Starting /dee2/code/volunteer_pipeline.sh SRR7171889 current disk space = 3110651576320 free memory = 1280623060 SRR7171889 SRAfilesize c5afe8fc76b43adff8fb3f3f2db1b8d0 SRR7171889.sra SRR7171889.sra file validated SRR7171889 is paired end SRR7171889 is conventional basespace SRR7171889 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171889_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.46625 32.0 18.0 33.0 18.0 34.0 2 30.482 31.0 29.0 33.0 27.0 33.0 3 31.01825 33.0 31.0 33.0 28.0 33.0 4 32.145 33.0 33.0 33.0 30.0 34.0 5 32.427 33.0 33.0 33.0 32.0 34.0 6 36.44575 38.0 36.0 38.0 34.0 38.0 7 37.142 38.0 38.0 38.0 36.0 38.0 8 37.33525 38.0 38.0 38.0 36.0 38.0 9 37.46675 38.0 38.0 38.0 37.0 38.0 10-14 37.531 38.0 38.0 38.0 37.0 38.0 15-19 37.52405 38.0 38.0 38.0 37.2 38.0 20-24 37.48365 38.0 38.0 38.0 37.0 38.0 25-29 37.51545 38.0 38.0 38.0 37.2 38.0 30-34 37.42985 38.0 38.0 38.0 37.2 38.0 35-39 37.39635 38.0 38.0 38.0 37.0 38.0 40-44 37.418350000000004 38.0 38.0 38.0 37.0 38.0 45-49 37.3738 38.0 38.0 38.0 37.0 38.0 50-54 37.28150000000001 38.0 38.0 38.0 36.6 38.0 55-59 37.16235 38.0 38.0 38.0 36.0 38.0 60-64 37.166250000000005 38.0 38.0 38.0 36.0 38.0 65-69 37.111000000000004 38.0 38.0 38.0 36.0 38.0 70-74 37.039 38.0 38.0 38.0 36.0 38.0 75-79 37.0382 38.0 38.0 38.0 36.0 38.0 80-84 36.9328 38.0 38.0 38.0 35.4 38.0 85-89 36.84160000000001 38.0 38.0 38.0 35.2 38.0 90-94 36.65260000000001 38.0 38.0 38.0 34.4 38.0 95-99 36.6173 38.0 38.0 38.0 34.0 38.0 100-104 36.490899999999996 38.0 38.0 38.0 34.0 38.0 105-109 36.3272 38.0 37.6 38.0 33.8 38.0 110-114 36.2854 38.0 37.4 38.0 33.8 38.0 115-119 36.16155 38.0 37.0 38.0 33.4 38.0 120-124 36.0021 38.0 37.0 38.0 33.0 38.0 125-129 35.7348 38.0 36.6 38.0 32.0 38.0 130-134 35.44475 38.0 36.0 38.0 30.6 38.0 135-139 35.113600000000005 38.0 35.8 38.0 28.6 38.0 140-144 34.62135 38.0 35.0 38.0 27.0 38.0 145-149 34.0904 38.0 35.0 38.0 24.8 38.0 150-151 31.071624999999997 36.5 31.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 1.0 12 1.0 13 1.0 14 0.0 15 0.0 16 2.0 17 2.0 18 1.0 19 2.0 20 2.0 21 3.0 22 4.0 23 11.0 24 4.0 25 9.0 26 11.0 27 15.0 28 22.0 29 30.0 30 53.0 31 47.0 32 58.0 33 81.0 34 147.0 35 306.0 36 796.0 37 2390.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.6688344172086 15.407703851925964 12.831415707853926 34.092046023011505 2 20.225 18.825 35.9 25.05 3 19.900000000000002 25.35 28.475 26.275 4 21.75 33.275 22.85 22.125 5 20.825 35.125 23.825 20.225 6 17.2 35.9 25.45 21.45 7 13.5 22.05 44.9 19.55 8 18.925 22.325 29.875 28.875 9 18.525 23.5 29.5 28.475 10-14 20.145 29.56 26.419999999999998 23.875 15-19 19.93 28.02 27.66 24.39 20-24 19.765 28.34 27.67 24.224999999999998 25-29 19.81 28.43 27.91 23.849999999999998 30-34 20.265 28.32 27.825 23.59 35-39 20.46 27.639999999999997 28.165000000000003 23.735 40-44 20.44 28.34 27.565 23.655 45-49 20.405 27.950000000000003 27.105 24.54 50-54 20.565 28.110000000000003 27.83 23.494999999999997 55-59 20.445 27.905 27.705000000000002 23.945 60-64 20.43 28.595 27.595 23.380000000000003 65-69 20.54 28.315 27.495000000000005 23.65 70-74 20.82 27.975 27.425 23.78 75-79 20.435 28.46 27.325 23.78 80-84 20.715 27.800000000000004 27.29 24.195 85-89 20.535 27.805000000000003 27.735 23.925 90-94 20.86 27.825 27.689999999999998 23.625 95-99 20.315 28.26 27.755000000000003 23.669999999999998 100-104 20.61 28.065 27.675 23.65 105-109 21.02 27.52 27.91 23.549999999999997 110-114 21.165 27.584999999999997 27.43 23.82 115-119 20.990000000000002 27.985 27.41 23.615 120-124 21.029999999999998 27.91 27.375 23.685000000000002 125-129 21.05 27.615000000000002 27.839999999999996 23.494999999999997 130-134 21.325 28.21 26.810000000000002 23.655 135-139 21.665 27.54 27.029999999999998 23.765 140-144 20.925 27.47 27.54 24.065 145-149 21.415 27.54 27.425 23.62 150-151 21.175 27.675 26.337500000000002 24.8125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 1.5 24 1.5 25 4.0 26 8.0 27 11.5 28 10.5 29 9.0 30 16.0 31 23.0 32 30.5 33 42.5 34 46.5 35 58.0 36 81.5 37 102.0 38 120.5 39 145.0 40 176.0 41 220.0 42 242.5 43 262.0 44 287.5 45 280.5 46 275.0 47 256.0 48 215.0 49 191.5 50 177.5 51 147.0 52 115.0 53 95.0 54 84.5 55 73.5 56 52.5 57 31.0 58 21.5 59 18.0 60 13.5 61 10.0 62 11.0 63 10.0 64 7.5 65 4.5 66 1.5 67 2.0 68 1.5 69 0.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67385850476668 99.325 2 0.3010536879076769 0.6 3 0.025087807325639738 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0125 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.037500000000000006 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.0875 0.0 0.0 0.0 0.0 98-99 0.1125 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.21250000000000002 0.0 0.0 0.0 0.0 104-105 0.2375 0.0 0.0 0.0 0.0 106-107 0.3375 0.0 0.0 0.0 0.0 108-109 0.4 0.0 0.0 0.0 0.0 110-111 0.475 0.0 0.0 0.0 0.0 112-113 0.5625 0.0 0.0 0.0 0.0 114-115 0.625 0.0 0.0 0.0 0.0 116-117 0.725 0.0 0.0 0.0 0.0 118-119 0.8 0.0 0.0 0.0 0.0 120-121 0.8999999999999999 0.0 0.0 0.0 0.0 122-123 1.075 0.0 0.0 0.0 0.0 124-125 1.275 0.0 0.0 0.0 0.0 126-127 1.475 0.0 0.0 0.0 0.0 128-129 1.6625 0.0 0.0 0.0 0.0 130-131 1.7375 0.0 0.0 0.0 0.0 132-133 1.8375 0.0 0.0 0.0 0.0 134-135 2.1500000000000004 0.0 0.0 0.0 0.0 136-137 2.325 0.0 0.0 0.0 0.0 138-139 2.6375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7171889 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171889_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.89275 33.0 33.0 34.0 32.0 34.0 2 33.055 34.0 33.0 34.0 32.0 34.0 3 33.09575 34.0 33.0 34.0 33.0 34.0 4 33.03275 34.0 33.0 34.0 33.0 34.0 5 33.01975 34.0 33.0 34.0 33.0 34.0 6 37.13325 38.0 38.0 38.0 37.0 38.0 7 37.21875 38.0 38.0 38.0 37.0 38.0 8 37.119 38.0 38.0 38.0 37.0 38.0 9 37.19025 38.0 38.0 38.0 37.0 38.0 10-14 37.18665 38.0 38.0 38.0 37.0 38.0 15-19 37.09135 38.0 38.0 38.0 37.0 38.0 20-24 37.1802 38.0 38.0 38.0 37.0 38.0 25-29 37.1189 38.0 38.0 38.0 37.0 38.0 30-34 37.0831 38.0 38.0 38.0 36.8 38.0 35-39 36.86274999999999 38.0 38.0 38.0 36.2 38.0 40-44 36.55215 38.0 38.0 38.0 35.8 38.0 45-49 36.9345 38.0 38.0 38.0 36.0 38.0 50-54 36.9339 38.0 38.0 38.0 36.0 38.0 55-59 36.920249999999996 38.0 38.0 38.0 36.0 38.0 60-64 36.83964999999999 38.0 38.0 38.0 36.0 38.0 65-69 36.82615 38.0 38.0 38.0 36.0 38.0 70-74 36.741499999999995 38.0 38.0 38.0 35.6 38.0 75-79 36.65745 38.0 38.0 38.0 35.0 38.0 80-84 36.608999999999995 38.0 38.0 38.0 34.8 38.0 85-89 36.41465 38.0 38.0 38.0 34.0 38.0 90-94 36.2966 38.0 38.0 38.0 34.0 38.0 95-99 36.2167 38.0 38.0 38.0 33.8 38.0 100-104 36.1043 38.0 37.8 38.0 33.6 38.0 105-109 35.90464999999999 38.0 37.4 38.0 33.0 38.0 110-114 35.67205 38.0 37.0 38.0 31.4 38.0 115-119 35.60594999999999 38.0 37.0 38.0 31.4 38.0 120-124 35.394149999999996 38.0 36.2 38.0 31.0 38.0 125-129 35.19225 38.0 36.0 38.0 30.0 38.0 130-134 34.766 38.0 35.8 38.0 27.8 38.0 135-139 34.52765 38.0 35.0 38.0 27.2 38.0 140-144 34.0661 38.0 35.0 38.0 23.4 38.0 145-149 33.391149999999996 38.0 34.4 38.0 18.2 38.0 150-151 30.00875 36.5 28.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 1.0 4 1.0 5 2.0 6 1.0 7 2.0 8 1.0 9 2.0 10 1.0 11 0.0 12 2.0 13 3.0 14 2.0 15 7.0 16 5.0 17 2.0 18 6.0 19 3.0 20 1.0 21 7.0 22 14.0 23 8.0 24 15.0 25 14.0 26 17.0 27 14.0 28 30.0 29 28.0 30 51.0 31 52.0 32 69.0 33 115.0 34 158.0 35 295.0 36 684.0 37 2379.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.75 17.45 16.2 24.6 2 24.625 24.375 32.5 18.5 3 22.075 26.900000000000002 30.225 20.8 4 24.175 36.575 21.375 17.875 5 23.549999999999997 35.425000000000004 21.875 19.15 6 18.575 36.199999999999996 24.925 20.3 7 18.775 18.099999999999998 41.175 21.95 8 20.75 23.625 27.0 28.625 9 22.400000000000002 25.85 28.1 23.65 10-14 23.445 28.37 26.165 22.02 15-19 23.044999999999998 27.944999999999997 27.595 21.415 20-24 22.79 28.64 27.16 21.41 25-29 22.865 28.15 27.415 21.57 30-34 23.14 27.785 27.67 21.404999999999998 35-39 23.280715865674644 27.654333400361953 27.609089081037602 21.4558616529258 40-44 23.088970848279693 27.444045874804225 27.681503561865306 21.785479715050776 45-49 23.345 27.915 27.55 21.19 50-54 23.255 28.015 27.505000000000003 21.224999999999998 55-59 23.135 28.21 27.455000000000002 21.2 60-64 22.93 28.26 27.76 21.05 65-69 23.745 27.935 26.945000000000004 21.375 70-74 23.580000000000002 27.689999999999998 27.3 21.43 75-79 23.445 27.650000000000002 27.495000000000005 21.41 80-84 23.605 27.834999999999997 27.474999999999998 21.085 85-89 23.29 27.175 27.925 21.61 90-94 23.13 27.865000000000002 28.13 20.875 95-99 24.005000000000003 28.23 27.139999999999997 20.625 100-104 23.885 28.084999999999997 26.695 21.335 105-109 23.835 27.950000000000003 27.145000000000003 21.07 110-114 24.075 28.07 27.215 20.64 115-119 24.015 27.79 27.139999999999997 21.055 120-124 23.75 27.855 27.36 21.035 125-129 24.07 27.88 27.205000000000002 20.845 130-134 24.13 27.900000000000002 27.015 20.955 135-139 24.215 27.37 27.425 20.990000000000002 140-144 23.885 27.229999999999997 27.894999999999996 20.990000000000002 145-149 24.385 27.994999999999997 26.784999999999997 20.835 150-151 24.212500000000002 28.599999999999998 26.5875 20.599999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.5 23 1.0 24 1.5 25 1.5 26 2.5 27 4.0 28 5.0 29 7.0 30 9.5 31 11.5 32 21.0 33 28.0 34 36.0 35 51.0 36 68.0 37 93.0 38 124.5 39 152.5 40 184.5 41 213.5 42 248.0 43 278.5 44 290.0 45 298.0 46 273.0 47 246.0 48 242.5 49 231.0 50 191.5 51 153.0 52 134.0 53 101.0 54 62.5 55 48.0 56 41.0 57 32.5 58 29.5 59 23.0 60 16.5 61 13.0 62 8.0 63 3.0 64 3.0 65 5.0 66 3.0 67 1.5 68 1.0 69 0.0 70 0.0 71 1.0 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.54 40-44 1.035 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64859437751004 99.25 2 0.30120481927710846 0.6 3 0.0502008032128514 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0125 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.037500000000000006 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.0875 0.0 0.0 0.0 0.0 98-99 0.1125 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.21250000000000002 0.0 0.0 0.0 0.0 104-105 0.2375 0.0 0.0 0.0 0.0 106-107 0.32499999999999996 0.0 0.0 0.0 0.0 108-109 0.375 0.0 0.0 0.0 0.0 110-111 0.44999999999999996 0.0 0.0 0.0 0.0 112-113 0.5375000000000001 0.0 0.0 0.0 0.0 114-115 0.6 0.0 0.0 0.0 0.0 116-117 0.7 0.0 0.0 0.0 0.0 118-119 0.75 0.0 0.0 0.0 0.0 120-121 0.8625 0.0 0.0 0.0 0.0 122-123 1.05 0.0 0.0 0.0 0.0 124-125 1.3125 0.0 0.0 0.0 0.0 126-127 1.5 0.0 0.0 0.0 0.0 128-129 1.7 0.0 0.0 0.0 0.0 130-131 1.7999999999999998 0.0 0.0 0.0 0.0 132-133 1.9375 0.0 0.0 0.0 0.0 134-135 2.2625 0.0 0.0 0.0 0.0 136-137 2.45 0.0 0.0 0.0 0.0 138-139 2.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATGATTA 10 0.006843168 144.91249 9 CAACCAA 10 0.006843168 144.91249 4 TATGATT 10 0.006843168 144.91249 8 >>END_MODULE Read 815149 spots for SRR7171889.sra Written 815149 spots for SRR7171889.sra Read 815149 spots for SRR7171889.sra Written 815149 spots for SRR7171889.sra Read 815149 spots for SRR7171889.sra Written 815149 spots for SRR7171889.sra Read 815149 spots for SRR7171889.sra Written 815149 spots for SRR7171889.sra Read 815149 spots for SRR7171889.sra Written 815149 spots for SRR7171889.sra Read 815149 spots for SRR7171889.sra Written 815149 spots for SRR7171889.sra Read 815149 spots for SRR7171889.sra Written 815149 spots for SRR7171889.sra Read 815149 spots for SRR7171889.sra Written 815149 spots for SRR7171889.sra Read 815149 spots for SRR7171889.sra Written 815149 spots for SRR7171889.sra Read 815149 spots for SRR7171889.sra Written 815149 spots for SRR7171889.sra Read 815149 spots for SRR7171889.sra Written 815149 spots for SRR7171889.sra Read 815149 spots for SRR7171889.sra Written 815149 spots for SRR7171889.sra Read 815149 spots for SRR7171889.sra Written 815149 spots for SRR7171889.sra Read 815149 spots for SRR7171889.sra Written 815149 spots for SRR7171889.sra Read 815149 spots for SRR7171889.sra Written 815149 spots for SRR7171889.sra Read 815149 spots for SRR7171889.sra Written 815149 spots for SRR7171889.sra Read 815149 spots for SRR7171889.sra Written 815149 spots for SRR7171889.sra Read 815149 spots for SRR7171889.sra Written 815149 spots for SRR7171889.sra Read 815149 spots for SRR7171889.sra Written 815149 spots for SRR7171889.sra Read 815158 spots for SRR7171889.sra Written 815158 spots for SRR7171889.sra SRR ids: ['SRR7171889.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7csefloy SRR7171889.sra spots: 16302989 blocks: [[1, 815149], [815150, 1630298], [1630299, 2445447], [2445448, 3260596], [3260597, 4075745], [4075746, 4890894], [4890895, 5706043], [5706044, 6521192], [6521193, 7336341], [7336342, 8151490], [8151491, 8966639], [8966640, 9781788], [9781789, 10596937], [10596938, 11412086], [11412087, 12227235], [12227236, 13042384], [13042385, 13857533], [13857534, 14672682], [14672683, 15487831], [15487832, 16302989]] SRR7171889 file size 5502847 SRR7171889 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171889 SRR7171889_1.fastq SRR7171889_2.fastq Input file: SRR7171889_1.fastq Paired file: SRR7171889_2.fastq trimmed: SRR7171889-trimmed-pair1.fastq, SRR7171889-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 13:05:16 2025 >> started Fri Feb 14 13:05:37 2025 >> done (20.589s) 16302989 read pairs processed; of these: 23969 ( 0.15%) short read pairs filtered out after trimming by size control 14994 ( 0.09%) empty read pairs filtered out after trimming by size control 16264026 (99.76%) read pairs available; of these: 6678387 (41.06%) trimmed read pairs available after processing 9585639 (58.94%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 2 0.00% 20 5 0.00% 21 5 0.00% 22 3 0.00% 23 5 0.00% 24 3 0.00% 25 7 0.00% 26 5 0.00% 27 8 0.00% 28 9 0.00% 29 8 0.00% 30 7 0.00% 31 5 0.00% 32 4 0.00% 33 4 0.00% 34 1 0.00% 35 3 0.00% 36 4 0.00% 37 5 0.00% 38 3 0.00% 39 4 0.00% 40 2 0.00% 41 10 0.00% 42 7 0.00% 43 7 0.00% 44 3 0.00% 45 11 0.00% 46 10 0.00% 47 18 0.00% 48 17 0.00% 49 26 0.00% 50 20 0.00% 51 30 0.00% 52 26 0.00% 53 29 0.00% 54 33 0.00% 55 39 0.00% 56 39 0.00% 57 53 0.00% 58 50 0.00% 59 64 0.00% 60 69 0.00% 61 56 0.00% 62 79 0.00% 63 92 0.00% 64 108 0.00% 65 96 0.00% 66 108 0.00% 67 139 0.00% 68 151 0.00% 69 179 0.00% 70 192 0.00% 71 225 0.00% 72 264 0.00% 73 314 0.00% 74 363 0.00% 75 403 0.00% 76 500 0.00% 77 489 0.00% 78 567 0.00% 79 700 0.00% 80 765 0.00% 81 859 0.01% 82 991 0.01% 83 1223 0.01% 84 2233 0.01% 85 2990 0.02% 86 3198 0.02% 87 3776 0.02% 88 3677 0.02% 89 3638 0.02% 90 3791 0.02% 91 3975 0.02% 92 4017 0.02% 93 4333 0.03% 94 4585 0.03% 95 4731 0.03% 96 4980 0.03% 97 5225 0.03% 98 5577 0.03% 99 5925 0.04% 100 6257 0.04% 101 6668 0.04% 102 7121 0.04% 103 7562 0.05% 104 8047 0.05% 105 8748 0.05% 106 9287 0.06% 107 9705 0.06% 108 10201 0.06% 109 10632 0.07% 110 11308 0.07% 111 12136 0.07% 112 12890 0.08% 113 13719 0.08% 114 14475 0.09% 115 15275 0.09% 116 15986 0.10% 117 16830 0.10% 118 17509 0.11% 119 18219 0.11% 120 18930 0.12% 121 19741 0.12% 122 20895 0.13% 123 22124 0.14% 124 22986 0.14% 125 24222 0.15% 126 25963 0.16% 127 26765 0.16% 128 27906 0.17% 129 29533 0.18% 130 31005 0.19% 131 32787 0.20% 132 35138 0.22% 133 37140 0.23% 134 39666 0.24% 135 42484 0.26% 136 45599 0.28% 137 48382 0.30% 138 52412 0.32% 139 56459 0.35% 140 61472 0.38% 141 68110 0.42% 142 76934 0.47% 143 87973 0.54% 144 103995 0.64% 145 124509 0.77% 146 160166 0.98% 147 221929 1.36% 148 349558 2.15% 149 722056 4.44% 150 3732793 22.95% 151 9585639 58.94% 16264026 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=3.22 fanout-score-rank=28 prefix-density=0.43 prefix-fanout=2.2 sequence=CATCTCAGACCTCTCATAGAACATCTTAACTGGTGCAACACCTGCAATGATTGTCTCAGTTGTGGTGTTCTCTGAGAAACCTAAGTCAGGGTACATGCCACATTTGCA criterion=fanout-score sequence-density=0.04 sequence-density-rank=35 fanout-score=13.93 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=2.9 sequence=ACAGCAAATACCAGCGGCCCTGACCCCGGGGAACAGTCGCATGACGAGGCAGTTTCCAGAAACGTGTATCACATCTAGGCATGGAATCTTATGCCAGCTAACGGAACAAGCTTTGTGCCATTCGGACCTACCGTAAGCCTATATTTCGTTTTTCTGAGACCTATCCGAGTTCAGTGCGACCGTACAGCTCTGGAACCCAAAGGTTCGTTTTTTTCTTGGTACCTATTCCTCCAGGAATTACTGACCATAGTGCTCGTACGCTAGTCTAGCCTAGTAAAACCACGATCAGCCGACGGTCTGGATGCCGACGCCCGTATACTGTGAGC criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=2.38 fanout-score-rank=27 prefix-density=0.49 prefix-fanout=2.3 sequence=ATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=94.14 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=7.1 sequence=CTCCTGCTCTCGCAATCGCTGCTTCTTTGTCTGTCTTTGGGTCGATCCGAAAGAGAGGAGCTCTTCTGCGCAATCATGTTGGTCTATCAAGATCTTCTCTCTGGTGATGAGCTTCTCTCGGATTCGTTCCCATACAAGGAGATTGAGAATGGGATACTGTGGGAAGTTGAAGGAAAGTGGGTTGTTCAAGGAGCCGTTGATGTAGACATTGGTGCAAATCCTTCAGCTGAAGGAGGTGATGAGGATGAGGGTGTTGATGACCAAGCTGCCAAGGTTGTTGACATCGTTGACACATTTAGGCTCCAGGAGCAACCTCCATTTGACAAGAAGCAGTTTCTTACACAGATTAAGAAATTTATCAAGAA SRR7171889 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 13:06:59 Started mapping on | Feb 14 13:07:00 Finished on | Feb 14 13:10:53 Mapping speed, Million of reads per hour | 251.29 Number of input reads | 16264026 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 14287968 Uniquely mapped reads % | 87.85% Average mapped length | 296.65 Number of splices: Total | 13896994 Number of splices: Annotated (sjdb) | 13617624 Number of splices: GT/AG | 13658644 Number of splices: GC/AG | 183672 Number of splices: AT/AC | 15039 Number of splices: Non-canonical | 39639 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.58 Insertion rate per base | 0.02% Insertion average length | 2.70 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 394733 % of reads mapped to multiple loci | 2.43% Number of reads mapped to too many loci | 55691 % of reads mapped to too many loci | 0.34% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 9.28% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1602544 1602544 1602544 N_multimapping 394733 394733 394733 N_noFeature 361263 14158625 422377 N_ambiguous 149418 834 80774 UnstrandedReadsAssigned:13777287 PositiveStrandReadsAssigned:128509 NegativeStrandReadsAssigned:13784817 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7171889 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171889-trimmed-pair1.fastq SRR7171889-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,264,026 reads, 13,703,640 reads pseudoaligned [quant] estimated average fragment length: 259.035 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,084 rounds 52401 SRR7171889.ke.tsv 34699 SRR7171889.se.tsv 87100 total ==> SRR7171889.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1759.97 1738 68.0555 Potri.005G024800.1.v4.1 1035 776.965 304 26.9643 Potri.004G059700.1.v4.1 961 702.982 35 3.43117 Potri.007G009000.2.v4.1 1416 1157.97 0 0 Potri.003G141000.2.v4.1 2943 2684.97 573 14.7073 Potri.016G087400.1.v4.1 270 68.8887 651.977 652.232 Potri.015G069301.1.v4.1 564 310.638 0 0 Potri.010G195200.1.v4.1 1773 1514.97 797.843 36.2938 Potri.012G127500.1.v4.1 977 718.971 13098 1255.49 ==> SRR7171889.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 5 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 383 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 301 SRR7171889 completed mapping pipeline successfully