Starting /dee2/code/volunteer_pipeline.sh SRR7171887 current disk space = 3112501321728 free memory = 1569744076 SRR7171887 SRAfilesize cabcffa44904658d85d32f7b665700ab SRR7171887.sra SRR7171887.sra file validated SRR7171887 is paired end SRR7171887 is conventional basespace SRR7171887 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171887_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.786 31.0 28.0 33.0 18.0 34.0 2 32.367 33.0 31.0 34.0 30.0 34.0 3 32.67625 33.0 33.0 34.0 31.0 34.0 4 33.06125 33.0 33.0 34.0 33.0 34.0 5 33.1215 33.0 33.0 34.0 33.0 34.0 6 36.861 38.0 37.0 38.0 35.0 38.0 7 37.255 38.0 38.0 38.0 36.0 38.0 8 37.5785 38.0 38.0 38.0 37.0 38.0 9 37.6415 38.0 38.0 38.0 38.0 38.0 10-14 37.61935 38.0 38.0 38.0 38.0 38.0 15-19 37.661550000000005 38.0 38.0 38.0 38.0 38.0 20-24 37.656099999999995 38.0 38.0 38.0 38.0 38.0 25-29 37.60335 38.0 38.0 38.0 38.0 38.0 30-34 37.564 38.0 38.0 38.0 38.0 38.0 35-39 37.54504999999999 38.0 38.0 38.0 38.0 38.0 40-44 37.504 38.0 38.0 38.0 37.8 38.0 45-49 37.4432 38.0 38.0 38.0 37.2 38.0 50-54 37.3809 38.0 38.0 38.0 37.0 38.0 55-59 37.3266 38.0 38.0 38.0 37.0 38.0 60-64 37.30585 38.0 38.0 38.0 37.0 38.0 65-69 37.24715 38.0 38.0 38.0 36.8 38.0 70-74 37.19715 38.0 38.0 38.0 36.0 38.0 75-79 37.11905 38.0 38.0 38.0 36.0 38.0 80-84 37.0391 38.0 38.0 38.0 36.0 38.0 85-89 37.00224999999999 38.0 38.0 38.0 36.0 38.0 90-94 36.924049999999994 38.0 38.0 38.0 35.8 38.0 95-99 36.8146 38.0 38.0 38.0 35.4 38.0 100-104 36.668949999999995 38.0 38.0 38.0 34.6 38.0 105-109 36.551550000000006 38.0 38.0 38.0 34.4 38.0 110-114 36.368700000000004 38.0 37.8 38.0 34.0 38.0 115-119 36.28770000000001 38.0 38.0 38.0 34.0 38.0 120-124 36.06245 38.0 37.4 38.0 33.2 38.0 125-129 35.7606 38.0 36.8 38.0 32.6 38.0 130-134 35.6944 38.0 36.4 38.0 31.6 38.0 135-139 35.2373 38.0 36.0 38.0 30.4 38.0 140-144 34.9972 38.0 35.6 38.0 29.4 38.0 145-149 34.4534 38.0 35.0 38.0 27.8 38.0 150-151 31.367874999999998 36.5 31.5 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 2.0 16 1.0 17 2.0 18 5.0 19 1.0 20 3.0 21 3.0 22 6.0 23 11.0 24 9.0 25 5.0 26 14.0 27 17.0 28 20.0 29 23.0 30 35.0 31 35.0 32 46.0 33 63.0 34 111.0 35 244.0 36 660.0 37 2683.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.4 14.124999999999998 13.375 37.1 2 20.580145036259065 20.455113778444613 38.78469617404351 20.180045011252815 3 18.575 27.375 26.025 28.025 4 22.975 33.275 22.1 21.65 5 22.0 36.35 23.45 18.2 6 17.025000000000002 36.075 27.3 19.6 7 13.900000000000002 22.525000000000002 44.224999999999994 19.35 8 17.65 23.175 31.25 27.925 9 19.475 22.0 30.525000000000002 28.000000000000004 10-14 19.915 29.160000000000004 26.965 23.96 15-19 20.380000000000003 27.82 28.494999999999997 23.305 20-24 19.875 28.32 27.939999999999998 23.865 25-29 20.055 28.01 28.375 23.56 30-34 20.075000000000003 28.96 26.974999999999998 23.990000000000002 35-39 20.175 28.405 27.694999999999997 23.724999999999998 40-44 20.169999999999998 28.365000000000002 28.09 23.375 45-49 19.695 28.694999999999997 27.665 23.945 50-54 20.27 28.77 27.08 23.880000000000003 55-59 20.119999999999997 28.199999999999996 27.839999999999996 23.84 60-64 20.07 28.51 27.224999999999998 24.195 65-69 20.71 28.275 27.634999999999998 23.380000000000003 70-74 20.465 28.389999999999997 27.51 23.635 75-79 20.125 27.82 27.555000000000003 24.5 80-84 20.49 27.994999999999997 27.944999999999997 23.57 85-89 20.34 28.299999999999997 27.284999999999997 24.075 90-94 20.380000000000003 27.794999999999998 28.055000000000003 23.77 95-99 20.330000000000002 27.74 27.875 24.055 100-104 20.805 27.634999999999998 27.52 24.04 105-109 21.060000000000002 28.01 27.16 23.77 110-114 21.115000000000002 27.715 27.705000000000002 23.465 115-119 21.255 27.735 26.724999999999998 24.285 120-124 20.419999999999998 27.725 27.52 24.335 125-129 20.535 27.755000000000003 27.634999999999998 24.075 130-134 20.630000000000003 27.485 27.515 24.37 135-139 21.36 27.41 27.74 23.49 140-144 20.724999999999998 27.71 27.205000000000002 24.36 145-149 20.915 27.465 27.689999999999998 23.93 150-151 19.9875 28.6625 26.9625 24.3875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.0 22 0.0 23 2.0 24 2.0 25 1.5 26 4.0 27 4.5 28 7.0 29 12.0 30 15.5 31 22.5 32 37.0 33 42.0 34 51.5 35 73.0 36 85.0 37 107.5 38 140.5 39 163.5 40 180.0 41 215.0 42 256.0 43 276.0 44 278.0 45 274.5 46 264.5 47 248.5 48 240.5 49 210.0 50 174.5 51 137.0 52 92.0 53 76.5 54 67.0 55 50.5 56 42.0 57 34.0 58 24.5 59 19.5 60 16.0 61 13.5 62 9.0 63 7.5 64 7.0 65 3.5 66 2.0 67 2.5 68 2.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.025 0.0 66-67 0.0 0.0 0.0 0.025 0.0 68-69 0.0 0.0 0.0 0.025 0.0 70-71 0.0 0.0 0.0 0.025 0.0 72-73 0.0 0.0 0.0 0.025 0.0 74-75 0.0 0.0 0.0 0.025 0.0 76-77 0.0 0.0 0.0 0.025 0.0 78-79 0.0 0.0 0.0 0.025 0.0 80-81 0.025 0.0 0.0 0.025 0.0 82-83 0.025 0.0 0.0 0.025 0.0 84-85 0.037500000000000006 0.0 0.0 0.025 0.0 86-87 0.05 0.0 0.0 0.025 0.0 88-89 0.05 0.0 0.0 0.025 0.0 90-91 0.05 0.0 0.0 0.025 0.0 92-93 0.075 0.0 0.0 0.025 0.0 94-95 0.1 0.0 0.0 0.025 0.0 96-97 0.125 0.0 0.0 0.025 0.0 98-99 0.16249999999999998 0.0 0.0 0.025 0.0 100-101 0.2375 0.0 0.0 0.025 0.0 102-103 0.3375 0.0 0.0 0.025 0.0 104-105 0.45 0.0 0.0 0.025 0.0 106-107 0.48750000000000004 0.0 0.0 0.025 0.0 108-109 0.5375000000000001 0.0 0.0 0.025 0.0 110-111 0.5625 0.0 0.0 0.025 0.0 112-113 0.5874999999999999 0.0 0.0 0.025 0.0 114-115 0.7250000000000001 0.0 0.0 0.025 0.0 116-117 0.825 0.0 0.0 0.025 0.0 118-119 0.9125 0.0 0.0 0.025 0.0 120-121 0.9875 0.0 0.0 0.025 0.0 122-123 1.0875 0.0 0.0 0.025 0.0 124-125 1.25 0.0 0.0 0.025 0.0 126-127 1.3375 0.0 0.0 0.025 0.0 128-129 1.4874999999999998 0.0 0.0 0.025 0.0 130-131 1.625 0.0 0.0 0.025 0.0 132-133 1.8125 0.0 0.0 0.025 0.0 134-135 1.9625 0.0 0.0 0.025 0.0 136-137 2.0625 0.0 0.0 0.025 0.0 138-139 2.2375 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7171887 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171887_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.1175 33.0 33.0 34.0 32.0 34.0 2 33.24775 34.0 33.0 34.0 33.0 34.0 3 33.19375 34.0 33.0 34.0 33.0 34.0 4 33.25625 34.0 33.0 34.0 33.0 34.0 5 33.2515 34.0 33.0 34.0 33.0 34.0 6 37.46775 38.0 38.0 38.0 38.0 38.0 7 37.499 38.0 38.0 38.0 38.0 38.0 8 37.43125 38.0 38.0 38.0 38.0 38.0 9 37.49825 38.0 38.0 38.0 38.0 38.0 10-14 37.396699999999996 38.0 38.0 38.0 38.0 38.0 15-19 37.3729 38.0 38.0 38.0 37.0 38.0 20-24 37.41915 38.0 38.0 38.0 38.0 38.0 25-29 37.42144999999999 38.0 38.0 38.0 37.8 38.0 30-34 37.3203 38.0 38.0 38.0 37.0 38.0 35-39 37.081100000000006 38.0 38.0 38.0 37.0 38.0 40-44 36.645050000000005 38.0 38.0 38.0 36.8 38.0 45-49 37.281800000000004 38.0 38.0 38.0 37.0 38.0 50-54 37.2822 38.0 38.0 38.0 37.0 38.0 55-59 37.234 38.0 38.0 38.0 37.0 38.0 60-64 37.19135 38.0 38.0 38.0 37.0 38.0 65-69 37.11024999999999 38.0 38.0 38.0 36.6 38.0 70-74 37.07795 38.0 38.0 38.0 36.4 38.0 75-79 37.00015 38.0 38.0 38.0 36.0 38.0 80-84 36.981700000000004 38.0 38.0 38.0 36.0 38.0 85-89 36.84405 38.0 38.0 38.0 36.0 38.0 90-94 36.749399999999994 38.0 38.0 38.0 35.2 38.0 95-99 36.61525 38.0 38.0 38.0 34.8 38.0 100-104 36.5576 38.0 38.0 38.0 34.8 38.0 105-109 36.3996 38.0 38.0 38.0 34.0 38.0 110-114 36.30555 38.0 38.0 38.0 34.0 38.0 115-119 36.26785 38.0 38.0 38.0 34.0 38.0 120-124 36.09815 38.0 37.8 38.0 33.8 38.0 125-129 35.7396 38.0 37.0 38.0 32.8 38.0 130-134 35.392399999999995 38.0 36.0 38.0 30.6 38.0 135-139 35.300599999999996 38.0 36.0 38.0 30.6 38.0 140-144 34.761900000000004 38.0 35.6 38.0 27.8 38.0 145-149 34.535399999999996 38.0 35.6 38.0 28.0 38.0 150-151 31.103875000000002 35.5 31.0 38.0 14.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 0.0 4 1.0 5 0.0 6 2.0 7 0.0 8 2.0 9 1.0 10 0.0 11 0.0 12 2.0 13 0.0 14 4.0 15 4.0 16 3.0 17 1.0 18 0.0 19 2.0 20 4.0 21 2.0 22 2.0 23 8.0 24 11.0 25 12.0 26 23.0 27 19.0 28 20.0 29 27.0 30 38.0 31 44.0 32 51.0 33 70.0 34 116.0 35 220.0 36 581.0 37 2726.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.3 16.650000000000002 16.950000000000003 29.099999999999998 2 25.624999999999996 23.775 33.800000000000004 16.8 3 20.925 28.549999999999997 28.975 21.55 4 24.0 36.475 21.0 18.525 5 24.9 36.35 20.424999999999997 18.325 6 18.224999999999998 37.225 25.074999999999996 19.475 7 17.775 16.7 43.55 21.975 8 20.9 23.125 26.950000000000003 29.025000000000002 9 22.8 24.775 27.325 25.1 10-14 22.88 28.799999999999997 26.255 22.065 15-19 23.54 27.87 27.215 21.375 20-24 23.16 28.13 27.165 21.545 25-29 23.369999999999997 28.549999999999997 27.075 21.005 30-34 22.91562406165549 27.724952457211486 28.005204684215794 21.354218796917227 35-39 23.32376202710191 27.86257619263513 27.54521182811949 21.26844995214347 40-44 23.51325227654271 27.679706974614643 27.669532482067456 21.137508266775196 45-49 23.01 28.23 27.944999999999997 20.815 50-54 23.025000000000002 28.470000000000002 27.700000000000003 20.805 55-59 23.015 28.084999999999997 27.775 21.125 60-64 23.54 28.265 27.49 20.705000000000002 65-69 22.975 28.405 27.16 21.46 70-74 23.674999999999997 27.894999999999996 27.235 21.195 75-79 23.49 27.63 27.3 21.58 80-84 24.165 27.534999999999997 27.255000000000003 21.044999999999998 85-89 23.96 27.62 27.55 20.87 90-94 23.494999999999997 26.834999999999997 28.015 21.654999999999998 95-99 23.65 28.255000000000003 26.83 21.265 100-104 24.154999999999998 27.47 27.21 21.165 105-109 24.015 27.384999999999998 27.560000000000002 21.04 110-114 23.59 27.68 27.705000000000002 21.025 115-119 23.915 28.28 26.93 20.875 120-124 24.025 28.29 27.125 20.560000000000002 125-129 24.14 27.955000000000002 27.295 20.61 130-134 24.15 27.845 27.139999999999997 20.865000000000002 135-139 23.91 27.565 27.825 20.7 140-144 24.555 28.435 26.82 20.19 145-149 24.33 28.499999999999996 26.58 20.59 150-151 24.0 27.975 26.987499999999997 21.0375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.5 24 2.0 25 2.0 26 0.5 27 1.0 28 4.0 29 6.0 30 8.5 31 14.0 32 20.5 33 29.0 34 41.5 35 52.0 36 68.5 37 89.5 38 122.0 39 172.5 40 200.5 41 234.0 42 254.0 43 253.0 44 276.5 45 293.0 46 302.5 47 284.5 48 233.0 49 190.5 50 159.0 51 141.5 52 123.0 53 93.0 54 71.0 55 55.0 56 43.0 57 32.5 58 29.0 59 25.0 60 20.0 61 18.0 62 11.0 63 6.5 64 4.5 65 3.5 66 2.0 67 0.0 68 0.0 69 1.5 70 2.5 71 1.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.09 35-39 0.745 40-44 1.7149999999999999 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69894631209232 99.35000000000001 2 0.2508780732563974 0.5 3 0.050175614651279475 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.2625 0.0 0.0 0.0 0.0 102-103 0.36250000000000004 0.0 0.0 0.0 0.0 104-105 0.475 0.0 0.0 0.0 0.0 106-107 0.5125 0.0 0.0 0.0 0.0 108-109 0.5625 0.0 0.0 0.0 0.0 110-111 0.5874999999999999 0.0 0.0 0.0 0.0 112-113 0.6125 0.0 0.0 0.0 0.0 114-115 0.7375 0.0 0.0 0.0 0.0 116-117 0.85 0.0 0.0 0.0 0.0 118-119 0.95 0.0 0.0 0.0 0.0 120-121 1.0375 0.0 0.0 0.0 0.0 122-123 1.1375000000000002 0.0 0.0 0.0 0.0 124-125 1.2999999999999998 0.0 0.0 0.0 0.0 126-127 1.4 0.0 0.0 0.0 0.0 128-129 1.5625 0.0 0.0 0.0 0.0 130-131 1.7000000000000002 0.0 0.0 0.0 0.0 132-133 1.8875 0.0 0.0 0.0 0.0 134-135 2.025 0.0 0.0 0.0 0.0 136-137 2.1125 0.0 0.0 0.0 0.0 138-139 2.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTAGGCA 10 0.0068519996 144.85 8 AGGCTGG 10 0.0068519996 144.85 9 GAAAGGA 25 8.7491947E-4 86.909996 2 >>END_MODULE Read 926316 spots for SRR7171887.sra Written 926316 spots for SRR7171887.sra Read 926316 spots for SRR7171887.sra Written 926316 spots for SRR7171887.sra Read 926316 spots for SRR7171887.sra Written 926316 spots for SRR7171887.sra Read 926316 spots for SRR7171887.sra Written 926316 spots for SRR7171887.sra Read 926316 spots for SRR7171887.sra Written 926316 spots for SRR7171887.sra Read 926316 spots for SRR7171887.sra Written 926316 spots for SRR7171887.sra Read 926316 spots for SRR7171887.sra Written 926316 spots for SRR7171887.sra Read 926316 spots for SRR7171887.sra Written 926316 spots for SRR7171887.sra Read 926316 spots for SRR7171887.sra Written 926316 spots for SRR7171887.sra Read 926316 spots for SRR7171887.sra Written 926316 spots for SRR7171887.sra Read 926316 spots for SRR7171887.sra Written 926316 spots for SRR7171887.sra Read 926316 spots for SRR7171887.sra Written 926316 spots for SRR7171887.sra Read 926316 spots for SRR7171887.sra Written 926316 spots for SRR7171887.sra Read 926316 spots for SRR7171887.sra Written 926316 spots for SRR7171887.sra Read 926323 spots for SRR7171887.sra Written 926323 spots for SRR7171887.sra Read 926316 spots for SRR7171887.sra Written 926316 spots for SRR7171887.sra Read 926316 spots for SRR7171887.sra Written 926316 spots for SRR7171887.sra Read 926316 spots for SRR7171887.sra Written 926316 spots for SRR7171887.sra Read 926316 spots for SRR7171887.sra Written 926316 spots for SRR7171887.sra Read 926316 spots for SRR7171887.sra Written 926316 spots for SRR7171887.sra SRR ids: ['SRR7171887.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rnhd0g36 SRR7171887.sra spots: 18526327 blocks: [[1, 926316], [926317, 1852632], [1852633, 2778948], [2778949, 3705264], [3705265, 4631580], [4631581, 5557896], [5557897, 6484212], [6484213, 7410528], [7410529, 8336844], [8336845, 9263160], [9263161, 10189476], [10189477, 11115792], [11115793, 12042108], [12042109, 12968424], [12968425, 13894740], [13894741, 14821056], [14821057, 15747372], [15747373, 16673688], [16673689, 17600004], [17600005, 18526327]] SRR7171887 file size 6256263 SRR7171887 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171887 SRR7171887_1.fastq SRR7171887_2.fastq Input file: SRR7171887_1.fastq Paired file: SRR7171887_2.fastq trimmed: SRR7171887-trimmed-pair1.fastq, SRR7171887-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 14:24:34 2025 >> started Fri Feb 14 14:24:53 2025 >> done (19.227s) 18526327 read pairs processed; of these: 11025 ( 0.06%) short read pairs filtered out after trimming by size control 6730 ( 0.04%) empty read pairs filtered out after trimming by size control 18508572 (99.90%) read pairs available; of these: 7541926 (40.75%) trimmed read pairs available after processing 10966646 (59.25%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 2 0.00% 20 1 0.00% 21 0 0.00% 22 4 0.00% 23 7 0.00% 24 4 0.00% 25 2 0.00% 26 2 0.00% 27 6 0.00% 28 8 0.00% 29 4 0.00% 30 5 0.00% 31 3 0.00% 32 2 0.00% 33 3 0.00% 34 4 0.00% 35 5 0.00% 36 7 0.00% 37 8 0.00% 38 3 0.00% 39 1 0.00% 40 6 0.00% 41 5 0.00% 42 9 0.00% 43 9 0.00% 44 6 0.00% 45 12 0.00% 46 14 0.00% 47 14 0.00% 48 21 0.00% 49 30 0.00% 50 15 0.00% 51 24 0.00% 52 30 0.00% 53 28 0.00% 54 42 0.00% 55 31 0.00% 56 35 0.00% 57 48 0.00% 58 56 0.00% 59 50 0.00% 60 40 0.00% 61 69 0.00% 62 50 0.00% 63 88 0.00% 64 103 0.00% 65 125 0.00% 66 137 0.00% 67 138 0.00% 68 144 0.00% 69 175 0.00% 70 206 0.00% 71 251 0.00% 72 252 0.00% 73 311 0.00% 74 359 0.00% 75 452 0.00% 76 558 0.00% 77 505 0.00% 78 561 0.00% 79 632 0.00% 80 689 0.00% 81 819 0.00% 82 997 0.01% 83 1113 0.01% 84 1662 0.01% 85 2125 0.01% 86 2321 0.01% 87 2561 0.01% 88 2777 0.02% 89 2862 0.02% 90 3166 0.02% 91 3374 0.02% 92 3532 0.02% 93 3763 0.02% 94 4158 0.02% 95 4482 0.02% 96 4712 0.03% 97 5079 0.03% 98 5510 0.03% 99 5877 0.03% 100 6406 0.03% 101 6697 0.04% 102 7203 0.04% 103 7675 0.04% 104 8149 0.04% 105 9037 0.05% 106 9495 0.05% 107 10072 0.05% 108 10715 0.06% 109 11190 0.06% 110 11795 0.06% 111 12704 0.07% 112 13201 0.07% 113 14337 0.08% 114 15125 0.08% 115 16278 0.09% 116 16591 0.09% 117 17855 0.10% 118 18634 0.10% 119 19490 0.11% 120 20350 0.11% 121 21641 0.12% 122 22518 0.12% 123 24056 0.13% 124 25087 0.14% 125 26549 0.14% 126 28283 0.15% 127 29397 0.16% 128 30843 0.17% 129 32494 0.18% 130 34373 0.19% 131 36097 0.20% 132 38778 0.21% 133 41614 0.22% 134 44157 0.24% 135 47369 0.26% 136 50946 0.28% 137 54173 0.29% 138 58607 0.32% 139 64005 0.35% 140 69199 0.37% 141 76671 0.41% 142 85908 0.46% 143 98223 0.53% 144 116260 0.63% 145 141606 0.77% 146 181265 0.98% 147 249250 1.35% 148 392734 2.12% 149 815652 4.41% 150 4273869 23.09% 151 10966646 59.25% 18508572 reads passed initial QC criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=2.71 fanout-score-rank=25 prefix-density=0.69 prefix-fanout=2.0 sequence=CACTTGCAGCCATTCTCAGCACCA criterion=fanout-score sequence-density=0.04 sequence-density-rank=33 fanout-score=25.71 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=5.4 sequence=TTGTCAATGGTATCAGAGCTCTCCACCTCCAAGGTGATGGTCTT criterion=sequence-density sequence-density=0.73 sequence-density-rank=1 fanout-score=2.27 fanout-score-rank=23 prefix-density=0.75 prefix-fanout=2.2 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.13 sequence-density-rank=21 fanout-score=20.94 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=8.8 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7171887 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 14:26:15 Started mapping on | Feb 14 14:26:15 Finished on | Feb 14 14:30:09 Mapping speed, Million of reads per hour | 284.75 Number of input reads | 18508572 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 16552146 Uniquely mapped reads % | 89.43% Average mapped length | 297.01 Number of splices: Total | 16691696 Number of splices: Annotated (sjdb) | 16396432 Number of splices: GT/AG | 16421262 Number of splices: GC/AG | 212681 Number of splices: AT/AC | 12808 Number of splices: Non-canonical | 44945 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.56 Insertion rate per base | 0.02% Insertion average length | 2.56 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 505585 % of reads mapped to multiple loci | 2.73% Number of reads mapped to too many loci | 39901 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.55% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1462401 1462401 1462401 N_multimapping 505585 505585 505585 N_noFeature 390084 16400256 449602 N_ambiguous 184329 1139 91397 UnstrandedReadsAssigned:15977733 PositiveStrandReadsAssigned:150751 NegativeStrandReadsAssigned:16011147 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7171887 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171887-trimmed-pair1.fastq SRR7171887-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,508,572 reads, 15,825,135 reads pseudoaligned [quant] estimated average fragment length: 269.338 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,079 rounds 52401 SRR7171887.ke.tsv 34699 SRR7171887.se.tsv 87100 total ==> SRR7171887.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1749.66 1316 42.019 Potri.005G024800.1.v4.1 1035 766.662 276 20.1117 Potri.004G059700.1.v4.1 961 692.678 37 2.98411 Potri.007G009000.2.v4.1 1416 1147.66 0 0 Potri.003G141000.2.v4.1 2943 2674.66 585.335 12.2259 Potri.016G087400.1.v4.1 270 67.4642 1003 830.562 Potri.015G069301.1.v4.1 564 302.61 0 0 Potri.010G195200.1.v4.1 1773 1504.66 512 19.0097 Potri.012G127500.1.v4.1 977 708.673 8634 680.629 ==> SRR7171887.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 36 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 509 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 240 SRR7171887 completed mapping pipeline successfully