Starting /dee2/code/volunteer_pipeline.sh SRR7171890 current disk space = 3089301745664 free memory = 1450360576 SRR7171890 SRAfilesize 56f0bbd8c5301a15acd29f17a9df2363 SRR7171890.sra SRR7171890.sra file validated SRR7171890 is paired end SRR7171890 is conventional basespace SRR7171890 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171890_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.8415 32.0 18.0 33.0 18.0 33.0 2 27.976 30.0 25.0 33.0 18.0 33.0 3 30.5055 31.0 29.0 33.0 27.0 33.0 4 31.67425 33.0 31.0 33.0 29.0 33.0 5 32.45725 33.0 33.0 33.0 32.0 33.0 6 36.5065 38.0 37.0 38.0 34.0 38.0 7 36.60625 38.0 37.0 38.0 34.0 38.0 8 37.22875 38.0 38.0 38.0 36.0 38.0 9 37.37175 38.0 38.0 38.0 37.0 38.0 10-14 37.4967 38.0 38.0 38.0 37.2 38.0 15-19 37.49595 38.0 38.0 38.0 37.0 38.0 20-24 37.52595 38.0 38.0 38.0 37.0 38.0 25-29 37.49885 38.0 38.0 38.0 37.6 38.0 30-34 37.4423 38.0 38.0 38.0 37.0 38.0 35-39 37.43845 38.0 38.0 38.0 37.0 38.0 40-44 37.415600000000005 38.0 38.0 38.0 37.0 38.0 45-49 37.3712 38.0 38.0 38.0 37.0 38.0 50-54 37.3219 38.0 38.0 38.0 37.0 38.0 55-59 37.22105 38.0 38.0 38.0 36.2 38.0 60-64 37.145500000000006 38.0 38.0 38.0 36.0 38.0 65-69 37.099149999999995 38.0 38.0 38.0 36.0 38.0 70-74 37.056850000000004 38.0 38.0 38.0 36.0 38.0 75-79 36.93985 38.0 38.0 38.0 35.4 38.0 80-84 36.866200000000006 38.0 38.0 38.0 35.4 38.0 85-89 36.818799999999996 38.0 38.0 38.0 35.0 38.0 90-94 36.659 38.0 38.0 38.0 34.6 38.0 95-99 36.6342 38.0 38.0 38.0 34.4 38.0 100-104 36.491200000000006 38.0 38.0 38.0 34.0 38.0 105-109 36.258700000000005 38.0 37.8 38.0 33.8 38.0 110-114 36.2362 38.0 37.4 38.0 34.0 38.0 115-119 36.086850000000005 38.0 37.0 38.0 33.0 38.0 120-124 35.98965 38.0 37.0 38.0 33.0 38.0 125-129 35.81435 38.0 36.8 38.0 32.2 38.0 130-134 35.44605 38.0 36.0 38.0 31.0 38.0 135-139 35.21035 38.0 36.0 38.0 30.0 38.0 140-144 34.759899999999995 38.0 35.2 38.0 27.6 38.0 145-149 34.218500000000006 38.0 35.0 38.0 25.4 38.0 150-151 31.171125 36.5 31.5 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 2.0 14 1.0 15 1.0 16 2.0 17 1.0 18 5.0 19 4.0 20 3.0 21 4.0 22 4.0 23 7.0 24 8.0 25 13.0 26 11.0 27 13.0 28 12.0 29 19.0 30 52.0 31 47.0 32 80.0 33 88.0 34 161.0 35 253.0 36 790.0 37 2418.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.66066066066066 14.43943943943944 13.313313313313312 36.58658658658659 2 20.349999999999998 17.45 37.225 24.975 3 18.675 22.900000000000002 28.449999999999996 29.975 4 23.474999999999998 30.2 23.724999999999998 22.6 5 22.425 34.225 23.549999999999997 19.8 6 17.175 35.975 26.174999999999997 20.674999999999997 7 13.425 24.075 43.65 18.85 8 18.15 23.525 29.725 28.599999999999998 9 17.849999999999998 22.3 32.800000000000004 27.05 10-14 19.545 29.475 26.97 24.01 15-19 20.044999999999998 28.375 27.935 23.645 20-24 19.34 28.37 28.77 23.52 25-29 20.235 27.939999999999998 27.800000000000004 24.025 30-34 19.955000000000002 28.455000000000002 28.125 23.465 35-39 19.744999999999997 29.17 27.27 23.815 40-44 19.61 28.465 28.134999999999998 23.79 45-49 20.68 28.025 27.93 23.365 50-54 19.845 27.92 28.22 24.015 55-59 20.215 28.425 27.875 23.485 60-64 20.22 28.015 28.325 23.44 65-69 19.99 28.185 27.939999999999998 23.885 70-74 20.075000000000003 28.494999999999997 27.79 23.64 75-79 20.215 28.549999999999997 27.725 23.51 80-84 20.47 27.805000000000003 28.13 23.595 85-89 20.275000000000002 27.77 27.935 24.02 90-94 20.330000000000002 27.965 27.389999999999997 24.315 95-99 19.585 28.255000000000003 27.855 24.305 100-104 20.535 27.63 28.22 23.615 105-109 20.305 28.105000000000004 28.134999999999998 23.455000000000002 110-114 21.005 28.08 27.63 23.285 115-119 20.745 27.834999999999997 27.74 23.68 120-124 20.215 27.785 27.71 24.29 125-129 20.955 27.82 27.589999999999996 23.635 130-134 20.685000000000002 27.455000000000002 27.865000000000002 23.995 135-139 20.615 27.525 27.98 23.880000000000003 140-144 21.235 27.975 27.455000000000002 23.335 145-149 20.745 28.355000000000004 27.12 23.78 150-151 21.462500000000002 27.474999999999998 27.5625 23.5 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.5 16 1.5 17 1.0 18 0.5 19 0.5 20 1.0 21 0.5 22 0.5 23 3.0 24 5.0 25 2.5 26 2.0 27 6.5 28 8.0 29 9.0 30 14.0 31 21.0 32 27.5 33 37.0 34 49.5 35 60.5 36 77.5 37 116.5 38 151.5 39 171.0 40 201.5 41 222.5 42 246.5 43 267.0 44 272.5 45 275.5 46 268.0 47 265.5 48 244.0 49 199.5 50 168.0 51 137.0 52 101.0 53 83.5 54 72.0 55 52.0 56 39.0 57 33.5 58 19.5 59 12.0 60 12.0 61 7.0 62 8.0 63 6.5 64 3.0 65 3.5 66 2.0 67 1.0 68 0.5 69 2.0 70 2.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72410333584149 99.4 2 0.2508151492350138 0.5 3 0.0 0.0 4 0.025081514923501375 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.21250000000000002 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.32499999999999996 0.0 0.0 0.0 0.0 104-105 0.4 0.0 0.0 0.0 0.0 106-107 0.5249999999999999 0.0 0.0 0.0 0.0 108-109 0.6 0.0 0.0 0.0 0.0 110-111 0.65 0.0 0.0 0.0 0.0 112-113 0.7 0.0 0.0 0.0 0.0 114-115 0.875 0.0 0.0 0.0 0.0 116-117 1.0750000000000002 0.0 0.0 0.0 0.0 118-119 1.2374999999999998 0.0 0.0 0.0 0.0 120-121 1.4500000000000002 0.0 0.0 0.0 0.0 122-123 1.7374999999999998 0.0 0.0 0.0 0.0 124-125 1.8875000000000002 0.0 0.0 0.0 0.0 126-127 2.15 0.0 0.0 0.0 0.0 128-129 2.4000000000000004 0.0 0.0 0.0 0.0 130-131 2.7249999999999996 0.0 0.0 0.0 0.0 132-133 3.075 0.0 0.0 0.0 0.0 134-135 3.4000000000000004 0.0 0.0 0.0 0.0 136-137 3.675 0.0 0.0 0.0 0.0 138-139 3.9875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCTGCCT 10 0.006577216 146.82278 1 TAAGCCT 10 0.006832588 144.9875 7 CTGCCTC 10 0.006832588 144.9875 2 >>END_MODULE SRR7171890 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171890_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.95725 33.0 33.0 34.0 32.0 34.0 2 33.056 34.0 33.0 34.0 32.0 34.0 3 33.14475 34.0 33.0 34.0 33.0 34.0 4 33.098 34.0 33.0 34.0 33.0 34.0 5 33.038 34.0 33.0 34.0 33.0 34.0 6 37.2495 38.0 38.0 38.0 37.0 38.0 7 37.26675 38.0 38.0 38.0 37.0 38.0 8 37.133 38.0 38.0 38.0 37.0 38.0 9 37.1455 38.0 38.0 38.0 37.0 38.0 10-14 37.21555 38.0 38.0 38.0 37.0 38.0 15-19 37.15225 38.0 38.0 38.0 37.0 38.0 20-24 37.17925 38.0 38.0 38.0 37.0 38.0 25-29 37.17095 38.0 38.0 38.0 37.0 38.0 30-34 37.111749999999994 38.0 38.0 38.0 36.6 38.0 35-39 36.964549999999996 38.0 38.0 38.0 36.4 38.0 40-44 36.71705000000001 38.0 38.0 38.0 36.0 38.0 45-49 36.9952 38.0 38.0 38.0 36.0 38.0 50-54 37.04515 38.0 38.0 38.0 36.0 38.0 55-59 36.937949999999994 38.0 38.0 38.0 36.0 38.0 60-64 36.9043 38.0 38.0 38.0 36.0 38.0 65-69 36.84565 38.0 38.0 38.0 36.0 38.0 70-74 36.784800000000004 38.0 38.0 38.0 35.6 38.0 75-79 36.695949999999996 38.0 38.0 38.0 35.0 38.0 80-84 36.55655 38.0 38.0 38.0 35.0 38.0 85-89 36.4563 38.0 38.0 38.0 34.2 38.0 90-94 36.285199999999996 38.0 38.0 38.0 34.0 38.0 95-99 36.2445 38.0 38.0 38.0 34.0 38.0 100-104 36.1699 38.0 38.0 38.0 34.0 38.0 105-109 35.926 38.0 37.4 38.0 32.8 38.0 110-114 35.737 38.0 37.0 38.0 32.4 38.0 115-119 35.58075000000001 38.0 37.0 38.0 31.0 38.0 120-124 35.4388 38.0 36.6 38.0 30.6 38.0 125-129 35.195299999999996 38.0 36.0 38.0 28.8 38.0 130-134 34.85265 38.0 35.6 38.0 27.8 38.0 135-139 34.62535 38.0 35.2 38.0 26.6 38.0 140-144 34.2548 38.0 35.0 38.0 24.4 38.0 145-149 33.61025 38.0 35.0 38.0 20.6 38.0 150-151 30.3575 36.5 29.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 1.0 4 2.0 5 1.0 6 0.0 7 1.0 8 2.0 9 0.0 10 0.0 11 3.0 12 5.0 13 1.0 14 2.0 15 4.0 16 2.0 17 0.0 18 5.0 19 4.0 20 4.0 21 14.0 22 8.0 23 11.0 24 12.0 25 7.0 26 25.0 27 16.0 28 28.0 29 23.0 30 38.0 31 64.0 32 79.0 33 97.0 34 170.0 35 252.0 36 647.0 37 2464.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.3 18.725 16.05 26.924999999999997 2 22.875 25.974999999999998 33.45 17.7 3 21.349999999999998 28.475 29.025000000000002 21.15 4 23.875 36.475 21.075 18.575 5 24.15 36.75 21.625 17.474999999999998 6 18.75 38.6 24.2 18.45 7 19.175 18.275 40.150000000000006 22.400000000000002 8 21.2 23.075000000000003 27.425 28.299999999999997 9 22.45 24.875 27.250000000000004 25.424999999999997 10-14 23.294999999999998 29.080000000000002 26.495 21.13 15-19 23.24 28.16 27.175 21.425 20-24 23.494999999999997 29.085 26.974999999999998 20.445 25-29 23.105 28.435 27.36 21.099999999999998 30-34 22.945 27.915 27.98 21.16 35-39 23.72235317719043 27.58914689803902 27.669391644515773 21.019108280254777 40-44 23.321252391019833 28.30967482130273 27.876774388402296 20.492298399275143 45-49 23.155 28.18 27.639999999999997 21.025 50-54 23.645 28.465 27.485 20.405 55-59 23.544999999999998 28.155 27.495000000000005 20.805 60-64 23.75 27.855 27.435 20.96 65-69 23.695 28.185 27.33 20.79 70-74 23.45 28.325 27.744999999999997 20.48 75-79 23.849999999999998 27.900000000000002 27.145000000000003 21.105 80-84 23.76 27.73 27.525 20.985 85-89 23.82 28.02 27.41 20.75 90-94 23.945 28.04 27.62 20.395 95-99 24.175 27.755000000000003 27.544999999999998 20.525 100-104 23.96 28.785 27.235 20.02 105-109 24.03 28.015 28.1 19.855 110-114 23.9 28.22 27.665 20.215 115-119 24.349999999999998 27.689999999999998 27.694999999999997 20.265 120-124 23.655 28.044999999999998 27.825 20.474999999999998 125-129 23.630000000000003 27.905 28.02 20.445 130-134 24.005000000000003 27.915 27.48 20.599999999999998 135-139 24.104999999999997 28.060000000000002 27.284999999999997 20.549999999999997 140-144 24.47 28.38 27.089999999999996 20.06 145-149 24.87 28.444999999999997 26.985 19.7 150-151 24.875 28.037499999999998 27.4125 19.675 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.0 15 0.0 16 1.0 17 1.0 18 0.0 19 0.0 20 0.0 21 1.0 22 2.5 23 1.5 24 0.5 25 1.5 26 5.0 27 5.0 28 4.5 29 6.5 30 6.5 31 13.0 32 19.5 33 23.0 34 37.5 35 53.0 36 72.5 37 107.5 38 129.5 39 150.5 40 191.0 41 222.0 42 249.5 43 276.5 44 296.0 45 304.0 46 289.5 47 272.5 48 259.5 49 219.0 50 163.5 51 132.5 52 114.5 53 91.0 54 66.0 55 52.0 56 41.5 57 30.0 58 19.5 59 14.0 60 12.5 61 11.5 62 9.0 63 4.0 64 3.0 65 3.0 66 2.5 67 1.5 68 1.0 69 1.5 70 1.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.305 40-44 0.67 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52261306532664 99.02499999999999 2 0.4522613065326633 0.8999999999999999 3 0.02512562814070352 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.25 0.0 0.0 0.0 0.0 102-103 0.2875 0.0 0.0 0.0 0.0 104-105 0.35 0.0 0.0 0.0 0.0 106-107 0.475 0.0 0.0 0.0 0.0 108-109 0.55 0.0 0.0 0.0 0.0 110-111 0.6 0.0 0.0 0.0 0.0 112-113 0.65 0.0 0.0 0.0 0.0 114-115 0.8375 0.0 0.0 0.0 0.0 116-117 1.0499999999999998 0.0 0.0 0.0 0.0 118-119 1.2125 0.0 0.0 0.0 0.0 120-121 1.4249999999999998 0.0 0.0 0.0 0.0 122-123 1.7374999999999998 0.0 0.0 0.0 0.0 124-125 1.9 0.0 0.0 0.0 0.0 126-127 2.1875 0.0 0.0 0.0 0.0 128-129 2.4125 0.0 0.0 0.0 0.0 130-131 2.7249999999999996 0.0 0.0 0.0 0.0 132-133 3.075 0.0 0.0 0.0 0.0 134-135 3.3875 0.0 0.0 0.0 0.0 136-137 3.675 0.0 0.0 0.0 0.0 138-139 4.0125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 801741 spots for SRR7171890.sra Written 801741 spots for SRR7171890.sra Read 801741 spots for SRR7171890.sra Written 801741 spots for SRR7171890.sra Read 801741 spots for SRR7171890.sra Written 801741 spots for SRR7171890.sra Read 801741 spots for SRR7171890.sra Written 801741 spots for SRR7171890.sra Read 801741 spots for SRR7171890.sra Written 801741 spots for SRR7171890.sra Read 801741 spots for SRR7171890.sra Written 801741 spots for SRR7171890.sra Read 801741 spots for SRR7171890.sra Written 801741 spots for SRR7171890.sra Read 801741 spots for SRR7171890.sra Written 801741 spots for SRR7171890.sra Read 801741 spots for SRR7171890.sra Written 801741 spots for SRR7171890.sra Read 801741 spots for SRR7171890.sra Written 801741 spots for SRR7171890.sra Read 801741 spots for SRR7171890.sra Written 801741 spots for SRR7171890.sra Read 801741 spots for SRR7171890.sra Written 801741 spots for SRR7171890.sra Read 801741 spots for SRR7171890.sra Written 801741 spots for SRR7171890.sra Read 801741 spots for SRR7171890.sra Written 801741 spots for SRR7171890.sra Read 801741 spots for SRR7171890.sra Written 801741 spots for SRR7171890.sra Read 801741 spots for SRR7171890.sra Written 801741 spots for SRR7171890.sra Read 801741 spots for SRR7171890.sra Written 801741 spots for SRR7171890.sra Read 801741 spots for SRR7171890.sra Written 801741 spots for SRR7171890.sra Read 801755 spots for SRR7171890.sra Written 801755 spots for SRR7171890.sra Read 801741 spots for SRR7171890.sra Written 801741 spots for SRR7171890.sra SRR ids: ['SRR7171890.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__7mky5qc SRR7171890.sra spots: 16034834 blocks: [[1, 801741], [801742, 1603482], [1603483, 2405223], [2405224, 3206964], [3206965, 4008705], [4008706, 4810446], [4810447, 5612187], [5612188, 6413928], [6413929, 7215669], [7215670, 8017410], [8017411, 8819151], [8819152, 9620892], [9620893, 10422633], [10422634, 11224374], [11224375, 12026115], [12026116, 12827856], [12827857, 13629597], [13629598, 14431338], [14431339, 15233079], [15233080, 16034834]] SRR7171890 file size 5411978 SRR7171890 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171890 SRR7171890_1.fastq SRR7171890_2.fastq Input file: SRR7171890_1.fastq Paired file: SRR7171890_2.fastq trimmed: SRR7171890-trimmed-pair1.fastq, SRR7171890-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 22:43:08 2025 >> started Thu Feb 13 22:43:26 2025 >> done (18.459s) 16034834 read pairs processed; of these: 14872 ( 0.09%) short read pairs filtered out after trimming by size control 8586 ( 0.05%) empty read pairs filtered out after trimming by size control 16011376 (99.85%) read pairs available; of these: 6587117 (41.14%) trimmed read pairs available after processing 9424259 (58.86%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 1 0.00% 21 8 0.00% 22 2 0.00% 23 5 0.00% 24 2 0.00% 25 7 0.00% 26 2 0.00% 27 7 0.00% 28 4 0.00% 29 5 0.00% 30 7 0.00% 31 4 0.00% 32 7 0.00% 33 3 0.00% 34 4 0.00% 35 5 0.00% 36 6 0.00% 37 3 0.00% 38 5 0.00% 39 3 0.00% 40 1 0.00% 41 8 0.00% 42 6 0.00% 43 8 0.00% 44 5 0.00% 45 12 0.00% 46 10 0.00% 47 11 0.00% 48 16 0.00% 49 17 0.00% 50 20 0.00% 51 23 0.00% 52 15 0.00% 53 18 0.00% 54 32 0.00% 55 25 0.00% 56 34 0.00% 57 37 0.00% 58 51 0.00% 59 54 0.00% 60 66 0.00% 61 72 0.00% 62 73 0.00% 63 80 0.00% 64 101 0.00% 65 114 0.00% 66 114 0.00% 67 124 0.00% 68 178 0.00% 69 205 0.00% 70 223 0.00% 71 238 0.00% 72 305 0.00% 73 324 0.00% 74 375 0.00% 75 431 0.00% 76 554 0.00% 77 517 0.00% 78 594 0.00% 79 625 0.00% 80 780 0.00% 81 833 0.01% 82 1060 0.01% 83 1171 0.01% 84 1885 0.01% 85 2516 0.02% 86 2737 0.02% 87 3335 0.02% 88 3362 0.02% 89 3478 0.02% 90 3539 0.02% 91 3828 0.02% 92 4080 0.03% 93 4239 0.03% 94 4577 0.03% 95 4939 0.03% 96 5119 0.03% 97 5595 0.03% 98 5804 0.04% 99 6359 0.04% 100 6737 0.04% 101 7462 0.05% 102 7929 0.05% 103 8420 0.05% 104 9005 0.06% 105 9703 0.06% 106 10443 0.07% 107 10838 0.07% 108 11500 0.07% 109 12064 0.08% 110 12918 0.08% 111 14051 0.09% 112 14523 0.09% 113 15457 0.10% 114 16491 0.10% 115 17598 0.11% 116 18420 0.12% 117 18913 0.12% 118 19510 0.12% 119 20434 0.13% 120 21444 0.13% 121 22498 0.14% 122 23634 0.15% 123 24916 0.16% 124 26360 0.16% 125 27341 0.17% 126 28418 0.18% 127 30482 0.19% 128 31224 0.20% 129 32621 0.20% 130 34382 0.21% 131 36026 0.23% 132 38314 0.24% 133 40491 0.25% 134 43270 0.27% 135 45702 0.29% 136 49676 0.31% 137 51736 0.32% 138 55237 0.34% 139 59760 0.37% 140 64192 0.40% 141 70959 0.44% 142 78851 0.49% 143 89078 0.56% 144 105097 0.66% 145 124769 0.78% 146 158224 0.99% 147 216673 1.35% 148 334644 2.09% 149 684751 4.28% 150 3598886 22.48% 151 9424259 58.86% 16011376 reads passed initial QC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=6.00 fanout-score-rank=14 prefix-density=0.60 prefix-fanout=3.3 sequence=TTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=92.17 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=7.6 sequence=CAACAAGAGGAGCGGGCCTAACCAGGCTAAAAACAGGGCAGTTAAACCAACATTAATACCACAACTATCTTAATTGCCACTGACTAGCAATAACAACACCCATTTCTAAAGAAAATATCTTATTCTGCAAATCTCAGACTCTTCTCCCTCGTTGTAAACAAGGAAGAGAAGTACTTGAGTTTGACATGTAGCAAATCAAAGTTTCTAGTGGTGCTTGTTTGCAACAGTGCACTGCTTTCTGATCTCACCCTTGGTACCGGTGAGTGGGTTGTTCTCAGAAAGAATGGTGATAGCCCTAGAAAACTCCTTAAAGAAGTAATCCTGACTCTTGGCCATTTTCTTCACGTAAGGCTTAGTTCTCTTGTCAGTGGCTAGTTGGTGATCCACTATCAACAAGCCCTTGTTGTCCAATATGTTTCTGTAGTAGTTGTTGTCTAGAACCATGGGTGTGCCTCTGTCATTCCTCACATATTGGACAGCTTTAGGGTCTGGGATTGAATCAGGGCACTTG criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=2.28 fanout-score-rank=33 prefix-density=0.41 prefix-fanout=2.2 sequence=GGCAGTGGCTGCAA criterion=fanout-score sequence-density=0.03 sequence-density-rank=33 fanout-score=89.62 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=15.3 sequence=AAGAAAAACAAAAAAGAAATGGATGCCAAAGCTCTCTTCTTCTTTGCCTTGTTGTCCTTCTCAGCTGTGTCGGTCAGGCCGGCATTAGCAGAAAATGAAGAAGACCCTGGTCTTGTTATGAACTTTTACAAGGATACATGCCCTCAAGCTGAGGACATTGTCAAAGAACAAGTTAGACTCCTTTACAAGAGACACAAAAACACTGCATTTTCTTGGCTAAGAAACATCTTCCATGACTGTGCTGTTCAGTCATGTGATGCTTCACTGCTGCTGGACTCAACAAGGAGGACCTTGTCCGAGAAGGAGACAGACAGGAGCTTTGGCCTCAGGAACTTTAGATACTTTGACGATATCAAAGAAGCTGTTGAAAGAGAGTGTCCTGGAGTCGTTTCCTGTGCTGATATTCTTGTCCTGTCTGCTAGAGATGGCATTGTTTCGCTAGGAGGACCTCATATCCCTCTCAAAACTGGAAG SRR7171890 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 22:44:31 Started mapping on | Feb 13 22:44:31 Finished on | Feb 13 22:46:10 Mapping speed, Million of reads per hour | 582.23 Number of input reads | 16011376 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 14264910 Uniquely mapped reads % | 89.09% Average mapped length | 288.38 Number of splices: Total | 13782642 Number of splices: Annotated (sjdb) | 13474816 Number of splices: GT/AG | 13548719 Number of splices: GC/AG | 180352 Number of splices: AT/AC | 12499 Number of splices: Non-canonical | 41072 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.67 Insertion rate per base | 0.02% Insertion average length | 2.67 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 361429 % of reads mapped to multiple loci | 2.26% Number of reads mapped to too many loci | 44963 % of reads mapped to too many loci | 0.28% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.31% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1401006 1401006 1401006 N_multimapping 361429 361429 361429 N_noFeature 402288 14133914 460296 N_ambiguous 195899 1412 121997 UnstrandedReadsAssigned:13666723 PositiveStrandReadsAssigned:129584 NegativeStrandReadsAssigned:13682617 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7171890 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171890-trimmed-pair1.fastq SRR7171890-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,011,376 reads, 14,292,855 reads pseudoaligned [quant] estimated average fragment length: 242.265 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,102 rounds 52401 SRR7171890.ke.tsv 34699 SRR7171890.se.tsv 87100 total ==> SRR7171890.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1776.73 1312 48.0813 Potri.005G024800.1.v4.1 1035 793.735 846 69.4 Potri.004G059700.1.v4.1 961 719.746 47 4.2519 Potri.007G009000.2.v4.1 1416 1174.73 2 0.110855 Potri.003G141000.2.v4.1 2943 2701.73 416 10.0257 Potri.016G087400.1.v4.1 270 76.8144 836 708.645 Potri.015G069301.1.v4.1 564 326.115 0 0 Potri.010G195200.1.v4.1 1773 1531.73 228 9.69206 Potri.012G127500.1.v4.1 977 735.735 21579 1909.74 ==> SRR7171890.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 185 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 406 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 369 SRR7171890 completed mapping pipeline successfully