Starting /dee2/code/volunteer_pipeline.sh SRR7171892 current disk space = 3089318387712 free memory = 1461732780 SRR7171892 SRAfilesize b07714b02dd55133b6b39eacf8aca32f SRR7171892.sra SRR7171892.sra file validated SRR7171892 is paired end SRR7171892 is conventional basespace SRR7171892 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171892_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.22425 25.0 18.0 33.0 18.0 33.0 2 27.61975 29.0 25.0 31.0 18.0 33.0 3 28.17875 29.0 27.0 31.0 18.0 33.0 4 31.327 33.0 31.0 33.0 29.0 33.0 5 32.1315 33.0 32.0 33.0 31.0 33.0 6 36.622 38.0 37.0 38.0 34.0 38.0 7 37.29325 38.0 38.0 38.0 36.0 38.0 8 37.45375 38.0 38.0 38.0 37.0 38.0 9 37.546 38.0 38.0 38.0 37.0 38.0 10-14 37.5363 38.0 38.0 38.0 37.4 38.0 15-19 37.5498 38.0 38.0 38.0 37.8 38.0 20-24 37.50025 38.0 38.0 38.0 37.4 38.0 25-29 37.46775 38.0 38.0 38.0 37.0 38.0 30-34 37.4442 38.0 38.0 38.0 37.0 38.0 35-39 37.4146 38.0 38.0 38.0 37.0 38.0 40-44 37.3925 38.0 38.0 38.0 37.0 38.0 45-49 37.32465 38.0 38.0 38.0 37.0 38.0 50-54 37.250550000000004 38.0 38.0 38.0 36.4 38.0 55-59 37.197250000000004 38.0 38.0 38.0 36.0 38.0 60-64 37.158249999999995 38.0 38.0 38.0 36.2 38.0 65-69 37.05965 38.0 38.0 38.0 36.0 38.0 70-74 37.027 38.0 38.0 38.0 36.0 38.0 75-79 36.969500000000004 38.0 38.0 38.0 36.0 38.0 80-84 36.8942 38.0 38.0 38.0 35.4 38.0 85-89 36.7934 38.0 38.0 38.0 35.2 38.0 90-94 36.611450000000005 38.0 38.0 38.0 34.4 38.0 95-99 36.56615 38.0 38.0 38.0 34.2 38.0 100-104 36.4678 38.0 38.0 38.0 34.0 38.0 105-109 36.340999999999994 38.0 37.8 38.0 34.0 38.0 110-114 36.2093 38.0 37.4 38.0 33.8 38.0 115-119 36.04705 38.0 37.0 38.0 33.4 38.0 120-124 35.8899 38.0 37.0 38.0 33.0 38.0 125-129 35.6957 38.0 36.4 38.0 32.2 38.0 130-134 35.34055 38.0 36.0 38.0 30.4 38.0 135-139 35.0612 38.0 35.6 38.0 29.0 38.0 140-144 34.5871 38.0 35.0 38.0 27.4 38.0 145-149 34.1462 38.0 35.0 38.0 25.0 38.0 150-151 31.043374999999997 36.5 31.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 1.0 14 5.0 15 2.0 16 1.0 17 1.0 18 2.0 19 3.0 20 5.0 21 5.0 22 7.0 23 6.0 24 8.0 25 9.0 26 10.0 27 12.0 28 21.0 29 26.0 30 36.0 31 42.0 32 75.0 33 99.0 34 158.0 35 279.0 36 895.0 37 2290.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.81981981981982 11.386386386386386 11.31131131131131 32.48248248248248 2 22.025 16.05 36.625 25.3 3 19.5 22.175 29.125 29.2 4 23.200000000000003 30.349999999999998 23.65 22.8 5 23.1 31.825 25.6 19.475 6 19.85 33.550000000000004 24.9 21.7 7 14.499999999999998 24.05 42.725 18.725 8 18.05 23.599999999999998 30.925000000000004 27.425 9 17.349999999999998 24.099999999999998 33.1 25.45 10-14 19.7 29.830000000000002 27.089999999999996 23.380000000000003 15-19 19.89 28.4 27.605 24.104999999999997 20-24 19.805 28.76 28.1 23.335 25-29 19.965 27.99 28.435 23.61 30-34 20.075000000000003 28.310000000000002 28.244999999999997 23.369999999999997 35-39 20.23 28.425 27.57 23.775 40-44 20.375 28.325 27.88 23.419999999999998 45-49 20.05 28.115000000000002 27.845 23.990000000000002 50-54 20.34 28.68 27.445000000000004 23.535 55-59 20.880000000000003 28.01 28.03 23.080000000000002 60-64 19.845 28.165000000000003 28.050000000000004 23.94 65-69 20.155 28.565 27.96 23.32 70-74 20.48 28.055000000000003 27.55 23.915 75-79 20.45 28.060000000000002 27.565 23.925 80-84 20.45 28.294999999999998 27.29 23.965 85-89 21.349999999999998 27.42 27.85 23.380000000000003 90-94 20.695 28.23 27.665 23.41 95-99 21.02 27.255000000000003 28.23 23.494999999999997 100-104 20.815 28.035 27.32 23.830000000000002 105-109 20.455000000000002 27.889999999999997 27.744999999999997 23.91 110-114 20.965 27.650000000000002 27.794999999999998 23.59 115-119 20.215 27.495000000000005 28.74 23.549999999999997 120-124 20.455000000000002 27.705000000000002 27.88 23.96 125-129 20.995 27.755000000000003 27.589999999999996 23.66 130-134 20.87 27.189999999999998 28.134999999999998 23.805 135-139 20.495 27.985 27.425 24.095 140-144 21.17 27.665 27.41 23.755000000000003 145-149 20.755000000000003 28.115000000000002 26.924999999999997 24.205 150-151 20.9875 27.437499999999996 27.462500000000002 24.1125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 1.0 17 0.5 18 0.0 19 2.0 20 2.0 21 1.0 22 1.0 23 1.5 24 4.0 25 5.5 26 7.0 27 10.0 28 10.5 29 12.5 30 18.5 31 27.0 32 34.5 33 42.0 34 50.0 35 64.5 36 85.0 37 101.0 38 110.5 39 146.5 40 192.0 41 195.0 42 225.0 43 251.5 44 271.5 45 292.5 46 275.5 47 259.5 48 237.0 49 202.5 50 173.0 51 158.5 52 132.0 53 99.0 54 68.5 55 50.5 56 46.5 57 37.5 58 26.0 59 16.5 60 10.5 61 9.0 62 7.5 63 4.5 64 3.0 65 2.0 66 2.5 67 3.0 68 2.0 69 2.0 70 2.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72410333584149 99.4 2 0.2257336343115124 0.44999999999999996 3 0.05016302984700275 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.2375 0.0 0.0 0.0 0.0 104-105 0.275 0.0 0.0 0.0 0.0 106-107 0.3125 0.0 0.0 0.0 0.0 108-109 0.3625 0.0 0.0 0.0 0.0 110-111 0.4625 0.0 0.0 0.0 0.0 112-113 0.5375000000000001 0.0 0.0 0.0 0.0 114-115 0.675 0.0 0.0 0.0 0.0 116-117 0.8125 0.0 0.0 0.0 0.0 118-119 1.0125 0.0 0.0 0.0 0.0 120-121 1.175 0.0 0.0 0.0 0.0 122-123 1.3125 0.0 0.0 0.0 0.0 124-125 1.4249999999999998 0.0 0.0 0.0 0.0 126-127 1.55 0.0 0.0 0.0 0.0 128-129 1.75 0.0 0.0 0.0 0.0 130-131 1.875 0.0 0.0 0.0 0.0 132-133 2.075 0.0 0.0 0.0 0.0 134-135 2.3 0.0 0.0 0.0 0.0 136-137 2.525 0.0 0.0 0.0 0.0 138-139 2.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7171892 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171892_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.949 33.0 33.0 34.0 32.0 34.0 2 33.0395 33.0 33.0 34.0 32.0 34.0 3 33.099 34.0 33.0 34.0 32.0 34.0 4 33.0625 34.0 33.0 34.0 33.0 34.0 5 32.9945 34.0 33.0 34.0 32.0 34.0 6 37.17225 38.0 38.0 38.0 37.0 38.0 7 37.1845 38.0 38.0 38.0 37.0 38.0 8 37.061 38.0 38.0 38.0 37.0 38.0 9 37.1555 38.0 38.0 38.0 37.0 38.0 10-14 37.15435 38.0 38.0 38.0 37.0 38.0 15-19 37.1006 38.0 38.0 38.0 36.8 38.0 20-24 37.0945 38.0 38.0 38.0 36.8 38.0 25-29 37.12165 38.0 38.0 38.0 37.0 38.0 30-34 37.03915 38.0 38.0 38.0 36.2 38.0 35-39 36.8583 38.0 38.0 38.0 36.4 38.0 40-44 36.569050000000004 38.0 38.0 38.0 35.4 38.0 45-49 36.929500000000004 38.0 38.0 38.0 36.0 38.0 50-54 36.8709 38.0 38.0 38.0 36.0 38.0 55-59 36.8519 38.0 38.0 38.0 36.0 38.0 60-64 36.818299999999994 38.0 38.0 38.0 35.8 38.0 65-69 36.74575 38.0 38.0 38.0 35.4 38.0 70-74 36.6639 38.0 38.0 38.0 35.0 38.0 75-79 36.6564 38.0 38.0 38.0 35.0 38.0 80-84 36.5887 38.0 38.0 38.0 34.6 38.0 85-89 36.4138 38.0 38.0 38.0 34.0 38.0 90-94 36.333600000000004 38.0 38.0 38.0 34.0 38.0 95-99 36.2902 38.0 38.0 38.0 34.0 38.0 100-104 36.1342 38.0 37.8 38.0 34.0 38.0 105-109 35.989 38.0 37.2 38.0 33.2 38.0 110-114 35.75685 38.0 37.0 38.0 32.0 38.0 115-119 35.601150000000004 38.0 37.0 38.0 31.0 38.0 120-124 35.44685 38.0 36.0 38.0 31.0 38.0 125-129 35.2151 38.0 36.0 38.0 29.0 38.0 130-134 34.8789 38.0 35.2 38.0 28.0 38.0 135-139 34.598 38.0 35.0 38.0 27.0 38.0 140-144 34.23925 38.0 35.0 38.0 24.8 38.0 145-149 33.565400000000004 38.0 34.6 38.0 20.2 38.0 150-151 30.33525 36.5 29.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 3.0 4 4.0 5 4.0 6 1.0 7 2.0 8 1.0 9 1.0 10 0.0 11 1.0 12 0.0 13 1.0 14 3.0 15 3.0 16 6.0 17 4.0 18 1.0 19 1.0 20 7.0 21 5.0 22 5.0 23 8.0 24 17.0 25 11.0 26 17.0 27 27.0 28 20.0 29 39.0 30 44.0 31 53.0 32 68.0 33 103.0 34 146.0 35 284.0 36 739.0 37 2365.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.699999999999996 20.025000000000002 15.5 23.775 2 25.724999999999998 24.875 31.45 17.95 3 20.95 28.749999999999996 30.5 19.8 4 23.75 34.300000000000004 22.95 19.0 5 24.15 36.475 22.15 17.224999999999998 6 19.525000000000002 36.875 24.025 19.575 7 19.05 20.349999999999998 39.675 20.925 8 22.2 23.799999999999997 27.450000000000003 26.55 9 22.0 25.674999999999997 28.000000000000004 24.325 10-14 23.06 29.32 26.31 21.310000000000002 15-19 22.905 28.389999999999997 27.83 20.875 20-24 23.115 28.43 27.694999999999997 20.76 25-29 22.855 28.455000000000002 27.48 21.21 30-34 23.77 27.66 27.62 20.95 35-39 23.532958199356912 28.200361736334408 27.406551446945336 20.860128617363344 40-44 23.383838383838384 28.055555555555557 27.656565656565657 20.904040404040405 45-49 23.515 27.889999999999997 27.445000000000004 21.15 50-54 23.59 28.175 27.49 20.745 55-59 23.810000000000002 27.935 27.089999999999996 21.165 60-64 22.98 28.49 27.505000000000003 21.025 65-69 23.89 28.050000000000004 27.49 20.57 70-74 24.115000000000002 27.29 27.48 21.115000000000002 75-79 23.945 27.744999999999997 27.534999999999997 20.775 80-84 24.23 28.025 26.745 21.0 85-89 23.855 27.955000000000002 26.825 21.365000000000002 90-94 24.07 28.48 26.695 20.755000000000003 95-99 24.005000000000003 28.044999999999998 26.955000000000002 20.995 100-104 23.849999999999998 28.084999999999997 27.595 20.47 105-109 24.12 28.335 26.924999999999997 20.62 110-114 24.585 28.09 26.555 20.77 115-119 23.62 28.810000000000002 27.04 20.53 120-124 24.310000000000002 28.43 26.665 20.595 125-129 23.830000000000002 28.58 27.295 20.294999999999998 130-134 23.895 28.015 26.63 21.46 135-139 24.09 28.23 26.745 20.935000000000002 140-144 24.14 28.54 27.325 19.994999999999997 145-149 24.165 28.134999999999998 26.919999999999998 20.78 150-151 24.7375 27.250000000000004 27.037499999999998 20.974999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 2.0 15 1.5 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.5 23 1.0 24 1.0 25 1.0 26 2.0 27 3.5 28 5.5 29 7.5 30 8.5 31 14.0 32 18.0 33 26.0 34 35.0 35 50.0 36 62.0 37 82.0 38 118.0 39 151.5 40 195.5 41 227.5 42 252.5 43 274.5 44 288.5 45 295.5 46 284.0 47 273.5 48 259.0 49 230.0 50 187.5 51 148.0 52 123.5 53 95.5 54 77.0 55 53.5 56 35.0 57 26.5 58 19.5 59 19.0 60 10.5 61 7.0 62 5.5 63 3.5 64 3.5 65 3.0 66 3.5 67 2.5 68 0.5 69 0.0 70 1.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.48 40-44 1.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54762503141494 99.02499999999999 2 0.3769791404875597 0.75 3 0.07539582809751194 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.21250000000000002 0.0 0.0 0.0 0.0 104-105 0.25 0.0 0.0 0.0 0.0 106-107 0.2875 0.0 0.0 0.0 0.0 108-109 0.3625 0.0 0.0 0.0 0.0 110-111 0.4625 0.0 0.0 0.0 0.0 112-113 0.5375000000000001 0.0 0.0 0.0 0.0 114-115 0.675 0.0 0.0 0.0 0.0 116-117 0.825 0.0 0.0 0.0 0.0 118-119 1.0125 0.0 0.0 0.0 0.0 120-121 1.175 0.0 0.0 0.0 0.0 122-123 1.3125 0.0 0.0 0.0 0.0 124-125 1.4375 0.0 0.0 0.0 0.0 126-127 1.575 0.0 0.0 0.0 0.0 128-129 1.75 0.0 0.0 0.0 0.0 130-131 1.875 0.0 0.0 0.0 0.0 132-133 2.0375 0.0 0.0 0.0 0.0 134-135 2.3125 0.0 0.0 0.0 0.0 136-137 2.5625 0.0 0.0 0.0 0.0 138-139 2.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACATTGA 20 3.6149065E-4 108.54375 4 >>END_MODULE Read 869513 spots for SRR7171892.sra Written 869513 spots for SRR7171892.sra Read 869513 spots for SRR7171892.sra Written 869513 spots for SRR7171892.sra Read 869513 spots for SRR7171892.sra Written 869513 spots for SRR7171892.sra Read 869513 spots for SRR7171892.sra Written 869513 spots for SRR7171892.sra Read 869513 spots for SRR7171892.sra Written 869513 spots for SRR7171892.sra Read 869513 spots for SRR7171892.sra Written 869513 spots for SRR7171892.sra Read 869513 spots for SRR7171892.sra Written 869513 spots for SRR7171892.sra Read 869513 spots for SRR7171892.sra Written 869513 spots for SRR7171892.sra Read 869513 spots for SRR7171892.sra Written 869513 spots for SRR7171892.sra Read 869513 spots for SRR7171892.sra Written 869513 spots for SRR7171892.sra Read 869513 spots for SRR7171892.sra Written 869513 spots for SRR7171892.sra Read 869513 spots for SRR7171892.sra Written 869513 spots for SRR7171892.sra Read 869513 spots for SRR7171892.sra Written 869513 spots for SRR7171892.sra Read 869513 spots for SRR7171892.sra Written 869513 spots for SRR7171892.sra Read 869513 spots for SRR7171892.sra Written 869513 spots for SRR7171892.sra Read 869513 spots for SRR7171892.sra Written 869513 spots for SRR7171892.sra Read 869513 spots for SRR7171892.sra Written 869513 spots for SRR7171892.sra Read 869513 spots for SRR7171892.sra Written 869513 spots for SRR7171892.sra Read 869525 spots for SRR7171892.sra Written 869525 spots for SRR7171892.sra Read 869513 spots for SRR7171892.sra Written 869513 spots for SRR7171892.sra SRR ids: ['SRR7171892.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_sl1slp_d SRR7171892.sra spots: 17390272 blocks: [[1, 869513], [869514, 1739026], [1739027, 2608539], [2608540, 3478052], [3478053, 4347565], [4347566, 5217078], [5217079, 6086591], [6086592, 6956104], [6956105, 7825617], [7825618, 8695130], [8695131, 9564643], [9564644, 10434156], [10434157, 11303669], [11303670, 12173182], [12173183, 13042695], [13042696, 13912208], [13912209, 14781721], [14781722, 15651234], [15651235, 16520747], [16520748, 17390272]] SRR7171892 file size 5871292 SRR7171892 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171892 SRR7171892_1.fastq SRR7171892_2.fastq Input file: SRR7171892_1.fastq Paired file: SRR7171892_2.fastq trimmed: SRR7171892-trimmed-pair1.fastq, SRR7171892-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 23:12:29 2025 >> started Thu Feb 13 23:12:50 2025 >> done (21.426s) 17390272 read pairs processed; of these: 26545 ( 0.15%) short read pairs filtered out after trimming by size control 16713 ( 0.10%) empty read pairs filtered out after trimming by size control 17347014 (99.75%) read pairs available; of these: 7169527 (41.33%) trimmed read pairs available after processing 10177487 (58.67%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 4 0.00% 20 4 0.00% 21 7 0.00% 22 10 0.00% 23 9 0.00% 24 19 0.00% 25 12 0.00% 26 8 0.00% 27 7 0.00% 28 6 0.00% 29 5 0.00% 30 3 0.00% 31 4 0.00% 32 9 0.00% 33 5 0.00% 34 9 0.00% 35 7 0.00% 36 14 0.00% 37 7 0.00% 38 9 0.00% 39 7 0.00% 40 5 0.00% 41 7 0.00% 42 9 0.00% 43 12 0.00% 44 14 0.00% 45 10 0.00% 46 18 0.00% 47 11 0.00% 48 26 0.00% 49 19 0.00% 50 25 0.00% 51 31 0.00% 52 47 0.00% 53 42 0.00% 54 57 0.00% 55 51 0.00% 56 56 0.00% 57 78 0.00% 58 60 0.00% 59 70 0.00% 60 96 0.00% 61 110 0.00% 62 108 0.00% 63 87 0.00% 64 127 0.00% 65 139 0.00% 66 141 0.00% 67 137 0.00% 68 200 0.00% 69 203 0.00% 70 226 0.00% 71 265 0.00% 72 315 0.00% 73 324 0.00% 74 350 0.00% 75 438 0.00% 76 550 0.00% 77 540 0.00% 78 572 0.00% 79 660 0.00% 80 719 0.00% 81 839 0.00% 82 972 0.01% 83 1130 0.01% 84 2395 0.01% 85 3184 0.02% 86 3381 0.02% 87 3908 0.02% 88 3999 0.02% 89 3986 0.02% 90 4108 0.02% 91 4145 0.02% 92 4408 0.03% 93 4290 0.02% 94 4718 0.03% 95 4909 0.03% 96 4983 0.03% 97 5273 0.03% 98 5625 0.03% 99 5958 0.03% 100 6063 0.03% 101 6714 0.04% 102 7199 0.04% 103 7680 0.04% 104 8039 0.05% 105 8789 0.05% 106 9418 0.05% 107 9830 0.06% 108 10054 0.06% 109 10794 0.06% 110 11531 0.07% 111 12623 0.07% 112 13011 0.08% 113 13559 0.08% 114 14693 0.08% 115 15606 0.09% 116 16123 0.09% 117 16581 0.10% 118 17223 0.10% 119 18136 0.10% 120 19001 0.11% 121 19801 0.11% 122 20843 0.12% 123 21845 0.13% 124 23330 0.13% 125 24178 0.14% 126 25632 0.15% 127 27129 0.16% 128 28106 0.16% 129 29298 0.17% 130 31102 0.18% 131 32792 0.19% 132 34923 0.20% 133 37261 0.21% 134 40239 0.23% 135 43059 0.25% 136 45999 0.27% 137 49311 0.28% 138 53402 0.31% 139 58031 0.33% 140 63413 0.37% 141 70294 0.41% 142 79806 0.46% 143 91987 0.53% 144 110029 0.63% 145 133713 0.77% 146 174870 1.01% 147 243415 1.40% 148 385888 2.22% 149 802113 4.62% 150 4035717 23.26% 151 10177487 58.67% 17347014 reads passed initial QC criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=31 prefix-density=0.50 prefix-fanout=2.0 sequence=CAGGTGCAGTTTGATCCACA criterion=fanout-score sequence-density=0.11 sequence-density-rank=26 fanout-score=30.04 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=9.8 sequence=CTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCAT criterion=sequence-density sequence-density=0.65 sequence-density-rank=1 fanout-score=2.22 fanout-score-rank=27 prefix-density=0.67 prefix-fanout=2.2 sequence=ATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=165.31 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=12.2 sequence=TTTCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCCTTCGATGATGAGAACAAGATCATAACTCTTAATGGTTTGGAAGGAGATGTCATGAAAATTTACAAGGTCTATAGGCCCGTCTGGCAGCTTACACCAAAAGGCTCGGGCTGCTTGGCAAAACTGACCATTGAATACGAAAAACTCCATCCTGAAGTCCCGGTTCCAGAGATTTATGTTGATCTTATGGTT SRR7171892 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 23:14:10 Started mapping on | Feb 13 23:14:11 Finished on | Feb 13 23:16:37 Mapping speed, Million of reads per hour | 427.73 Number of input reads | 17347014 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 15909779 Uniquely mapped reads % | 91.71% Average mapped length | 296.80 Number of splices: Total | 15847871 Number of splices: Annotated (sjdb) | 15571243 Number of splices: GT/AG | 15599180 Number of splices: GC/AG | 195185 Number of splices: AT/AC | 12957 Number of splices: Non-canonical | 40549 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.65 Insertion rate per base | 0.02% Insertion average length | 2.58 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 463952 % of reads mapped to multiple loci | 2.67% Number of reads mapped to too many loci | 49033 % of reads mapped to too many loci | 0.28% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.24% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1000672 1000672 1000672 N_multimapping 463952 463952 463952 N_noFeature 333513 15731080 427452 N_ambiguous 171737 1401 85949 UnstrandedReadsAssigned:15404529 PositiveStrandReadsAssigned:177298 NegativeStrandReadsAssigned:15396378 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7171892 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171892-trimmed-pair1.fastq SRR7171892-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,347,014 reads, 15,244,710 reads pseudoaligned [quant] estimated average fragment length: 268.252 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,136 rounds 52401 SRR7171892.ke.tsv 34699 SRR7171892.se.tsv 87100 total ==> SRR7171892.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1750.75 1325 43.4074 Potri.005G024800.1.v4.1 1035 767.748 347 25.9228 Potri.004G059700.1.v4.1 961 693.805 34 2.81069 Potri.007G009000.2.v4.1 1416 1148.75 0 0 Potri.003G141000.2.v4.1 2943 2675.75 655 14.04 Potri.016G087400.1.v4.1 270 66.3213 1149 993.662 Potri.015G069301.1.v4.1 564 302.285 0 0 Potri.010G195200.1.v4.1 1773 1505.75 400 15.2363 Potri.012G127500.1.v4.1 977 709.769 3145 254.141 ==> SRR7171892.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 70 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 591 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 307 SRR7171892 completed mapping pipeline successfully