Starting /dee2/code/volunteer_pipeline.sh SRR7171886 current disk space = 3089304924160 free memory = 1580049712 SRR7171886 SRAfilesize e30cbdb7f0935f6ba80578653b67792a SRR7171886.sra SRR7171886.sra file validated SRR7171886 is paired end SRR7171886 is conventional basespace SRR7171886 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171886_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.74025 32.0 18.0 33.0 18.0 34.0 2 26.7515 29.0 18.0 31.0 18.0 33.0 3 31.1935 33.0 30.0 33.0 28.0 33.0 4 32.15875 33.0 32.0 33.0 32.0 33.0 5 32.7115 33.0 33.0 33.0 32.0 34.0 6 36.471 38.0 37.0 38.0 34.0 38.0 7 37.28425 38.0 38.0 38.0 36.0 38.0 8 37.34925 38.0 38.0 38.0 36.0 38.0 9 37.44025 38.0 38.0 38.0 37.0 38.0 10-14 37.6035 38.0 38.0 38.0 37.6 38.0 15-19 37.58455 38.0 38.0 38.0 38.0 38.0 20-24 37.59205 38.0 38.0 38.0 37.8 38.0 25-29 37.56125 38.0 38.0 38.0 38.0 38.0 30-34 37.520050000000005 38.0 38.0 38.0 37.6 38.0 35-39 37.5365 38.0 38.0 38.0 37.4 38.0 40-44 37.49464999999999 38.0 38.0 38.0 37.4 38.0 45-49 37.4537 38.0 38.0 38.0 37.0 38.0 50-54 37.4387 38.0 38.0 38.0 37.0 38.0 55-59 37.30045 38.0 38.0 38.0 37.0 38.0 60-64 37.2661 38.0 38.0 38.0 36.6 38.0 65-69 37.21675 38.0 38.0 38.0 36.2 38.0 70-74 37.136399999999995 38.0 38.0 38.0 36.0 38.0 75-79 37.0788 38.0 38.0 38.0 36.0 38.0 80-84 37.027300000000004 38.0 38.0 38.0 36.0 38.0 85-89 36.9519 38.0 38.0 38.0 35.6 38.0 90-94 36.876400000000004 38.0 38.0 38.0 35.2 38.0 95-99 36.732299999999995 38.0 38.0 38.0 34.8 38.0 100-104 36.61 38.0 38.0 38.0 34.4 38.0 105-109 36.4104 38.0 38.0 38.0 34.0 38.0 110-114 36.2108 38.0 37.2 38.0 33.6 38.0 115-119 36.18605 38.0 37.4 38.0 33.8 38.0 120-124 36.00115 38.0 37.0 38.0 33.0 38.0 125-129 35.83540000000001 38.0 36.8 38.0 32.6 38.0 130-134 35.50269999999999 38.0 36.0 38.0 31.0 38.0 135-139 35.1572 38.0 36.0 38.0 29.2 38.0 140-144 34.90985 38.0 35.2 38.0 28.0 38.0 145-149 34.36615 38.0 35.0 38.0 27.0 38.0 150-151 31.296374999999998 36.5 31.5 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 0.0 14 2.0 15 0.0 16 3.0 17 2.0 18 0.0 19 2.0 20 3.0 21 4.0 22 7.0 23 2.0 24 4.0 25 12.0 26 17.0 27 14.0 28 14.0 29 21.0 30 35.0 31 42.0 32 73.0 33 80.0 34 147.0 35 267.0 36 777.0 37 2471.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.025 14.524999999999999 11.75 37.7 2 18.85 21.349999999999998 38.2 21.6 3 19.175 28.000000000000004 25.025 27.800000000000004 4 21.375 35.55 20.4 22.675 5 21.099999999999998 38.3 22.625 17.974999999999998 6 17.325 37.574999999999996 25.224999999999998 19.875 7 12.525 23.275000000000002 45.050000000000004 19.15 8 17.875 21.25 31.324999999999996 29.549999999999997 9 17.625 22.55 33.225 26.6 10-14 19.89 29.38 26.935 23.794999999999998 15-19 19.615 28.465 28.4 23.52 20-24 19.689999999999998 28.595 28.194999999999997 23.52 25-29 19.475 29.115000000000002 28.189999999999998 23.22 30-34 19.470000000000002 28.33 28.515 23.685000000000002 35-39 19.675 28.904999999999998 27.825 23.595 40-44 19.645000000000003 29.475 27.615000000000002 23.265 45-49 20.02 28.470000000000002 28.54 22.97 50-54 20.03 28.634999999999998 27.339999999999996 23.995 55-59 19.61 29.13 28.13 23.13 60-64 20.035 28.355000000000004 27.785 23.825 65-69 19.794999999999998 28.375 28.23 23.599999999999998 70-74 19.84 28.389999999999997 28.439999999999998 23.330000000000002 75-79 20.0 28.384999999999998 27.779999999999998 23.835 80-84 19.6 28.189999999999998 28.525 23.685000000000002 85-89 20.335 28.315 27.88 23.47 90-94 19.88 28.985 27.515 23.62 95-99 19.79 28.485 28.26 23.465 100-104 20.495 28.26 27.96 23.285 105-109 20.31 28.46 27.79 23.44 110-114 20.555 27.944999999999997 27.92 23.580000000000002 115-119 20.119999999999997 28.720000000000002 28.09 23.07 120-124 20.07 28.810000000000002 27.35 23.77 125-129 20.064999999999998 27.839999999999996 27.800000000000004 24.295 130-134 20.165 28.175 27.93 23.73 135-139 19.950000000000003 28.93 27.52 23.599999999999998 140-144 20.26 28.505000000000003 28.035 23.200000000000003 145-149 20.715 28.299999999999997 27.775 23.21 150-151 19.950000000000003 27.8375 28.125 24.087500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 1.0 21 2.5 22 2.5 23 2.0 24 3.5 25 4.5 26 4.0 27 6.5 28 7.0 29 14.0 30 23.0 31 29.5 32 39.0 33 41.5 34 55.0 35 76.5 36 103.0 37 120.0 38 148.5 39 183.0 40 204.0 41 248.5 42 257.5 43 265.5 44 281.0 45 275.5 46 273.0 47 243.5 48 209.5 49 181.5 50 159.5 51 130.5 52 103.0 53 83.5 54 60.5 55 44.5 56 29.5 57 18.5 58 18.0 59 14.5 60 8.0 61 7.0 62 3.5 63 3.0 64 2.5 65 1.0 66 1.5 67 1.5 68 2.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57318604067285 99.15 2 0.42681395932714034 0.8500000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.21250000000000002 0.0 0.0 0.0 0.0 102-103 0.275 0.0 0.0 0.0 0.0 104-105 0.32499999999999996 0.0 0.0 0.0 0.0 106-107 0.35 0.0 0.0 0.0 0.0 108-109 0.44999999999999996 0.0 0.0 0.0 0.0 110-111 0.525 0.0 0.0 0.0 0.0 112-113 0.675 0.0 0.0 0.0 0.0 114-115 0.8 0.0 0.0 0.0 0.0 116-117 0.9375 0.0 0.0 0.0 0.0 118-119 1.025 0.0 0.0 0.0 0.0 120-121 1.1125 0.0 0.0 0.0 0.0 122-123 1.2125 0.0 0.0 0.0 0.0 124-125 1.375 0.0 0.0 0.0 0.0 126-127 1.5499999999999998 0.0 0.0 0.0 0.0 128-129 1.725 0.0 0.0 0.0 0.0 130-131 1.95 0.0 0.0 0.0 0.0 132-133 2.0875 0.0 0.0 0.0 0.0 134-135 2.3625 0.0 0.0 0.0 0.0 136-137 2.65 0.0 0.0 0.0 0.0 138-139 2.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7171886 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171886_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.09575 33.0 33.0 34.0 32.0 34.0 2 33.21725 34.0 33.0 34.0 33.0 34.0 3 33.18875 34.0 33.0 34.0 33.0 34.0 4 33.20875 34.0 33.0 34.0 33.0 34.0 5 33.2045 34.0 33.0 34.0 33.0 34.0 6 37.47975 38.0 38.0 38.0 38.0 38.0 7 37.4505 38.0 38.0 38.0 38.0 38.0 8 37.41125 38.0 38.0 38.0 37.0 38.0 9 37.41275 38.0 38.0 38.0 38.0 38.0 10-14 37.393600000000006 38.0 38.0 38.0 37.4 38.0 15-19 37.33434999999999 38.0 38.0 38.0 37.0 38.0 20-24 37.366049999999994 38.0 38.0 38.0 37.0 38.0 25-29 37.3146 38.0 38.0 38.0 37.0 38.0 30-34 37.2611 38.0 38.0 38.0 37.0 38.0 35-39 37.0775 38.0 38.0 38.0 36.8 38.0 40-44 36.79135000000001 38.0 38.0 38.0 36.4 38.0 45-49 37.18465 38.0 38.0 38.0 36.6 38.0 50-54 37.18955 38.0 38.0 38.0 37.0 38.0 55-59 37.157050000000005 38.0 38.0 38.0 36.4 38.0 60-64 37.103049999999996 38.0 38.0 38.0 36.4 38.0 65-69 36.9978 38.0 38.0 38.0 36.0 38.0 70-74 36.9478 38.0 38.0 38.0 36.0 38.0 75-79 36.92700000000001 38.0 38.0 38.0 36.0 38.0 80-84 36.88355000000001 38.0 38.0 38.0 36.0 38.0 85-89 36.8072 38.0 38.0 38.0 35.6 38.0 90-94 36.657849999999996 38.0 38.0 38.0 34.8 38.0 95-99 36.552049999999994 38.0 38.0 38.0 34.2 38.0 100-104 36.467 38.0 38.0 38.0 34.0 38.0 105-109 36.317099999999996 38.0 38.0 38.0 34.0 38.0 110-114 36.14965 38.0 37.8 38.0 33.6 38.0 115-119 36.06155 38.0 37.6 38.0 33.2 38.0 120-124 35.8375 38.0 37.0 38.0 32.6 38.0 125-129 35.612199999999994 38.0 36.4 38.0 31.0 38.0 130-134 35.3433 38.0 36.0 38.0 30.6 38.0 135-139 35.06735 38.0 36.0 38.0 29.2 38.0 140-144 34.5322 38.0 35.0 38.0 26.2 38.0 145-149 34.10675 38.0 35.0 38.0 24.4 38.0 150-151 30.433125 35.5 28.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 0.0 4 0.0 5 1.0 6 0.0 7 1.0 8 1.0 9 0.0 10 1.0 11 0.0 12 0.0 13 0.0 14 1.0 15 4.0 16 2.0 17 3.0 18 0.0 19 5.0 20 2.0 21 6.0 22 11.0 23 8.0 24 8.0 25 16.0 26 22.0 27 20.0 28 15.0 29 32.0 30 34.0 31 51.0 32 76.0 33 90.0 34 121.0 35 248.0 36 612.0 37 2605.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.324999999999996 16.325 15.65 29.7 2 23.0 23.0 37.775 16.225 3 21.125 27.025 31.15 20.7 4 23.925 34.875 21.575 19.625 5 22.7 36.225 22.400000000000002 18.675 6 17.349999999999998 37.85 24.3 20.5 7 17.05 16.875 43.425000000000004 22.650000000000002 8 20.575 22.375 29.325000000000003 27.725 9 24.075 23.925 28.749999999999996 23.25 10-14 22.43 29.054999999999996 26.765 21.75 15-19 22.685 28.12 27.944999999999997 21.25 20-24 22.545 29.285 27.46 20.71 25-29 22.67 28.835 28.13 20.365 30-34 22.780946662663865 27.68938256779746 28.319823876713702 21.209846892824977 35-39 22.407556270096464 28.44654340836013 28.431471061093248 20.71442926045016 40-44 23.232885023763778 28.026089594498938 28.32945697239357 20.411568409343715 45-49 22.555 28.294999999999998 27.905 21.245 50-54 22.884999999999998 28.044999999999998 28.01 21.060000000000002 55-59 22.875 28.005000000000003 28.060000000000002 21.060000000000002 60-64 22.994999999999997 28.215 28.505000000000003 20.285 65-69 23.61 28.194999999999997 27.93 20.265 70-74 22.91 28.64 27.725 20.724999999999998 75-79 23.235 28.26 28.025 20.48 80-84 23.419999999999998 28.110000000000003 28.27 20.200000000000003 85-89 23.135 28.48 27.87 20.515 90-94 23.71 27.915 27.805000000000003 20.57 95-99 23.61 28.499999999999996 27.525 20.365 100-104 23.9 28.205000000000002 27.51 20.385 105-109 24.145 27.97 27.834999999999997 20.05 110-114 23.985 27.495000000000005 28.18 20.34 115-119 23.49 28.449999999999996 27.74 20.32 120-124 23.73 28.225 27.71 20.335 125-129 23.435 28.9 27.52 20.145 130-134 23.810000000000002 28.32 27.87 20.0 135-139 23.485 28.27 27.894999999999996 20.349999999999998 140-144 23.685000000000002 27.584999999999997 28.22 20.51 145-149 23.735 28.155 28.095 20.015 150-151 23.8125 27.9125 27.650000000000002 20.625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.5 18 1.0 19 1.5 20 1.5 21 1.0 22 1.0 23 1.0 24 1.0 25 2.5 26 4.5 27 7.0 28 6.0 29 6.5 30 11.0 31 13.5 32 25.5 33 40.0 34 52.0 35 72.0 36 86.0 37 105.0 38 151.0 39 172.5 40 196.5 41 246.5 42 286.0 43 302.0 44 290.0 45 284.5 46 266.0 47 236.5 48 208.5 49 196.5 50 176.0 51 138.5 52 107.5 53 77.0 54 54.5 55 43.0 56 36.0 57 26.5 58 18.0 59 11.0 60 7.0 61 5.0 62 6.5 63 4.5 64 3.0 65 1.5 66 1.0 67 1.5 68 0.5 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.06999999999999999 35-39 0.48 40-44 1.11 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59798994974875 99.1 2 0.32663316582914576 0.65 3 0.05025125628140704 0.15 4 0.02512562814070352 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.21250000000000002 0.0 0.0 0.0 0.0 102-103 0.275 0.0 0.0 0.0 0.0 104-105 0.32499999999999996 0.0 0.0 0.0 0.0 106-107 0.35 0.0 0.0 0.0 0.0 108-109 0.44999999999999996 0.0 0.0 0.0 0.0 110-111 0.525 0.0 0.0 0.0 0.0 112-113 0.675 0.0 0.0 0.0 0.0 114-115 0.8 0.0 0.0 0.0 0.0 116-117 0.9375 0.0 0.0 0.0 0.0 118-119 1.025 0.0 0.0 0.0 0.0 120-121 1.1125 0.0 0.0 0.0 0.0 122-123 1.2125 0.0 0.0 0.0 0.0 124-125 1.375 0.0 0.0 0.0 0.0 126-127 1.5499999999999998 0.0 0.0 0.0 0.0 128-129 1.725 0.0 0.0 0.0 0.0 130-131 1.95 0.0 0.0 0.0 0.0 132-133 2.0875 0.0 0.0 0.0 0.0 134-135 2.3625 0.0 0.0 0.0 0.0 136-137 2.675 0.0 0.0 0.0 0.0 138-139 2.9000000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGTTTTG 10 0.0068484643 144.875 8 >>END_MODULE Read 766817 spots for SRR7171886.sra Written 766817 spots for SRR7171886.sra Read 766817 spots for SRR7171886.sra Written 766817 spots for SRR7171886.sra Read 766817 spots for SRR7171886.sra Written 766817 spots for SRR7171886.sra Read 766817 spots for SRR7171886.sra Written 766817 spots for SRR7171886.sra Read 766817 spots for SRR7171886.sra Written 766817 spots for SRR7171886.sra Read 766817 spots for SRR7171886.sra Written 766817 spots for SRR7171886.sra Read 766817 spots for SRR7171886.sra Written 766817 spots for SRR7171886.sra Read 766817 spots for SRR7171886.sra Written 766817 spots for SRR7171886.sra Read 766817 spots for SRR7171886.sra Written 766817 spots for SRR7171886.sra Read 766817 spots for SRR7171886.sra Written 766817 spots for SRR7171886.sra Read 766817 spots for SRR7171886.sra Written 766817 spots for SRR7171886.sra Read 766817 spots for SRR7171886.sra Written 766817 spots for SRR7171886.sra Read 766817 spots for SRR7171886.sra Written 766817 spots for SRR7171886.sra Read 766817 spots for SRR7171886.sra Written 766817 spots for SRR7171886.sra Read 766817 spots for SRR7171886.sra Written 766817 spots for SRR7171886.sra Read 766817 spots for SRR7171886.sra Written 766817 spots for SRR7171886.sra Read 766817 spots for SRR7171886.sra Written 766817 spots for SRR7171886.sra Read 766817 spots for SRR7171886.sra Written 766817 spots for SRR7171886.sra Read 766817 spots for SRR7171886.sra Written 766817 spots for SRR7171886.sra Read 766829 spots for SRR7171886.sra Written 766829 spots for SRR7171886.sra SRR ids: ['SRR7171886.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_83j8615y SRR7171886.sra spots: 15336352 blocks: [[1, 766817], [766818, 1533634], [1533635, 2300451], [2300452, 3067268], [3067269, 3834085], [3834086, 4600902], [4600903, 5367719], [5367720, 6134536], [6134537, 6901353], [6901354, 7668170], [7668171, 8434987], [8434988, 9201804], [9201805, 9968621], [9968622, 10735438], [10735439, 11502255], [11502256, 12269072], [12269073, 13035889], [13035890, 13802706], [13802707, 14569523], [14569524, 15336352]] SRR7171886 file size 5175286 SRR7171886 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171886 SRR7171886_1.fastq SRR7171886_2.fastq Input file: SRR7171886_1.fastq Paired file: SRR7171886_2.fastq trimmed: SRR7171886-trimmed-pair1.fastq, SRR7171886-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 23:16:27 2025 >> started Thu Feb 13 23:16:44 2025 >> done (17.850s) 15336352 read pairs processed; of these: 6417 ( 0.04%) short read pairs filtered out after trimming by size control 4182 ( 0.03%) empty read pairs filtered out after trimming by size control 15325753 (99.93%) read pairs available; of these: 6285318 (41.01%) trimmed read pairs available after processing 9040435 (58.99%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 5 0.00% 21 7 0.00% 22 0 0.00% 23 3 0.00% 24 4 0.00% 25 2 0.00% 26 2 0.00% 27 0 0.00% 28 2 0.00% 29 1 0.00% 30 1 0.00% 31 0 0.00% 32 5 0.00% 33 2 0.00% 34 1 0.00% 35 5 0.00% 36 8 0.00% 37 3 0.00% 38 5 0.00% 39 1 0.00% 40 3 0.00% 41 11 0.00% 42 10 0.00% 43 8 0.00% 44 6 0.00% 45 6 0.00% 46 10 0.00% 47 7 0.00% 48 7 0.00% 49 17 0.00% 50 20 0.00% 51 17 0.00% 52 17 0.00% 53 21 0.00% 54 15 0.00% 55 24 0.00% 56 27 0.00% 57 33 0.00% 58 36 0.00% 59 44 0.00% 60 54 0.00% 61 63 0.00% 62 60 0.00% 63 69 0.00% 64 76 0.00% 65 97 0.00% 66 93 0.00% 67 124 0.00% 68 119 0.00% 69 141 0.00% 70 194 0.00% 71 193 0.00% 72 222 0.00% 73 243 0.00% 74 305 0.00% 75 365 0.00% 76 441 0.00% 77 473 0.00% 78 487 0.00% 79 526 0.00% 80 577 0.00% 81 733 0.00% 82 791 0.01% 83 955 0.01% 84 1317 0.01% 85 1658 0.01% 86 1784 0.01% 87 2070 0.01% 88 2278 0.01% 89 2356 0.02% 90 2440 0.02% 91 2647 0.02% 92 2925 0.02% 93 3092 0.02% 94 3285 0.02% 95 3615 0.02% 96 3779 0.02% 97 4075 0.03% 98 4336 0.03% 99 4597 0.03% 100 4928 0.03% 101 5367 0.04% 102 5703 0.04% 103 6123 0.04% 104 6480 0.04% 105 6962 0.05% 106 7465 0.05% 107 7950 0.05% 108 8064 0.05% 109 8647 0.06% 110 9250 0.06% 111 9890 0.06% 112 10520 0.07% 113 10846 0.07% 114 11595 0.08% 115 12338 0.08% 116 12961 0.08% 117 13367 0.09% 118 14099 0.09% 119 14784 0.10% 120 15460 0.10% 121 15998 0.10% 122 17046 0.11% 123 17742 0.12% 124 19348 0.13% 125 20138 0.13% 126 21088 0.14% 127 21877 0.14% 128 23153 0.15% 129 24811 0.16% 130 25802 0.17% 131 27521 0.18% 132 28989 0.19% 133 31524 0.21% 134 33506 0.22% 135 36397 0.24% 136 39088 0.26% 137 42142 0.27% 138 45388 0.30% 139 50251 0.33% 140 54581 0.36% 141 61056 0.40% 142 68969 0.45% 143 79969 0.52% 144 94506 0.62% 145 117136 0.76% 146 151056 0.99% 147 210843 1.38% 148 337344 2.20% 149 704629 4.60% 150 3606567 23.53% 151 9040435 58.99% 15325753 reads passed initial QC criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=5.43 fanout-score-rank=4 prefix-density=0.65 prefix-fanout=3.3 sequence=TTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCATCCAGAGCCGCAGCCACAGTTTCCTCCACAGCAAGACATTTTCTGTTGGAAAAGAAGGAAAGTGTGATGAAATTAAGGGATTTCTTTTACTTAGAAGAATGCAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=21.43 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=4.7 sequence=AATAACATTACAAACGAGGAAGCAGCCGCGGCTTTAGCTTCTACTTTTATTTAATAGTTTTATAGATTACACAAAGGAAATACAACACAAGATCTCCCCACAAATCACACGCATTGATGCAGTACTGAACTCGTTGCACGAAAGCGCTTAGATATATATTATACAAGTACTAGCATGATCACAAACATGTGATATATGCTTATTGGTCGAGATCGATGACCCCTTCTATTACTCCGTGCTAAGGGCTTCGTCGATGTCTTTAGTCATATGAACCATAAGATCAACATAAATCTCTGGAACCGGGACTTCAGGATGGAGTTTTTCGTATTCAATGGTCAGTTTTGCCAAGCAGCCCGAGCCTTTTGGTGTAAGCTGCCAGACGGGCCTATAGACCTTGTAAATTTTCATGACATCTCCTTCCAAACCATTAAGAGTTATGATCTTGTTCTCATCATCGAAGGAAACCTCCTCTTTAAAGACCCCGGCTTTCCCTCCGATTGTGTACTGCCAA criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=2.51 fanout-score-rank=27 prefix-density=0.45 prefix-fanout=2.3 sequence=CACAGCAGTCCATGCA criterion=fanout-score sequence-density=0.02 sequence-density-rank=35 fanout-score=137.10 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=10.6 sequence=AAGAAGATCAACTGTCTCTCTGCCTGGTTTGTATTCCAAGAAATGGAGAAAGTCCAAAAGCTCTTTTGTGTGGCTCTATTGCTTGCAGTACTAGCCATAGCAAGCAATATTGCGAATGCCCAGAGTACCATATGCAAAATGCCTGTTGCTGGCCTAATGTCATGCAAGCCTTCTGTAACTCCTCCTAACCCTACCGCACCCTCGGCAGACTGCTGCTCGGCACTTTCGCATGCTGACATAAACTGCCTTTGCTCCTACAAAAATTCCAACCTGCTCCCTTCCCTTGGAATCGACCCAAAACTTGCCATGCAGCTCCCTGGCAAGTGCAAGCTTCCTCACCCTGCTAATTGCTAGACTACCGATCGTAATCGATCCAAGGGTTTTCCTC SRR7171886 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 23:17:33 Started mapping on | Feb 13 23:17:34 Finished on | Feb 13 23:19:15 Mapping speed, Million of reads per hour | 546.26 Number of input reads | 15325753 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 14482343 Uniquely mapped reads % | 94.50% Average mapped length | 297.07 Number of splices: Total | 14282690 Number of splices: Annotated (sjdb) | 13986234 Number of splices: GT/AG | 14038983 Number of splices: GC/AG | 191519 Number of splices: AT/AC | 12289 Number of splices: Non-canonical | 39899 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.04% Deletion average length | 2.68 Insertion rate per base | 0.02% Insertion average length | 2.67 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 332983 % of reads mapped to multiple loci | 2.17% Number of reads mapped to too many loci | 30810 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.09% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 518106 518106 518106 N_multimapping 332983 332983 332983 N_noFeature 439545 14327340 499719 N_ambiguous 177004 711 81804 UnstrandedReadsAssigned:13865794 PositiveStrandReadsAssigned:154292 NegativeStrandReadsAssigned:13900820 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7171886 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171886-trimmed-pair1.fastq SRR7171886-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,325,753 reads, 13,689,610 reads pseudoaligned [quant] estimated average fragment length: 269.159 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,116 rounds 52401 SRR7171886.ke.tsv 34699 SRR7171886.se.tsv 87100 total ==> SRR7171886.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1749.84 727 28.7226 Potri.005G024800.1.v4.1 1035 766.841 215 19.383 Potri.004G059700.1.v4.1 961 692.925 29 2.89334 Potri.007G009000.2.v4.1 1416 1147.84 0 0 Potri.003G141000.2.v4.1 2943 2674.84 643.4 16.6292 Potri.016G087400.1.v4.1 270 67.0193 881.457 909.262 Potri.015G069301.1.v4.1 564 302.976 0 0 Potri.010G195200.1.v4.1 1773 1504.84 291 13.3687 Potri.012G127500.1.v4.1 977 708.87 15317 1493.81 ==> SRR7171886.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 368 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 353 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 213 SRR7171886 completed mapping pipeline successfully