Starting /dee2/code/volunteer_pipeline.sh SRR7171891 current disk space = 3089339826176 free memory = 1456165216 SRR7171891 SRAfilesize f392e8c7a69f4c4fd953286618014419 SRR7171891.sra SRR7171891.sra file validated SRR7171891 is paired end SRR7171891 is conventional basespace SRR7171891 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171891_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.77975 32.0 25.0 33.0 18.0 34.0 2 29.04 31.0 27.0 33.0 18.0 33.0 3 31.267 33.0 31.0 33.0 29.0 33.0 4 32.06925 33.0 31.0 33.0 31.0 33.0 5 32.49475 33.0 33.0 33.0 32.0 34.0 6 36.46475 38.0 36.0 38.0 34.0 38.0 7 37.1855 38.0 38.0 38.0 36.0 38.0 8 37.38875 38.0 38.0 38.0 37.0 38.0 9 37.5835 38.0 38.0 38.0 38.0 38.0 10-14 37.67185 38.0 38.0 38.0 38.0 38.0 15-19 37.665499999999994 38.0 38.0 38.0 38.0 38.0 20-24 37.6301 38.0 38.0 38.0 38.0 38.0 25-29 37.6346 38.0 38.0 38.0 38.0 38.0 30-34 37.59055 38.0 38.0 38.0 38.0 38.0 35-39 37.57005 38.0 38.0 38.0 38.0 38.0 40-44 37.5493 38.0 38.0 38.0 38.0 38.0 45-49 37.514649999999996 38.0 38.0 38.0 37.8 38.0 50-54 37.497499999999995 38.0 38.0 38.0 37.6 38.0 55-59 37.42705 38.0 38.0 38.0 37.0 38.0 60-64 37.37075 38.0 38.0 38.0 37.0 38.0 65-69 37.33174999999999 38.0 38.0 38.0 37.0 38.0 70-74 37.26835 38.0 38.0 38.0 37.0 38.0 75-79 37.2183 38.0 38.0 38.0 36.8 38.0 80-84 37.1599 38.0 38.0 38.0 36.4 38.0 85-89 37.125299999999996 38.0 38.0 38.0 36.0 38.0 90-94 36.970150000000004 38.0 38.0 38.0 36.0 38.0 95-99 36.95365 38.0 38.0 38.0 36.0 38.0 100-104 36.8332 38.0 38.0 38.0 35.2 38.0 105-109 36.697050000000004 38.0 38.0 38.0 34.8 38.0 110-114 36.62095000000001 38.0 38.0 38.0 34.8 38.0 115-119 36.47625 38.0 38.0 38.0 34.0 38.0 120-124 36.3729 38.0 38.0 38.0 34.0 38.0 125-129 36.165350000000004 38.0 38.0 38.0 34.0 38.0 130-134 35.928650000000005 38.0 37.2 38.0 33.2 38.0 135-139 35.67055 38.0 36.2 38.0 32.4 38.0 140-144 35.4049 38.0 36.0 38.0 31.4 38.0 145-149 34.91369999999999 38.0 35.8 38.0 30.6 38.0 150-151 32.025 36.5 32.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 0.0 14 1.0 15 1.0 16 1.0 17 2.0 18 4.0 19 1.0 20 2.0 21 4.0 22 2.0 23 7.0 24 5.0 25 8.0 26 13.0 27 18.0 28 20.0 29 25.0 30 24.0 31 28.0 32 45.0 33 62.0 34 90.0 35 200.0 36 627.0 37 2809.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.431971936857934 15.409671761463292 12.853921322976698 35.30443497870208 2 21.325 18.375 35.15 25.15 3 19.125 25.7 26.700000000000003 28.475 4 22.900000000000002 30.25 23.674999999999997 23.175 5 22.175 34.25 24.45 19.125 6 18.4 35.15 26.224999999999998 20.225 7 14.649999999999999 22.225 43.45 19.675 8 17.724999999999998 23.200000000000003 29.075 30.0 9 17.75 23.549999999999997 31.45 27.250000000000004 10-14 19.925 29.134999999999998 27.6 23.34 15-19 20.09 28.34 27.68 23.89 20-24 20.265 28.27 28.185 23.28 25-29 20.06 28.82 27.325 23.794999999999998 30-34 20.835 28.52 27.54 23.105 35-39 20.01 27.800000000000004 28.060000000000002 24.13 40-44 20.560000000000002 28.615000000000002 27.55 23.275000000000002 45-49 21.0 28.499999999999996 27.389999999999997 23.11 50-54 20.49 28.01 27.61 23.89 55-59 20.495 28.349999999999998 27.015 24.14 60-64 20.330000000000002 28.155 27.61 23.905 65-69 20.815 28.625 27.095000000000002 23.465 70-74 21.215 27.905 27.74 23.14 75-79 21.095 27.950000000000003 27.310000000000002 23.645 80-84 20.76 28.48 27.435 23.325000000000003 85-89 20.849999999999998 27.905 27.73 23.515 90-94 21.05 27.765 27.785 23.400000000000002 95-99 21.04 27.195000000000004 27.87 23.895 100-104 21.07 27.644999999999996 27.525 23.76 105-109 20.96 27.08 27.77 24.19 110-114 21.215 27.98 26.884999999999998 23.919999999999998 115-119 21.275 27.46 27.54 23.724999999999998 120-124 21.33 27.595 27.57 23.505000000000003 125-129 20.86 27.655 27.625 23.86 130-134 21.145 27.375 27.589999999999996 23.89 135-139 21.4 27.425 27.42 23.755000000000003 140-144 21.025 27.455000000000002 27.605 23.915 145-149 21.295 27.505000000000003 27.284999999999997 23.915 150-151 20.5625 29.262500000000003 26.650000000000002 23.525 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 1.0 18 0.5 19 0.0 20 0.5 21 1.0 22 1.0 23 2.0 24 3.0 25 4.0 26 6.0 27 7.0 28 9.0 29 15.0 30 20.5 31 21.5 32 24.5 33 33.0 34 44.0 35 55.0 36 87.0 37 107.5 38 129.0 39 167.5 40 190.5 41 215.0 42 242.0 43 261.0 44 268.5 45 270.5 46 259.0 47 245.5 48 233.5 49 206.5 50 174.5 51 148.5 52 115.5 53 83.5 54 71.5 55 58.5 56 46.5 57 41.0 58 29.5 59 22.0 60 17.5 61 13.0 62 9.0 63 9.0 64 8.5 65 5.0 66 4.0 67 3.5 68 3.0 69 2.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.2625 0.0 0.0 0.0 0.0 100-101 0.36250000000000004 0.0 0.0 0.0 0.0 102-103 0.475 0.0 0.0 0.0 0.0 104-105 0.6 0.0 0.0 0.0 0.0 106-107 0.6375 0.0 0.0 0.0 0.0 108-109 0.7 0.0 0.0 0.0 0.0 110-111 0.7875000000000001 0.0 0.0 0.0 0.0 112-113 0.8999999999999999 0.0 0.0 0.0 0.0 114-115 1.0375 0.0 0.0 0.0 0.0 116-117 1.1749999999999998 0.0 0.0 0.0 0.0 118-119 1.2875 0.0 0.0 0.0 0.0 120-121 1.4125 0.0 0.0 0.0 0.0 122-123 1.6 0.0 0.0 0.0 0.0 124-125 1.8375 0.0 0.0 0.0 0.0 126-127 1.95 0.0 0.0 0.0 0.0 128-129 2.1625 0.0 0.0 0.0 0.0 130-131 2.375 0.0 0.0 0.0 0.0 132-133 2.675 0.0 0.0 0.0 0.0 134-135 2.8625 0.0 0.0 0.0 0.0 136-137 3.0875 0.0 0.0 0.0 0.0 138-139 3.3375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7171891 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171891_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.98 33.0 33.0 34.0 32.0 34.0 2 33.11875 34.0 33.0 34.0 32.0 34.0 3 33.15925 34.0 33.0 34.0 33.0 34.0 4 33.13825 34.0 33.0 34.0 33.0 34.0 5 33.1305 34.0 33.0 34.0 33.0 34.0 6 37.34325 38.0 38.0 38.0 37.0 38.0 7 37.28525 38.0 38.0 38.0 37.0 38.0 8 37.205 38.0 38.0 38.0 37.0 38.0 9 37.236 38.0 38.0 38.0 37.0 38.0 10-14 37.247 38.0 38.0 38.0 37.0 38.0 15-19 37.21105 38.0 38.0 38.0 37.0 38.0 20-24 37.2577 38.0 38.0 38.0 37.0 38.0 25-29 37.1951 38.0 38.0 38.0 37.0 38.0 30-34 37.17695 38.0 38.0 38.0 37.0 38.0 35-39 36.9956 38.0 38.0 38.0 36.6 38.0 40-44 36.78455 38.0 38.0 38.0 36.0 38.0 45-49 37.017849999999996 38.0 38.0 38.0 36.0 38.0 50-54 36.99900000000001 38.0 38.0 38.0 36.0 38.0 55-59 36.933299999999996 38.0 38.0 38.0 36.0 38.0 60-64 36.91755 38.0 38.0 38.0 36.0 38.0 65-69 36.86835 38.0 38.0 38.0 36.0 38.0 70-74 36.7294 38.0 38.0 38.0 35.2 38.0 75-79 36.70264999999999 38.0 38.0 38.0 35.0 38.0 80-84 36.6052 38.0 38.0 38.0 34.8 38.0 85-89 36.46775 38.0 38.0 38.0 34.2 38.0 90-94 36.3651 38.0 38.0 38.0 34.0 38.0 95-99 36.246249999999996 38.0 38.0 38.0 34.0 38.0 100-104 36.10315 38.0 38.0 38.0 33.4 38.0 105-109 35.93365 38.0 37.4 38.0 32.8 38.0 110-114 35.691500000000005 38.0 37.0 38.0 31.4 38.0 115-119 35.53185 38.0 37.0 38.0 31.2 38.0 120-124 35.35875 38.0 36.4 38.0 29.6 38.0 125-129 35.08515 38.0 36.0 38.0 28.4 38.0 130-134 34.7288 38.0 35.2 38.0 27.6 38.0 135-139 34.43755 38.0 35.0 38.0 26.4 38.0 140-144 34.04540000000001 38.0 35.0 38.0 23.4 38.0 145-149 33.411150000000006 38.0 34.6 38.0 20.0 38.0 150-151 29.955 36.5 29.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 2.0 4 1.0 5 0.0 6 0.0 7 3.0 8 3.0 9 0.0 10 2.0 11 2.0 12 2.0 13 2.0 14 2.0 15 3.0 16 3.0 17 2.0 18 3.0 19 6.0 20 8.0 21 11.0 22 7.0 23 11.0 24 11.0 25 19.0 26 15.0 27 29.0 28 29.0 29 34.0 30 28.0 31 47.0 32 67.0 33 85.0 34 177.0 35 261.0 36 664.0 37 2454.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.875 15.75 17.675 27.700000000000003 2 24.875 23.525 33.525 18.075 3 20.5 26.650000000000002 30.85 22.0 4 24.925 34.325 21.25 19.5 5 23.575 35.525 22.875 18.025 6 19.950000000000003 37.55 23.599999999999998 18.9 7 19.25 18.224999999999998 39.324999999999996 23.200000000000003 8 20.525 23.200000000000003 28.025 28.249999999999996 9 22.85 24.65 28.225 24.275 10-14 23.445 28.88 25.775 21.9 15-19 22.975 27.534999999999997 27.905 21.584999999999997 20-24 23.01 27.96 27.325 21.705 25-29 23.28 28.605000000000004 27.245 20.87 30-34 22.7 28.21 26.965 22.125 35-39 23.70823718270292 27.791712651750778 27.229858533159423 21.270191632386876 40-44 23.717045683236062 27.837593077077884 26.8565103642584 21.58885087542765 45-49 23.505000000000003 27.839999999999996 27.41 21.245 50-54 23.32 27.815 27.315 21.55 55-59 23.415 28.115000000000002 27.485 20.985 60-64 23.34 27.555000000000003 27.725 21.38 65-69 23.78 27.54 27.43 21.25 70-74 23.72 28.04 27.29 20.95 75-79 24.01 27.435 27.134999999999998 21.42 80-84 23.905 26.729999999999997 28.13 21.235 85-89 23.580000000000002 28.01 27.215 21.195 90-94 23.465 27.71 26.945000000000004 21.88 95-99 23.735 28.249999999999996 27.125 20.89 100-104 24.19 27.79 27.205000000000002 20.815 105-109 23.865 27.295 27.73 21.11 110-114 23.775 27.72 27.205000000000002 21.3 115-119 23.66 27.54 28.105000000000004 20.695 120-124 23.56 28.349999999999998 27.525 20.565 125-129 23.985 28.095 27.175 20.745 130-134 24.47 27.900000000000002 27.075 20.555 135-139 23.68 27.750000000000004 27.82 20.75 140-144 23.465 28.78 27.565 20.19 145-149 24.39 27.85 27.229999999999997 20.53 150-151 25.124999999999996 27.462500000000002 27.1125 20.3 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.0 24 2.0 25 2.5 26 1.0 27 3.0 28 6.0 29 8.0 30 8.5 31 11.5 32 19.5 33 24.5 34 29.0 35 40.5 36 60.5 37 79.0 38 123.0 39 170.5 40 189.5 41 214.0 42 255.0 43 282.5 44 277.0 45 269.0 46 278.5 47 272.0 48 240.5 49 217.0 50 182.0 51 140.0 52 113.5 53 94.5 54 86.5 55 70.0 56 47.5 57 41.5 58 36.0 59 28.0 60 18.0 61 12.0 62 11.0 63 6.0 64 3.0 65 4.0 66 7.0 67 5.0 68 1.0 69 1.0 70 1.5 71 1.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 1.0 80 1.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.33 40-44 0.62 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49698189134809 98.9 2 0.4275653923541248 0.8500000000000001 3 0.05030181086519115 0.15 4 0.025150905432595575 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.2375 0.0 0.0 0.0 0.0 100-101 0.3375 0.0 0.0 0.0 0.0 102-103 0.44999999999999996 0.0 0.0 0.0 0.0 104-105 0.55 0.0 0.0 0.0 0.0 106-107 0.5874999999999999 0.0 0.0 0.0 0.0 108-109 0.65 0.0 0.0 0.0 0.0 110-111 0.7375 0.0 0.0 0.0 0.0 112-113 0.8500000000000001 0.0 0.0 0.0 0.0 114-115 0.9875 0.0 0.0 0.0 0.0 116-117 1.15 0.0 0.0 0.0 0.0 118-119 1.2625 0.0 0.0 0.0 0.0 120-121 1.375 0.0 0.0 0.0 0.0 122-123 1.55 0.0 0.0 0.0 0.0 124-125 1.7875 0.0 0.0 0.0 0.0 126-127 1.9125 0.0 0.0 0.0 0.0 128-129 2.1375 0.0 0.0 0.0 0.0 130-131 2.35 0.0 0.0 0.0 0.0 132-133 2.6625 0.0 0.0 0.0 0.0 134-135 2.8375 0.0 0.0 0.0 0.0 136-137 3.0625 0.0 0.0 0.0 0.0 138-139 3.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 568612 spots for SRR7171891.sra Written 568612 spots for SRR7171891.sra Read 568612 spots for SRR7171891.sra Written 568612 spots for SRR7171891.sra Read 568612 spots for SRR7171891.sra Written 568612 spots for SRR7171891.sra Read 568612 spots for SRR7171891.sra Written 568612 spots for SRR7171891.sra Read 568612 spots for SRR7171891.sra Written 568612 spots for SRR7171891.sra Read 568612 spots for SRR7171891.sra Written 568612 spots for SRR7171891.sra Read 568612 spots for SRR7171891.sra Written 568612 spots for SRR7171891.sra Read 568612 spots for SRR7171891.sra Written 568612 spots for SRR7171891.sra Read 568612 spots for SRR7171891.sra Written 568612 spots for SRR7171891.sra Read 568612 spots for SRR7171891.sra Written 568612 spots for SRR7171891.sra Read 568612 spots for SRR7171891.sra Written 568612 spots for SRR7171891.sra Read 568612 spots for SRR7171891.sra Written 568612 spots for SRR7171891.sra Read 568612 spots for SRR7171891.sra Written 568612 spots for SRR7171891.sra Read 568612 spots for SRR7171891.sra Written 568612 spots for SRR7171891.sra Read 568612 spots for SRR7171891.sra Written 568612 spots for SRR7171891.sra Read 568612 spots for SRR7171891.sra Written 568612 spots for SRR7171891.sra Read 568612 spots for SRR7171891.sra Written 568612 spots for SRR7171891.sra Read 568612 spots for SRR7171891.sra Written 568612 spots for SRR7171891.sra Read 568630 spots for SRR7171891.sra Written 568630 spots for SRR7171891.sra Read 568612 spots for SRR7171891.sra Written 568612 spots for SRR7171891.sra SRR ids: ['SRR7171891.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9j2275ba SRR7171891.sra spots: 11372258 blocks: [[1, 568612], [568613, 1137224], [1137225, 1705836], [1705837, 2274448], [2274449, 2843060], [2843061, 3411672], [3411673, 3980284], [3980285, 4548896], [4548897, 5117508], [5117509, 5686120], [5686121, 6254732], [6254733, 6823344], [6823345, 7391956], [7391957, 7960568], [7960569, 8529180], [8529181, 9097792], [9097793, 9666404], [9666405, 10235016], [10235017, 10803628], [10803629, 11372258]] SRR7171891 file size 3831984 SRR7171891 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171891 SRR7171891_1.fastq SRR7171891_2.fastq Input file: SRR7171891_1.fastq Paired file: SRR7171891_2.fastq trimmed: SRR7171891-trimmed-pair1.fastq, SRR7171891-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 22:59:59 2025 >> started Thu Feb 13 23:00:13 2025 >> done (13.203s) 11372258 read pairs processed; of these: 17034 ( 0.15%) short read pairs filtered out after trimming by size control 11654 ( 0.10%) empty read pairs filtered out after trimming by size control 11343570 (99.75%) read pairs available; of these: 4504830 (39.71%) trimmed read pairs available after processing 6838740 (60.29%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 4 0.00% 21 4 0.00% 22 8 0.00% 23 4 0.00% 24 5 0.00% 25 4 0.00% 26 6 0.00% 27 6 0.00% 28 4 0.00% 29 6 0.00% 30 4 0.00% 31 5 0.00% 32 3 0.00% 33 3 0.00% 34 7 0.00% 35 6 0.00% 36 1 0.00% 37 4 0.00% 38 2 0.00% 39 4 0.00% 40 5 0.00% 41 8 0.00% 42 6 0.00% 43 5 0.00% 44 7 0.00% 45 13 0.00% 46 8 0.00% 47 6 0.00% 48 13 0.00% 49 13 0.00% 50 14 0.00% 51 19 0.00% 52 20 0.00% 53 25 0.00% 54 35 0.00% 55 24 0.00% 56 32 0.00% 57 36 0.00% 58 35 0.00% 59 46 0.00% 60 46 0.00% 61 63 0.00% 62 51 0.00% 63 68 0.00% 64 62 0.00% 65 77 0.00% 66 101 0.00% 67 86 0.00% 68 110 0.00% 69 117 0.00% 70 128 0.00% 71 169 0.00% 72 177 0.00% 73 206 0.00% 74 243 0.00% 75 286 0.00% 76 326 0.00% 77 389 0.00% 78 365 0.00% 79 429 0.00% 80 512 0.00% 81 548 0.00% 82 686 0.01% 83 825 0.01% 84 1544 0.01% 85 2146 0.02% 86 2232 0.02% 87 2662 0.02% 88 2705 0.02% 89 2712 0.02% 90 2783 0.02% 91 2888 0.03% 92 2900 0.03% 93 3197 0.03% 94 3257 0.03% 95 3388 0.03% 96 3564 0.03% 97 3838 0.03% 98 3999 0.04% 99 4158 0.04% 100 4548 0.04% 101 4907 0.04% 102 5250 0.05% 103 5531 0.05% 104 5813 0.05% 105 6258 0.06% 106 6609 0.06% 107 7075 0.06% 108 7510 0.07% 109 7783 0.07% 110 8436 0.07% 111 9286 0.08% 112 9381 0.08% 113 10298 0.09% 114 10946 0.10% 115 11499 0.10% 116 12047 0.11% 117 12311 0.11% 118 13022 0.11% 119 13532 0.12% 120 14244 0.13% 121 14980 0.13% 122 15857 0.14% 123 16495 0.15% 124 17720 0.16% 125 18226 0.16% 126 19195 0.17% 127 20284 0.18% 128 20763 0.18% 129 22383 0.20% 130 23035 0.20% 131 24842 0.22% 132 26396 0.23% 133 27712 0.24% 134 29246 0.26% 135 31438 0.28% 136 33302 0.29% 137 35336 0.31% 138 38192 0.34% 139 41105 0.36% 140 45114 0.40% 141 48888 0.43% 142 54286 0.48% 143 61386 0.54% 144 72143 0.64% 145 83862 0.74% 146 107684 0.95% 147 144688 1.28% 148 222614 1.96% 149 452905 3.99% 150 2493961 21.99% 151 6838740 60.29% 11343570 reads passed initial QC criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=4.95 fanout-score-rank=10 prefix-density=0.59 prefix-fanout=3.3 sequence=TCCACACTTGCAGCCATTCTCAGCACCA criterion=fanout-score sequence-density=0.12 sequence-density-rank=22 fanout-score=13.55 fanout-score-rank=1 prefix-density=0.53 prefix-fanout=3.0 sequence=CACACTTGCAGTCAGAGCCACAGCTACAGCCAGACATTTTCTGCAGGTAAAATAGGATAAAGGGGCCTGGAAAGCTTTTGCTTAGAAACTGAATTTGCTCAAGCT criterion=sequence-density sequence-density=0.66 sequence-density-rank=1 fanout-score=2.52 fanout-score-rank=29 prefix-density=0.67 prefix-fanout=2.5 sequence=ATGTACCCTGAC criterion=fanout-score sequence-density=0.12 sequence-density-rank=26 fanout-score=25.88 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=9.7 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7171891 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 23:01:00 Started mapping on | Feb 13 23:01:01 Finished on | Feb 13 23:03:34 Mapping speed, Million of reads per hour | 266.91 Number of input reads | 11343570 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 10038104 Uniquely mapped reads % | 88.49% Average mapped length | 296.49 Number of splices: Total | 9711169 Number of splices: Annotated (sjdb) | 9493275 Number of splices: GT/AG | 9542001 Number of splices: GC/AG | 130057 Number of splices: AT/AC | 9404 Number of splices: Non-canonical | 29707 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.65 Insertion rate per base | 0.02% Insertion average length | 2.65 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 272816 % of reads mapped to multiple loci | 2.41% Number of reads mapped to too many loci | 37985 % of reads mapped to too many loci | 0.33% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.66% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1047573 1047573 1047573 N_multimapping 272816 272816 272816 N_noFeature 281299 9944483 324172 N_ambiguous 112479 502 61603 UnstrandedReadsAssigned:9644326 PositiveStrandReadsAssigned:93119 NegativeStrandReadsAssigned:9652329 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7171891 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171891-trimmed-pair1.fastq SRR7171891-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,343,570 reads, 9,545,763 reads pseudoaligned [quant] estimated average fragment length: 255.053 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,062 rounds 52401 SRR7171891.ke.tsv 34699 SRR7171891.se.tsv 87100 total ==> SRR7171891.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1763.95 1044 54.3805 Potri.005G024800.1.v4.1 1035 780.947 796 93.6526 Potri.004G059700.1.v4.1 961 706.98 6 0.779781 Potri.007G009000.2.v4.1 1416 1161.95 0 0 Potri.003G141000.2.v4.1 2943 2688.95 382.227 13.0607 Potri.016G087400.1.v4.1 270 69.4751 432.489 571.971 Potri.015G069301.1.v4.1 564 313.828 0 0 Potri.010G195200.1.v4.1 1773 1518.95 605 36.5966 Potri.012G127500.1.v4.1 977 722.963 27385 3480.36 ==> SRR7171891.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 42 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 355 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 372 SRR7171891 completed mapping pipeline successfully