) 15581555 read pairs processed; of these: 11672 ( 0.07%) short read pairs filtered out after trimming by size control 7984 ( 0.05%) empty read pairs filtered out after trimming by size control 15561899 (99.87%) read pairs available; of these: 6350644 (40.81%) trimmed read pairs available after processing 9211255 (59.19%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 2 0.00% 20 2 0.00% 21 3 0.00% 22 7 0.00% 23 2 0.00% 24 1 0.00% 25 4 0.00% 26 7 0.00% 27 4 0.00% 28 8 0.00% 29 6 0.00% 30 6 0.00% 31 4 0.00% 32 6 0.00% 33 5 0.00% 34 3 0.00% 35 3 0.00% 36 1 0.00% 37 6 0.00% 38 3 0.00% 39 1 0.00% 40 8 0.00% 41 3 0.00% 42 5 0.00% 43 9 0.00% 44 8 0.00% 45 5 0.00% 46 7 0.00% 47 13 0.00% 48 15 0.00% 49 15 0.00% 50 13 0.00% 51 12 0.00% 52 18 0.00% 53 20 0.00% 54 30 0.00% 55 25 0.00% 56 23 0.00% 57 38 0.00% 58 29 0.00% 59 28 0.00% 60 49 0.00% 61 49 0.00% 62 48 0.00% 63 56 0.00% 64 78 0.00% 65 82 0.00% 66 87 0.00% 67 121 0.00% 68 113 0.00% 69 140 0.00% 70 163 0.00% 71 171 0.00% 72 251 0.00% 73 246 0.00% 74 271 0.00% 75 295 0.00% 76 343 0.00% 77 386 0.00% 78 430 0.00% 79 478 0.00% 80 528 0.00% 81 680 0.00% 82 694 0.00% 83 861 0.01% 84 1469 0.01% 85 1907 0.01% 86 2070 0.01% 87 2229 0.01% 88 2371 0.02% 89 2432 0.02% 90 2440 0.02% 91 2749 0.02% 92 2904 0.02% 93 3041 0.02% 94 3207 0.02% 95 3415 0.02% 96 3514 0.02% 97 3762 0.02% 98 4061 0.03% 99 4297 0.03% 100 4561 0.03% 101 4705 0.03% 102 5320 0.03% 103 5688 0.04% 104 6083 0.04% 105 6358 0.04% 106 6864 0.04% 107 7194 0.05% 108 7613 0.05% 109 8004 0.05% 110 8535 0.05% 111 9059 0.06% 112 9589 0.06% 113 10259 0.07% 114 11119 0.07% 115 11590 0.07% 116 12098 0.08% 117 12842 0.08% 118 13388 0.09% 119 13969 0.09% 120 14678 0.09% 121 15415 0.10% 122 16347 0.11% 123 17191 0.11% 124 18352 0.12% 125 19283 0.12% 126 20212 0.13% 127 21396 0.14% 128 22284 0.14% 129 23689 0.15% 130 24909 0.16% 131 26539 0.17% 132 28696 0.18% 133 30823 0.20% 134 32745 0.21% 135 35408 0.23% 136 38212 0.25% 137 41150 0.26% 138 44835 0.29% 139 48798 0.31% 140 53974 0.35% 141 59981 0.39% 142 68499 0.44% 143 79292 0.51% 144 95595 0.61% 145 117314 0.75% 146 151680 0.97% 147 213502 1.37% 148 342747 2.20% 149 719757 4.63% 150 3679602 23.64% 151 9211255 59.19% 15561899 reads passed initial QC criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=30 prefix-density=0.39 prefix-fanout=2.0 sequence=CGACACCATCAT criterion=fanout-score sequence-density=0.11 sequence-density-rank=19 fanout-score=11.86 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=3.7 sequence=TTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGT criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=2.51 fanout-score-rank=25 prefix-density=0.41 prefix-fanout=2.4 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=79.47 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=3.8 sequence=TCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCC SRR7171884 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 22:47:33 Started mapping on | Feb 13 22:47:34 Finished on | Feb 13 22:49:53 Mapping speed, Million of reads per hour | 403.04 Number of input reads | 15561899 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 14309425 Uniquely mapped reads % | 91.95% Average mapped length | 297.16 Number of splices: Total | 14493520 Number of splices: Annotated (sjdb) | 14220929 Number of splices: GT/AG | 14252793 Number of splices: GC/AG | 184665 Number of splices: AT/AC | 14262 Number of splices: Non-canonical | 41800 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.56 Insertion rate per base | 0.02% Insertion average length | 2.61 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 432792 % of reads mapped to multiple loci | 2.78% Number of reads mapped to too many loci | 49208 % of reads mapped to too many loci | 0.32% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.87% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 831746 831746 831746 N_multimapping 432792 432792 432792 N_noFeature 354457 14175807 415861 N_ambiguous 171195 788 98556 UnstrandedReadsAssigned:13783773 PositiveStrandReadsAssigned:132830 NegativeStrandReadsAssigned:13795008 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7171884 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171884-trimmed-pair1.fastq SRR7171884-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,561,899 reads, 13,595,296 reads pseudoaligned [quant] estimated average fragment length: 271.596 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,099 rounds 52401 SRR7171884.ke.tsv 34699 SRR7171884.se.tsv 87100 total ==> SRR7171884.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1747.4 1354 53.539 Potri.005G024800.1.v4.1 1035 764.404 307 27.7498 Potri.004G059700.1.v4.1 961 690.437 29 2.90214 Potri.007G009000.2.v4.1 1416 1145.4 1 0.0603235 Potri.003G141000.2.v4.1 2943 2672.4 487 12.5913 Potri.016G087400.1.v4.1 270 66.1707 716.512 748.174 Potri.015G069301.1.v4.1 564 300.521 0 0 Potri.010G195200.1.v4.1 1773 1502.4 406 18.6717 Potri.012G127500.1.v4.1 977 706.415 7262 710.299 ==> SRR7171884.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 86 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 365 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 376 SRR7171884 completed mapping pipeline successfully