Starting /dee2/code/volunteer_pipeline.sh SRR7171888 current disk space = 3110845509632 free memory = 1012269016 SRR7171888 SRAfilesize 6967efdc9827ba3eb59afd911d02ce26 SRR7171888.sra SRR7171888.sra file validated SRR7171888 is paired end SRR7171888 is conventional basespace SRR7171888 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171888_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.1405 32.0 25.0 33.0 18.0 33.0 2 30.26475 31.0 29.0 33.0 25.0 34.0 3 31.69775 33.0 32.0 33.0 27.0 33.0 4 32.1195 33.0 32.0 33.0 31.0 34.0 5 32.733 33.0 33.0 33.0 32.0 34.0 6 36.35475 38.0 36.0 38.0 33.0 38.0 7 37.027 38.0 37.0 38.0 35.0 38.0 8 37.46525 38.0 38.0 38.0 37.0 38.0 9 37.5685 38.0 38.0 38.0 38.0 38.0 10-14 37.643950000000004 38.0 38.0 38.0 38.0 38.0 15-19 37.616 38.0 38.0 38.0 38.0 38.0 20-24 37.599650000000004 38.0 38.0 38.0 38.0 38.0 25-29 37.57785 38.0 38.0 38.0 38.0 38.0 30-34 37.5675 38.0 38.0 38.0 37.6 38.0 35-39 37.526799999999994 38.0 38.0 38.0 37.6 38.0 40-44 37.477700000000006 38.0 38.0 38.0 37.0 38.0 45-49 37.43365 38.0 38.0 38.0 37.0 38.0 50-54 37.40155 38.0 38.0 38.0 37.0 38.0 55-59 37.31005 38.0 38.0 38.0 37.0 38.0 60-64 37.32635 38.0 38.0 38.0 36.8 38.0 65-69 37.22345 38.0 38.0 38.0 36.0 38.0 70-74 37.180550000000004 38.0 38.0 38.0 36.0 38.0 75-79 37.20235 38.0 38.0 38.0 36.0 38.0 80-84 37.065999999999995 38.0 38.0 38.0 36.0 38.0 85-89 36.98695 38.0 38.0 38.0 36.0 38.0 90-94 36.902699999999996 38.0 38.0 38.0 35.4 38.0 95-99 36.865750000000006 38.0 38.0 38.0 35.0 38.0 100-104 36.80825 38.0 38.0 38.0 35.0 38.0 105-109 36.645950000000006 38.0 38.0 38.0 34.2 38.0 110-114 36.596199999999996 38.0 38.0 38.0 34.2 38.0 115-119 36.39195 38.0 37.2 38.0 34.0 38.0 120-124 36.273900000000005 38.0 37.0 38.0 34.0 38.0 125-129 36.0246 38.0 36.8 38.0 33.0 38.0 130-134 35.8206 38.0 36.0 38.0 32.4 38.0 135-139 35.5992 38.0 36.0 38.0 31.0 38.0 140-144 35.31464999999999 38.0 36.0 38.0 31.0 38.0 145-149 34.6363 38.0 35.0 38.0 27.8 38.0 150-151 31.609750000000002 36.5 31.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 0.0 13 0.0 14 1.0 15 0.0 16 1.0 17 1.0 18 0.0 19 2.0 20 2.0 21 2.0 22 6.0 23 5.0 24 5.0 25 6.0 26 3.0 27 14.0 28 20.0 29 24.0 30 27.0 31 44.0 32 54.0 33 73.0 34 119.0 35 251.0 36 723.0 37 2616.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.400000000000006 12.675 12.55 34.375 2 20.65 19.85 37.85 21.65 3 20.625 24.6 26.075 28.7 4 22.675 34.425 21.0 21.9 5 21.775 34.875 25.074999999999996 18.275 6 19.375 34.875 25.724999999999998 20.025000000000002 7 14.05 21.75 44.6 19.6 8 18.9 21.675 30.325000000000003 29.099999999999998 9 18.35 22.05 32.775 26.825 10-14 20.315 29.465000000000003 26.805 23.415 15-19 20.044999999999998 28.685 27.615000000000002 23.655 20-24 20.45 28.625 27.544999999999998 23.380000000000003 25-29 20.365 28.384999999999998 27.88 23.369999999999997 30-34 21.025 28.144999999999996 27.66 23.169999999999998 35-39 20.51 28.235 27.810000000000002 23.445 40-44 20.674999999999997 28.16 27.845 23.32 45-49 20.575 28.46 27.725 23.24 50-54 20.69 27.91 27.875 23.525 55-59 20.544999999999998 27.61 27.87 23.974999999999998 60-64 20.355 28.425 27.62 23.599999999999998 65-69 20.805 28.325 27.355 23.515 70-74 21.08 27.735 27.275 23.91 75-79 20.785 28.055000000000003 27.91 23.25 80-84 20.855 27.445000000000004 28.249999999999996 23.45 85-89 20.565 28.215 27.744999999999997 23.474999999999998 90-94 21.22 27.965 27.525 23.29 95-99 21.0 27.67 27.97 23.36 100-104 20.865000000000002 27.18 27.994999999999997 23.96 105-109 20.815 27.405 28.28 23.5 110-114 20.5 28.015 27.755000000000003 23.73 115-119 21.275 27.905 27.74 23.080000000000002 120-124 21.255 28.02 27.310000000000002 23.415 125-129 21.455 27.439999999999998 27.16 23.945 130-134 21.060000000000002 27.965 28.050000000000004 22.925 135-139 20.91 27.744999999999997 27.810000000000002 23.535 140-144 20.755000000000003 28.355000000000004 27.12 23.77 145-149 21.115000000000002 27.93 27.634999999999998 23.32 150-151 20.65 28.0625 27.6375 23.65 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 1.0 22 0.5 23 0.5 24 1.5 25 3.0 26 6.0 27 7.0 28 11.5 29 15.0 30 13.0 31 15.0 32 26.0 33 40.0 34 41.0 35 54.5 36 72.5 37 90.0 38 133.0 39 171.0 40 192.5 41 224.0 42 240.0 43 265.5 44 287.0 45 262.5 46 264.5 47 273.5 48 245.5 49 202.5 50 176.5 51 151.5 52 120.0 53 96.0 54 72.5 55 56.5 56 41.0 57 32.5 58 28.0 59 21.5 60 14.0 61 7.0 62 6.0 63 4.5 64 3.0 65 3.0 66 1.5 67 0.0 68 0.5 69 0.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.2625 0.0 0.0 0.0 0.0 102-103 0.32499999999999996 0.0 0.0 0.0 0.0 104-105 0.375 0.0 0.0 0.0 0.0 106-107 0.4 0.0 0.0 0.0 0.0 108-109 0.42500000000000004 0.0 0.0 0.0 0.0 110-111 0.5625 0.0 0.0 0.0 0.0 112-113 0.675 0.0 0.0 0.0 0.0 114-115 0.825 0.0 0.0 0.0 0.0 116-117 1.0 0.0 0.0 0.0 0.0 118-119 1.1375 0.0 0.0 0.0 0.0 120-121 1.2875 0.0 0.0 0.0 0.0 122-123 1.5125 0.0 0.0 0.0 0.0 124-125 1.8624999999999998 0.0 0.0 0.0 0.0 126-127 2.025 0.0 0.0 0.0 0.0 128-129 2.2 0.0 0.0 0.0 0.0 130-131 2.3125 0.0 0.0 0.0 0.0 132-133 2.4375 0.0 0.0 0.0 0.0 134-135 2.625 0.0 0.0 0.0 0.0 136-137 2.9125 0.0 0.0 0.0 0.0 138-139 3.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCGATTA 10 0.006830828 145.0 3 >>END_MODULE SRR7171888 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171888_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.151 33.0 33.0 34.0 33.0 34.0 2 33.197 34.0 33.0 34.0 33.0 34.0 3 33.26275 34.0 33.0 34.0 33.0 34.0 4 33.2625 34.0 33.0 34.0 33.0 34.0 5 33.22225 34.0 33.0 34.0 33.0 34.0 6 37.39525 38.0 38.0 38.0 38.0 38.0 7 37.33425 38.0 38.0 38.0 38.0 38.0 8 37.3975 38.0 38.0 38.0 37.0 38.0 9 37.46325 38.0 38.0 38.0 38.0 38.0 10-14 37.3332 38.0 38.0 38.0 37.0 38.0 15-19 37.33765 38.0 38.0 38.0 37.2 38.0 20-24 37.33485 38.0 38.0 38.0 37.2 38.0 25-29 37.346199999999996 38.0 38.0 38.0 37.0 38.0 30-34 37.2838 38.0 38.0 38.0 37.2 38.0 35-39 37.1103 38.0 38.0 38.0 37.0 38.0 40-44 37.07204999999999 38.0 38.0 38.0 37.0 38.0 45-49 37.1948 38.0 38.0 38.0 37.0 38.0 50-54 37.134550000000004 38.0 38.0 38.0 36.8 38.0 55-59 37.12205 38.0 38.0 38.0 36.8 38.0 60-64 37.0793 38.0 38.0 38.0 36.6 38.0 65-69 37.02524999999999 38.0 38.0 38.0 36.0 38.0 70-74 36.966150000000006 38.0 38.0 38.0 36.0 38.0 75-79 36.90405 38.0 38.0 38.0 36.0 38.0 80-84 36.814350000000005 38.0 38.0 38.0 35.8 38.0 85-89 36.71205 38.0 38.0 38.0 35.4 38.0 90-94 36.688100000000006 38.0 38.0 38.0 35.0 38.0 95-99 36.518950000000004 38.0 38.0 38.0 34.6 38.0 100-104 36.3373 38.0 38.0 38.0 33.8 38.0 105-109 36.23455 38.0 38.0 38.0 34.0 38.0 110-114 36.1893 38.0 38.0 38.0 33.8 38.0 115-119 36.0418 38.0 37.6 38.0 33.4 38.0 120-124 35.84465 38.0 37.0 38.0 32.8 38.0 125-129 35.52025 38.0 36.4 38.0 31.0 38.0 130-134 35.31824999999999 38.0 36.0 38.0 31.0 38.0 135-139 35.07935 38.0 35.8 38.0 29.6 38.0 140-144 34.73195 38.0 35.2 38.0 28.4 38.0 145-149 34.24435 38.0 34.8 38.0 26.2 38.0 150-151 30.79325 36.5 29.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 3.0 4 2.0 5 0.0 6 2.0 7 1.0 8 1.0 9 1.0 10 0.0 11 1.0 12 2.0 13 3.0 14 2.0 15 3.0 16 1.0 17 4.0 18 1.0 19 4.0 20 7.0 21 3.0 22 7.0 23 6.0 24 6.0 25 9.0 26 11.0 27 12.0 28 18.0 29 31.0 30 28.0 31 40.0 32 66.0 33 100.0 34 134.0 35 216.0 36 619.0 37 2650.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.7 16.775000000000002 15.85 28.675 2 23.9 23.65 33.775 18.675 3 21.725 27.525 29.175 21.575 4 26.150000000000002 34.2 20.325 19.325 5 25.0 37.125 20.325 17.549999999999997 6 19.675 36.675000000000004 24.375 19.275000000000002 7 18.8 17.549999999999997 42.025 21.625 8 22.15 22.325 27.375 28.15 9 22.175 24.125 27.675 26.025 10-14 23.07 29.04 25.965 21.925 15-19 22.78 28.21 27.305 21.705 20-24 22.415 28.115000000000002 27.76 21.709999999999997 25-29 23.575 28.09 27.445000000000004 20.89 30-34 23.317151293729044 28.25183924728492 27.431059506531202 20.999949952454834 35-39 22.20774012432324 27.927611790655703 27.90254662121516 21.962101463805894 40-44 22.491592631631782 28.655322993525072 27.61632284294534 21.23676153189781 45-49 23.28 28.02 28.015 20.685000000000002 50-54 23.005 27.900000000000002 27.875 21.22 55-59 23.01 28.205000000000002 27.279999999999998 21.505 60-64 23.200000000000003 28.349999999999998 27.065 21.385 65-69 23.794999999999998 27.815 27.51 20.880000000000003 70-74 23.575 28.005000000000003 27.46 20.96 75-79 22.97 28.415000000000003 27.665 20.95 80-84 23.695 27.38 27.575 21.349999999999998 85-89 23.47 28.03 27.235 21.265 90-94 23.095 28.005000000000003 27.295 21.605 95-99 23.544999999999998 28.28 27.05 21.125 100-104 24.365000000000002 27.765 26.795 21.075 105-109 23.59 28.08 27.1 21.23 110-114 23.49 27.58 27.685 21.245 115-119 23.580000000000002 27.650000000000002 27.48 21.29 120-124 23.895 28.110000000000003 26.96 21.035 125-129 23.71 28.205000000000002 27.005000000000003 21.08 130-134 23.835 28.455000000000002 27.134999999999998 20.575 135-139 24.060000000000002 27.915 27.389999999999997 20.635 140-144 24.349999999999998 28.375 26.985 20.29 145-149 24.610000000000003 28.37 26.424999999999997 20.595 150-151 23.625 28.787499999999998 26.187500000000004 21.4 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.0 23 1.0 24 1.5 25 2.0 26 2.5 27 2.5 28 4.5 29 6.0 30 7.0 31 13.5 32 21.0 33 26.5 34 37.0 35 46.0 36 59.5 37 83.0 38 110.5 39 149.5 40 184.0 41 228.5 42 271.0 43 293.0 44 311.0 45 304.0 46 283.5 47 269.5 48 242.5 49 202.0 50 183.0 51 159.0 52 115.5 53 95.0 54 70.5 55 42.0 56 41.0 57 41.5 58 26.5 59 17.0 60 14.0 61 7.5 62 5.5 63 4.5 64 2.5 65 1.0 66 1.0 67 1.5 68 1.5 69 1.0 70 0.5 71 1.0 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.095 35-39 0.26 40-44 0.385 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69887076537015 99.325 2 0.27603513174404015 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.02509410288582183 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTAGGCTTGAGCAGATTCATTCGCCAACTAACCCTTTAATTTATCCTAT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.2625 0.0 0.0 0.0 0.0 102-103 0.32499999999999996 0.0 0.0 0.0 0.0 104-105 0.375 0.0 0.0 0.0 0.0 106-107 0.4 0.0 0.0 0.0 0.0 108-109 0.42500000000000004 0.0 0.0 0.0 0.0 110-111 0.5625 0.0 0.0 0.0 0.0 112-113 0.675 0.0 0.0 0.0 0.0 114-115 0.825 0.0 0.0 0.0 0.0 116-117 1.0 0.0 0.0 0.0 0.0 118-119 1.1375 0.0 0.0 0.0 0.0 120-121 1.2875 0.0 0.0 0.0 0.0 122-123 1.5125 0.0 0.0 0.0 0.0 124-125 1.9 0.0 0.0 0.0 0.0 126-127 2.075 0.0 0.0 0.0 0.0 128-129 2.25 0.0 0.0 0.0 0.0 130-131 2.3625 0.0 0.0 0.0 0.0 132-133 2.4875 0.0 0.0 0.0 0.0 134-135 2.675 0.0 0.0 0.0 0.0 136-137 2.9375 0.0 0.0 0.0 0.0 138-139 3.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGAGCCA 15 1.1411342E-4 145.0 4 >>END_MODULE Read 695134 spots for SRR7171888.sra Written 695134 spots for SRR7171888.sra Read 695134 spots for SRR7171888.sra Written 695134 spots for SRR7171888.sra Read 695134 spots for SRR7171888.sra Written 695134 spots for SRR7171888.sra Read 695134 spots for SRR7171888.sra Written 695134 spots for SRR7171888.sra Read 695134 spots for SRR7171888.sra Written 695134 spots for SRR7171888.sra Read 695134 spots for SRR7171888.sra Written 695134 spots for SRR7171888.sra Read 695134 spots for SRR7171888.sra Written 695134 spots for SRR7171888.sra Read 695134 spots for SRR7171888.sra Written 695134 spots for SRR7171888.sra Read 695134 spots for SRR7171888.sra Written 695134 spots for SRR7171888.sra Read 695134 spots for SRR7171888.sra Written 695134 spots for SRR7171888.sra Read 695134 spots for SRR7171888.sra Written 695134 spots for SRR7171888.sra Read 695134 spots for SRR7171888.sra Written 695134 spots for SRR7171888.sra Read 695134 spots for SRR7171888.sra Written 695134 spots for SRR7171888.sra Read 695134 spots for SRR7171888.sra Written 695134 spots for SRR7171888.sra Read 695134 spots for SRR7171888.sra Written 695134 spots for SRR7171888.sra Read 695134 spots for SRR7171888.sra Written 695134 spots for SRR7171888.sra Read 695134 spots for SRR7171888.sra Written 695134 spots for SRR7171888.sra Read 695134 spots for SRR7171888.sra Written 695134 spots for SRR7171888.sra Read 695153 spots for SRR7171888.sra Written 695153 spots for SRR7171888.sra Read 695134 spots for SRR7171888.sra Written 695134 spots for SRR7171888.sra SRR ids: ['SRR7171888.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vj202ocw SRR7171888.sra spots: 13902699 blocks: [[1, 695134], [695135, 1390268], [1390269, 2085402], [2085403, 2780536], [2780537, 3475670], [3475671, 4170804], [4170805, 4865938], [4865939, 5561072], [5561073, 6256206], [6256207, 6951340], [6951341, 7646474], [7646475, 8341608], [8341609, 9036742], [9036743, 9731876], [9731877, 10427010], [10427011, 11122144], [11122145, 11817278], [11817279, 12512412], [12512413, 13207546], [13207547, 13902699]] SRR7171888 file size 4689468 SRR7171888 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171888 SRR7171888_1.fastq SRR7171888_2.fastq Input file: SRR7171888_1.fastq Paired file: SRR7171888_2.fastq trimmed: SRR7171888-trimmed-pair1.fastq, SRR7171888-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 12:55:41 2025 >> started Fri Feb 14 12:56:09 2025 >> done (27.803s) 13902699 read pairs processed; of these: 10912 ( 0.08%) short read pairs filtered out after trimming by size control 7910 ( 0.06%) empty read pairs filtered out after trimming by size control 13883877 (99.86%) read pairs available; of these: 5801905 (41.79%) trimmed read pairs available after processing 8081972 (58.21%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 4 0.00% 21 1 0.00% 22 1 0.00% 23 2 0.00% 24 0 0.00% 25 2 0.00% 26 3 0.00% 27 3 0.00% 28 2 0.00% 29 4 0.00% 30 1 0.00% 31 1 0.00% 32 3 0.00% 33 5 0.00% 34 6 0.00% 35 2 0.00% 36 7 0.00% 37 5 0.00% 38 3 0.00% 39 8 0.00% 40 5 0.00% 41 7 0.00% 42 5 0.00% 43 6 0.00% 44 6 0.00% 45 11 0.00% 46 9 0.00% 47 7 0.00% 48 12 0.00% 49 19 0.00% 50 16 0.00% 51 16 0.00% 52 17 0.00% 53 22 0.00% 54 19 0.00% 55 14 0.00% 56 29 0.00% 57 30 0.00% 58 33 0.00% 59 30 0.00% 60 51 0.00% 61 49 0.00% 62 47 0.00% 63 65 0.00% 64 71 0.00% 65 77 0.00% 66 78 0.00% 67 90 0.00% 68 107 0.00% 69 152 0.00% 70 167 0.00% 71 176 0.00% 72 198 0.00% 73 245 0.00% 74 277 0.00% 75 298 0.00% 76 391 0.00% 77 382 0.00% 78 438 0.00% 79 486 0.00% 80 558 0.00% 81 626 0.00% 82 733 0.01% 83 859 0.01% 84 1474 0.01% 85 1842 0.01% 86 2044 0.01% 87 2113 0.02% 88 2336 0.02% 89 2421 0.02% 90 2583 0.02% 91 2727 0.02% 92 2975 0.02% 93 3268 0.02% 94 3322 0.02% 95 3758 0.03% 96 3960 0.03% 97 4131 0.03% 98 4387 0.03% 99 4731 0.03% 100 5163 0.04% 101 5368 0.04% 102 6106 0.04% 103 6228 0.04% 104 6638 0.05% 105 7183 0.05% 106 7759 0.06% 107 8135 0.06% 108 8551 0.06% 109 9188 0.07% 110 9696 0.07% 111 10264 0.07% 112 10721 0.08% 113 11381 0.08% 114 12177 0.09% 115 12924 0.09% 116 13589 0.10% 117 14163 0.10% 118 14978 0.11% 119 15559 0.11% 120 16419 0.12% 121 17123 0.12% 122 18002 0.13% 123 18812 0.14% 124 19901 0.14% 125 20789 0.15% 126 22020 0.16% 127 23065 0.17% 128 23960 0.17% 129 25251 0.18% 130 26930 0.19% 131 28515 0.21% 132 30154 0.22% 133 32456 0.23% 134 33966 0.24% 135 36344 0.26% 136 38514 0.28% 137 41130 0.30% 138 44014 0.32% 139 48148 0.35% 140 52440 0.38% 141 58132 0.42% 142 65055 0.47% 143 74434 0.54% 144 87802 0.63% 145 106112 0.76% 146 136760 0.99% 147 191947 1.38% 148 305755 2.20% 149 645868 4.65% 150 3261247 23.49% 151 8081972 58.21% 13883877 reads passed initial QC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=2.46 fanout-score-rank=31 prefix-density=0.36 prefix-fanout=2.3 sequence=CAGGTGCAGTTTGATCC criterion=fanout-score sequence-density=0.02 sequence-density-rank=34 fanout-score=64.69 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=10.5 sequence=GAAAATCAAAGTACTTCACACCATGAAAAATCACACACTAAGCAAACCATGCATGATGGAATAAAAATGCTTTTAGGCGCACTGGAAATCTTTGGGGACCTTCTTTCCACAGACATTGAGAAGCAAGCTTAGAGATACAGGGATATTAAGGTTGATGCCCAAGATGTTAGCTTTGATGGCAGTGCAAAGGCAAACAGCAGCCTCGAGATCAAGAAGGCCTTGAATGAGACTACAGCAAGGTTCTACTGGGGGAGTGCCAACGGTGACATTAAGCAATGAACCGAGCAAATCAGCACATACACCTAATTTAAGTGCATCCTTTGGGCACTTTCCAC criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=4.13 fanout-score-rank=18 prefix-density=0.63 prefix-fanout=3.1 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.03 sequence-density-rank=30 fanout-score=444.68 fanout-score-rank=1 prefix-density=0.65 prefix-fanout=23.1 sequence=GAAGAAGATCAGAGATATGGCATCAGACTGTCAAGGTAAGAGTTCATGGCCAGAGCTCCTTGGAGCACAAGCAAGGGTTGCTGTAGTGACAATTGAGACGCAGAACCCTTACGT SRR7171888 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 12:57:24 Started mapping on | Feb 14 12:57:25 Finished on | Feb 14 12:59:22 Mapping speed, Million of reads per hour | 427.20 Number of input reads | 13883877 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 12984287 Uniquely mapped reads % | 93.52% Average mapped length | 296.77 Number of splices: Total | 13163099 Number of splices: Annotated (sjdb) | 12927169 Number of splices: GT/AG | 12949344 Number of splices: GC/AG | 167008 Number of splices: AT/AC | 10337 Number of splices: Non-canonical | 36410 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.59 Insertion rate per base | 0.02% Insertion average length | 2.61 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 490999 % of reads mapped to multiple loci | 3.54% Number of reads mapped to too many loci | 50806 % of reads mapped to too many loci | 0.37% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.45% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 419426 419426 419426 N_multimapping 490999 490999 490999 N_noFeature 239835 12867444 288145 N_ambiguous 136394 633 67470 UnstrandedReadsAssigned:12608058 PositiveStrandReadsAssigned:116210 NegativeStrandReadsAssigned:12628672 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7171888 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171888-trimmed-pair1.fastq SRR7171888-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,883,877 reads, 12,541,374 reads pseudoaligned [quant] estimated average fragment length: 256.784 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,165 rounds 52401 SRR7171888.ke.tsv 34699 SRR7171888.se.tsv 87100 total ==> SRR7171888.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1762.22 1222 48.6777 Potri.005G024800.1.v4.1 1035 779.216 402 36.2148 Potri.004G059700.1.v4.1 961 705.237 62 6.17127 Potri.007G009000.2.v4.1 1416 1160.22 0 0 Potri.003G141000.2.v4.1 2943 2687.22 388.122 10.1387 Potri.016G087400.1.v4.1 270 68.8816 859.559 875.972 Potri.015G069301.1.v4.1 564 312.087 0 0 Potri.010G195200.1.v4.1 1773 1517.22 573 26.5109 Potri.012G127500.1.v4.1 977 721.216 2594 252.477 ==> SRR7171888.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 71 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 263 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 143 SRR7171888 completed mapping pipeline successfully