Starting /dee2/code/volunteer_pipeline.sh SRR7171885 current disk space = 3089274208256 free memory = 1579178400 SRR7171885 SRAfilesize 6fdf0c7e986ea64069fd4aa1761f30e0 SRR7171885.sra SRR7171885.sra file validated SRR7171885 is paired end SRR7171885 is conventional basespace SRR7171885 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171885_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.22725 32.0 28.0 33.0 18.0 34.0 2 32.399 33.0 33.0 34.0 30.0 34.0 3 32.72125 33.0 33.0 34.0 31.0 34.0 4 32.66775 33.0 33.0 33.0 32.0 34.0 5 33.083 33.0 33.0 34.0 33.0 34.0 6 37.212 38.0 37.0 38.0 36.0 38.0 7 37.4745 38.0 38.0 38.0 37.0 38.0 8 37.61375 38.0 38.0 38.0 37.0 38.0 9 37.6025 38.0 38.0 38.0 38.0 38.0 10-14 37.64945 38.0 38.0 38.0 38.0 38.0 15-19 37.63765 38.0 38.0 38.0 38.0 38.0 20-24 37.6071 38.0 38.0 38.0 38.0 38.0 25-29 37.57415 38.0 38.0 38.0 38.0 38.0 30-34 37.54055 38.0 38.0 38.0 38.0 38.0 35-39 37.5253 38.0 38.0 38.0 38.0 38.0 40-44 37.529650000000004 38.0 38.0 38.0 38.0 38.0 45-49 37.4987 38.0 38.0 38.0 37.8 38.0 50-54 37.469550000000005 38.0 38.0 38.0 37.0 38.0 55-59 37.3984 38.0 38.0 38.0 37.0 38.0 60-64 37.36749999999999 38.0 38.0 38.0 37.0 38.0 65-69 37.281349999999996 38.0 38.0 38.0 36.6 38.0 70-74 37.27695 38.0 38.0 38.0 36.4 38.0 75-79 37.20585 38.0 38.0 38.0 36.0 38.0 80-84 37.15025 38.0 38.0 38.0 36.0 38.0 85-89 37.0705 38.0 38.0 38.0 36.0 38.0 90-94 37.00574999999999 38.0 38.0 38.0 35.8 38.0 95-99 36.880250000000004 38.0 38.0 38.0 35.0 38.0 100-104 36.76585 38.0 38.0 38.0 34.8 38.0 105-109 36.602 38.0 38.0 38.0 34.0 38.0 110-114 36.499750000000006 38.0 38.0 38.0 34.0 38.0 115-119 36.436099999999996 38.0 38.0 38.0 34.0 38.0 120-124 36.269000000000005 38.0 37.6 38.0 33.6 38.0 125-129 35.961349999999996 38.0 37.0 38.0 32.8 38.0 130-134 35.88335000000001 38.0 36.6 38.0 32.4 38.0 135-139 35.42045 38.0 36.0 38.0 31.0 38.0 140-144 35.19735 38.0 36.0 38.0 29.8 38.0 145-149 34.70870000000001 38.0 35.2 38.0 28.0 38.0 150-151 31.784374999999997 36.5 31.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 3.0 18 0.0 19 1.0 20 1.0 21 1.0 22 8.0 23 8.0 24 5.0 25 3.0 26 9.0 27 13.0 28 14.0 29 28.0 30 29.0 31 31.0 32 58.0 33 70.0 34 118.0 35 255.0 36 640.0 37 2703.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.5 12.925 12.275 37.3 2 20.79059294470853 19.189392044033024 36.55241431073305 23.46760070052539 3 20.3 23.875 25.825 30.0 4 22.725 33.15 22.175 21.95 5 21.75 35.575 23.95 18.725 6 17.5 34.525 26.25 21.725 7 13.275 22.1 45.35 19.275000000000002 8 18.575 21.175 31.275 28.975 9 18.45 22.625 32.7 26.224999999999998 10-14 19.805 29.015 26.939999999999998 24.240000000000002 15-19 20.34 27.685 27.88 24.095 20-24 19.52 28.205000000000002 27.74 24.535 25-29 19.97 28.754999999999995 27.49 23.785 30-34 20.03 27.775 28.275 23.919999999999998 35-39 20.294999999999998 27.860000000000003 27.92 23.925 40-44 20.11 27.725 27.74 24.425 45-49 20.125 27.985 27.68 24.21 50-54 19.895 27.775 28.075 24.255 55-59 20.09 28.345 27.405 24.16 60-64 19.869999999999997 27.639999999999997 27.894999999999996 24.595 65-69 20.235 28.57 27.08 24.115000000000002 70-74 20.380000000000003 27.725 28.24 23.655 75-79 20.685000000000002 28.005000000000003 27.395000000000003 23.915 80-84 20.23 27.765 28.075 23.93 85-89 20.665 27.950000000000003 27.6 23.785 90-94 20.52 27.560000000000002 28.395 23.525 95-99 20.1 27.73 27.79 24.38 100-104 20.505000000000003 27.6 27.665 24.23 105-109 20.73 27.855 27.35 24.065 110-114 20.73 27.860000000000003 27.595 23.815 115-119 21.32 27.805000000000003 27.150000000000002 23.724999999999998 120-124 20.674999999999997 28.165000000000003 27.150000000000002 24.01 125-129 21.22 27.950000000000003 27.310000000000002 23.52 130-134 20.79 28.12 27.07 24.02 135-139 20.91 27.560000000000002 27.715 23.815 140-144 21.060000000000002 27.425 27.560000000000002 23.955000000000002 145-149 21.34 27.639999999999997 27.58 23.44 150-151 21.3875 28.037499999999998 26.8 23.775 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 1.0 25 1.0 26 2.5 27 6.0 28 7.0 29 8.5 30 16.5 31 22.5 32 31.5 33 44.0 34 48.0 35 54.0 36 66.5 37 91.0 38 119.5 39 150.5 40 183.5 41 213.0 42 246.5 43 273.5 44 281.0 45 293.5 46 302.0 47 258.0 48 221.0 49 205.0 50 173.5 51 156.0 52 123.5 53 94.5 54 85.0 55 59.5 56 40.0 57 32.5 58 23.5 59 14.0 60 12.5 61 10.0 62 6.5 63 6.0 64 4.0 65 3.0 66 1.5 67 0.5 68 2.0 69 2.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8998998998999 99.8 2 0.10010010010010009 0.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.07500000000000001 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.21250000000000002 0.0 0.0 0.0 0.0 100-101 0.2375 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.3375 0.0 0.0 0.0 0.0 106-107 0.3875 0.0 0.0 0.0 0.0 108-109 0.44999999999999996 0.0 0.0 0.0 0.0 110-111 0.5125 0.0 0.0 0.0 0.0 112-113 0.6 0.0 0.0 0.0 0.0 114-115 0.6625 0.0 0.0 0.0 0.0 116-117 0.8500000000000001 0.0 0.0 0.0 0.0 118-119 1.0 0.0 0.0 0.0 0.0 120-121 1.1749999999999998 0.0 0.0 0.0 0.0 122-123 1.2999999999999998 0.0 0.0 0.0 0.0 124-125 1.4625 0.0 0.0 0.0 0.0 126-127 1.675 0.0 0.0 0.0 0.0 128-129 1.8125 0.0 0.0 0.0 0.0 130-131 1.9375 0.0 0.0 0.0 0.0 132-133 2.1500000000000004 0.0 0.0 0.0 0.0 134-135 2.4125 0.0 0.0 0.0 0.0 136-137 2.6625 0.0 0.0 0.0 0.0 138-139 2.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGGGGG 40 0.0076550315 18.125 135-139 >>END_MODULE SRR7171885 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171885_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0935 33.0 33.0 34.0 32.0 34.0 2 33.214 34.0 33.0 34.0 33.0 34.0 3 33.1905 34.0 33.0 34.0 33.0 34.0 4 33.2415 34.0 33.0 34.0 33.0 34.0 5 33.2785 34.0 33.0 34.0 33.0 34.0 6 37.48375 38.0 38.0 38.0 38.0 38.0 7 37.43475 38.0 38.0 38.0 38.0 38.0 8 37.45425 38.0 38.0 38.0 38.0 38.0 9 37.531 38.0 38.0 38.0 38.0 38.0 10-14 37.4394 38.0 38.0 38.0 37.8 38.0 15-19 37.35665 38.0 38.0 38.0 37.4 38.0 20-24 37.449650000000005 38.0 38.0 38.0 38.0 38.0 25-29 37.40365 38.0 38.0 38.0 37.8 38.0 30-34 37.3615 38.0 38.0 38.0 37.2 38.0 35-39 37.13785 38.0 38.0 38.0 37.0 38.0 40-44 36.767700000000005 38.0 38.0 38.0 37.0 38.0 45-49 37.26625 38.0 38.0 38.0 37.0 38.0 50-54 37.25155 38.0 38.0 38.0 37.0 38.0 55-59 37.286 38.0 38.0 38.0 37.0 38.0 60-64 37.14215 38.0 38.0 38.0 36.8 38.0 65-69 37.0836 38.0 38.0 38.0 36.4 38.0 70-74 37.044650000000004 38.0 38.0 38.0 36.4 38.0 75-79 36.9966 38.0 38.0 38.0 36.0 38.0 80-84 36.996 38.0 38.0 38.0 36.0 38.0 85-89 36.8947 38.0 38.0 38.0 36.0 38.0 90-94 36.741150000000005 38.0 38.0 38.0 35.2 38.0 95-99 36.6499 38.0 38.0 38.0 34.8 38.0 100-104 36.5692 38.0 38.0 38.0 34.8 38.0 105-109 36.40945 38.0 38.0 38.0 34.0 38.0 110-114 36.298249999999996 38.0 38.0 38.0 34.0 38.0 115-119 36.195100000000004 38.0 38.0 38.0 33.8 38.0 120-124 36.0989 38.0 38.0 38.0 33.8 38.0 125-129 35.80329999999999 38.0 37.0 38.0 32.8 38.0 130-134 35.4093 38.0 36.4 38.0 30.4 38.0 135-139 35.3994 38.0 36.0 38.0 31.0 38.0 140-144 34.87795 38.0 35.4 38.0 28.2 38.0 145-149 34.57745 38.0 35.2 38.0 27.6 38.0 150-151 31.018124999999998 35.5 30.5 38.0 14.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 3.0 4 1.0 5 0.0 6 3.0 7 2.0 8 0.0 9 0.0 10 0.0 11 2.0 12 1.0 13 0.0 14 1.0 15 1.0 16 4.0 17 1.0 18 4.0 19 0.0 20 3.0 21 3.0 22 8.0 23 5.0 24 7.0 25 7.0 26 17.0 27 26.0 28 14.0 29 32.0 30 37.0 31 36.0 32 69.0 33 92.0 34 108.0 35 210.0 36 535.0 37 2767.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.475 17.525 16.125 28.875 2 24.075 25.3 33.75 16.875 3 20.3 27.474999999999998 30.375000000000004 21.85 4 23.325000000000003 34.1 23.225 19.35 5 23.65 36.199999999999996 21.975 18.175 6 18.775 37.775 23.925 19.525000000000002 7 19.2 17.825 41.625 21.349999999999998 8 21.65 22.3 27.275 28.775000000000002 9 21.55 24.349999999999998 28.275 25.825 10-14 23.055 28.345 26.365 22.235 15-19 23.005 27.944999999999997 27.555000000000003 21.495 20-24 22.56 28.08 27.16 22.2 25-29 22.720000000000002 28.115000000000002 27.355 21.81 30-34 23.119247699079633 28.13625450180072 27.3609443777511 21.383553421368546 35-39 22.617132515584153 28.19726523225417 27.85039211743414 21.33521013472753 40-44 23.196999645228324 28.062439815518726 27.32755562313111 21.41300491612184 45-49 23.294999999999998 27.96 27.384999999999998 21.36 50-54 23.465 28.38 27.169999999999998 20.985 55-59 23.86 28.050000000000004 27.065 21.025 60-64 23.13 28.345 27.51 21.015 65-69 23.655 28.07 27.525 20.75 70-74 23.665 27.49 27.169999999999998 21.675 75-79 23.945 27.785 26.895000000000003 21.375 80-84 24.04 27.235 27.93 20.794999999999998 85-89 23.62 27.800000000000004 27.54 21.04 90-94 23.635 28.02 26.939999999999998 21.404999999999998 95-99 23.84 27.1 27.560000000000002 21.5 100-104 23.735 27.944999999999997 27.034999999999997 21.285 105-109 23.925 27.395000000000003 27.339999999999996 21.34 110-114 24.12 27.755000000000003 27.36 20.765 115-119 24.044999999999998 27.96 26.99 21.005 120-124 24.224999999999998 27.139999999999997 27.82 20.815 125-129 24.135 27.905 27.425 20.535 130-134 24.665 27.584999999999997 26.815 20.935000000000002 135-139 24.45 27.685 27.1 20.765 140-144 24.595 28.035 26.88 20.49 145-149 24.335 27.505000000000003 27.060000000000002 21.099999999999998 150-151 23.549999999999997 28.237499999999997 27.187499999999996 21.025 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.0 25 1.5 26 4.5 27 4.5 28 4.5 29 5.0 30 6.5 31 9.5 32 15.5 33 23.5 34 28.0 35 45.5 36 66.0 37 84.0 38 123.5 39 150.5 40 184.0 41 234.0 42 278.5 43 311.5 44 296.5 45 262.0 46 264.0 47 261.0 48 237.0 49 212.0 50 184.5 51 162.0 52 135.5 53 98.5 54 70.0 55 62.0 56 51.0 57 35.5 58 23.5 59 19.0 60 14.5 61 10.0 62 6.0 63 4.0 64 2.5 65 1.0 66 1.0 67 1.0 68 1.0 69 1.5 70 1.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.04 35-39 0.54 40-44 1.345 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79949874686717 99.55000000000001 2 0.15037593984962408 0.3 3 0.05012531328320802 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.07500000000000001 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.21250000000000002 0.0 0.0 0.0 0.0 100-101 0.2375 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.3375 0.0 0.0 0.0 0.0 106-107 0.3875 0.0 0.0 0.0 0.0 108-109 0.44999999999999996 0.0 0.0 0.0 0.0 110-111 0.5125 0.0 0.0 0.0 0.0 112-113 0.6 0.0 0.0 0.0 0.0 114-115 0.6625 0.0 0.0 0.0 0.0 116-117 0.8500000000000001 0.0 0.0 0.0 0.0 118-119 1.0 0.0 0.0 0.0 0.0 120-121 1.1875 0.0 0.0 0.0 0.0 122-123 1.3250000000000002 0.0 0.0 0.0 0.0 124-125 1.5125 0.0 0.0 0.0 0.0 126-127 1.75 0.0 0.0 0.0 0.0 128-129 1.8875 0.0 0.0 0.0 0.0 130-131 2.0125 0.0 0.0 0.0 0.0 132-133 2.2375 0.0 0.0 0.0 0.0 134-135 2.5125 0.0 0.0 0.0 0.0 136-137 2.7625 0.0 0.0 0.0 0.0 138-139 2.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAATGCA 10 0.0068661636 144.75 9 TTAACAA 10 0.0068661636 144.75 5 TTGCCCT 10 0.0068661636 144.75 2 >>END_MODULE Read 784056 spots for SRR7171885.sra Written 784056 spots for SRR7171885.sra Read 784056 spots for SRR7171885.sra Written 784056 spots for SRR7171885.sra Read 784056 spots for SRR7171885.sra Written 784056 spots for SRR7171885.sra Read 784056 spots for SRR7171885.sra Written 784056 spots for SRR7171885.sra Read 784056 spots for SRR7171885.sra Written 784056 spots for SRR7171885.sra Read 784056 spots for SRR7171885.sra Written 784056 spots for SRR7171885.sra Read 784056 spots for SRR7171885.sra Written 784056 spots for SRR7171885.sra Read 784056 spots for SRR7171885.sra Written 784056 spots for SRR7171885.sra Read 784056 spots for SRR7171885.sra Written 784056 spots for SRR7171885.sra Read 784056 spots for SRR7171885.sra Written 784056 spots for SRR7171885.sra Read 784056 spots for SRR7171885.sra Written 784056 spots for SRR7171885.sra Read 784056 spots for SRR7171885.sra Written 784056 spots for SRR7171885.sra Read 784075 spots for SRR7171885.sra Written 784075 spots for SRR7171885.sra Read 784056 spots for SRR7171885.sra Written 784056 spots for SRR7171885.sra Read 784056 spots for SRR7171885.sra Written 784056 spots for SRR7171885.sra Read 784056 spots for SRR7171885.sra Written 784056 spots for SRR7171885.sra Read 784056 spots for SRR7171885.sra Written 784056 spots for SRR7171885.sra Read 784056 spots for SRR7171885.sra Written 784056 spots for SRR7171885.sra Read 784056 spots for SRR7171885.sra Written 784056 spots for SRR7171885.sra Read 784056 spots for SRR7171885.sra Written 784056 spots for SRR7171885.sra SRR ids: ['SRR7171885.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_58vak20t SRR7171885.sra spots: 15681139 blocks: [[1, 784056], [784057, 1568112], [1568113, 2352168], [2352169, 3136224], [3136225, 3920280], [3920281, 4704336], [4704337, 5488392], [5488393, 6272448], [6272449, 7056504], [7056505, 7840560], [7840561, 8624616], [8624617, 9408672], [9408673, 10192728], [10192729, 10976784], [10976785, 11760840], [11760841, 12544896], [12544897, 13328952], [13328953, 14113008], [14113009, 14897064], [14897065, 15681139]] SRR7171885 file size 5292123 SRR7171885 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171885 SRR7171885_1.fastq SRR7171885_2.fastq Input file: SRR7171885_1.fastq Paired file: SRR7171885_2.fastq trimmed: SRR7171885-trimmed-pair1.fastq, SRR7171885-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 23:22:02 2025 >> started Thu Feb 13 23:22:19 2025 >> done (17.310s) 15681139 read pairs processed; of these: 10613 ( 0.07%) short read pairs filtered out after trimming by size control 8773 ( 0.06%) empty read pairs filtered out after trimming by size control 15661753 (99.88%) read pairs available; of these: 6367759 (40.66%) trimmed read pairs available after processing 9293994 (59.34%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 7 0.00% 20 1 0.00% 21 3 0.00% 22 3 0.00% 23 0 0.00% 24 2 0.00% 25 6 0.00% 26 0 0.00% 27 4 0.00% 28 3 0.00% 29 5 0.00% 30 6 0.00% 31 7 0.00% 32 5 0.00% 33 3 0.00% 34 3 0.00% 35 6 0.00% 36 8 0.00% 37 2 0.00% 38 5 0.00% 39 5 0.00% 40 2 0.00% 41 7 0.00% 42 6 0.00% 43 11 0.00% 44 12 0.00% 45 11 0.00% 46 8 0.00% 47 14 0.00% 48 16 0.00% 49 19 0.00% 50 19 0.00% 51 20 0.00% 52 29 0.00% 53 23 0.00% 54 27 0.00% 55 29 0.00% 56 51 0.00% 57 46 0.00% 58 44 0.00% 59 70 0.00% 60 71 0.00% 61 66 0.00% 62 82 0.00% 63 84 0.00% 64 114 0.00% 65 124 0.00% 66 123 0.00% 67 124 0.00% 68 195 0.00% 69 203 0.00% 70 202 0.00% 71 249 0.00% 72 275 0.00% 73 314 0.00% 74 386 0.00% 75 412 0.00% 76 607 0.00% 77 636 0.00% 78 625 0.00% 79 686 0.00% 80 777 0.00% 81 879 0.01% 82 997 0.01% 83 1103 0.01% 84 1776 0.01% 85 2166 0.01% 86 2272 0.01% 87 2463 0.02% 88 2701 0.02% 89 2805 0.02% 90 3118 0.02% 91 3314 0.02% 92 3533 0.02% 93 3899 0.02% 94 3998 0.03% 95 4359 0.03% 96 4728 0.03% 97 4925 0.03% 98 5300 0.03% 99 5567 0.04% 100 6182 0.04% 101 6513 0.04% 102 7100 0.05% 103 7445 0.05% 104 7797 0.05% 105 8460 0.05% 106 8995 0.06% 107 9503 0.06% 108 9987 0.06% 109 10502 0.07% 110 11078 0.07% 111 11758 0.08% 112 12639 0.08% 113 13221 0.08% 114 14168 0.09% 115 14831 0.09% 116 15610 0.10% 117 16515 0.11% 118 16904 0.11% 119 17606 0.11% 120 18614 0.12% 121 19592 0.13% 122 20625 0.13% 123 21578 0.14% 124 22548 0.14% 125 23672 0.15% 126 25031 0.16% 127 26316 0.17% 128 27263 0.17% 129 28804 0.18% 130 30329 0.19% 131 31927 0.20% 132 34169 0.22% 133 35952 0.23% 134 38408 0.25% 135 40831 0.26% 136 43386 0.28% 137 46846 0.30% 138 49881 0.32% 139 54154 0.35% 140 58768 0.38% 141 65230 0.42% 142 72446 0.46% 143 82737 0.53% 144 96838 0.62% 145 117255 0.75% 146 149285 0.95% 147 204926 1.31% 148 325474 2.08% 149 675015 4.31% 150 3586234 22.90% 151 9293994 59.34% 15661753 reads passed initial QC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=2.30 fanout-score-rank=28 prefix-density=0.34 prefix-fanout=2.1 sequence=CAGGTGCAGTTTGATCCACA criterion=fanout-score sequence-density=0.10 sequence-density-rank=19 fanout-score=42.56 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=14.6 sequence=ACCACCACCATG criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=4.89 fanout-score-rank=14 prefix-density=0.59 prefix-fanout=3.4 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=42.42 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=6.5 sequence=AGGATCTGTTTAATTTGAGACAGAAAACATGAAATCCTCCTACACTTTCTTCATTCTTTTCTCACTCTTTTCGTTTGCTAACGTGATCGGTGCTAGAAAAGACACTGGAGAGTATTGGAGAGCTGTCATGAAAGATCAGCCCATGCCAGAAGCAATACATGGCCTTATTCGCGAAACCACATTGTCATCAGTCTCCAATGAGAAAGCCGATTGCCACACAACCGAGTCCAATGAAAAGAATAATTTTGTGAAGGATTTTGG SRR7171885 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 23:23:04 Started mapping on | Feb 13 23:23:04 Finished on | Feb 13 23:24:52 Mapping speed, Million of reads per hour | 522.06 Number of input reads | 15661753 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 14748310 Uniquely mapped reads % | 94.17% Average mapped length | 296.76 Number of splices: Total | 15398268 Number of splices: Annotated (sjdb) | 15155445 Number of splices: GT/AG | 15160180 Number of splices: GC/AG | 191343 Number of splices: AT/AC | 11032 Number of splices: Non-canonical | 35713 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.68 Insertion rate per base | 0.02% Insertion average length | 2.68 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 416021 % of reads mapped to multiple loci | 2.66% Number of reads mapped to too many loci | 43478 % of reads mapped to too many loci | 0.28% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.84% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 507576 507576 507576 N_multimapping 416021 416021 416021 N_noFeature 256598 14622067 313049 N_ambiguous 141392 719 71217 UnstrandedReadsAssigned:14350320 PositiveStrandReadsAssigned:125524 NegativeStrandReadsAssigned:14364044 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7171885 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171885-trimmed-pair1.fastq SRR7171885-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,661,753 reads, 14,167,920 reads pseudoaligned [quant] estimated average fragment length: 263.382 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,103 rounds 52401 SRR7171885.ke.tsv 34699 SRR7171885.se.tsv 87100 total ==> SRR7171885.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1755.62 801 29.3693 Potri.005G024800.1.v4.1 1035 772.618 232 19.3292 Potri.004G059700.1.v4.1 961 698.641 23 2.11917 Potri.007G009000.2.v4.1 1416 1153.62 0 0 Potri.003G141000.2.v4.1 2943 2680.62 553 13.2795 Potri.016G087400.1.v4.1 270 69.3576 1176.24 1091.67 Potri.015G069301.1.v4.1 564 307.517 0 0 Potri.010G195200.1.v4.1 1773 1510.62 165 7.03106 Potri.012G127500.1.v4.1 977 714.641 4333 390.294 ==> SRR7171885.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 64 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 351 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 65 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 94 SRR7171885 completed mapping pipeline successfully