Starting /dee2/code/volunteer_pipeline.sh SRR7171893 current disk space = 3089320947712 free memory = 1464049236 SRR7171893 SRAfilesize 1ab6ab2adaf1809972726d10ae3f774d SRR7171893.sra SRR7171893.sra file validated SRR7171893 is paired end SRR7171893 is conventional basespace SRR7171893 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171893_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.414 33.0 33.0 33.0 32.0 34.0 2 31.1835 33.0 31.0 33.0 27.0 34.0 3 32.3895 33.0 33.0 34.0 31.0 34.0 4 32.19225 33.0 33.0 33.0 31.0 34.0 5 32.3425 33.0 33.0 33.0 31.0 34.0 6 35.939 37.0 36.0 38.0 32.0 38.0 7 36.275 38.0 36.0 38.0 33.0 38.0 8 36.9925 38.0 38.0 38.0 35.0 38.0 9 37.2645 38.0 38.0 38.0 36.0 38.0 10-14 37.378 38.0 38.0 38.0 36.8 38.0 15-19 37.39825 38.0 38.0 38.0 37.0 38.0 20-24 37.42555 38.0 38.0 38.0 37.0 38.0 25-29 37.371300000000005 38.0 38.0 38.0 37.0 38.0 30-34 37.342999999999996 38.0 38.0 38.0 37.0 38.0 35-39 37.358000000000004 38.0 38.0 38.0 37.0 38.0 40-44 37.329 38.0 38.0 38.0 37.0 38.0 45-49 37.249750000000006 38.0 38.0 38.0 37.0 38.0 50-54 37.24015 38.0 38.0 38.0 36.6 38.0 55-59 37.231399999999994 38.0 38.0 38.0 36.6 38.0 60-64 37.1808 38.0 38.0 38.0 36.2 38.0 65-69 37.08255 38.0 38.0 38.0 36.0 38.0 70-74 37.019549999999995 38.0 38.0 38.0 36.0 38.0 75-79 37.03275 38.0 38.0 38.0 36.0 38.0 80-84 36.9787 38.0 38.0 38.0 36.0 38.0 85-89 36.895050000000005 38.0 38.0 38.0 35.2 38.0 90-94 36.83265 38.0 38.0 38.0 35.0 38.0 95-99 36.682950000000005 38.0 38.0 38.0 34.4 38.0 100-104 36.60435 38.0 38.0 38.0 34.0 38.0 105-109 36.49955 38.0 38.0 38.0 34.0 38.0 110-114 36.2815 38.0 37.2 38.0 34.0 38.0 115-119 36.19715 38.0 37.0 38.0 33.6 38.0 120-124 36.1101 38.0 37.0 38.0 33.0 38.0 125-129 35.925349999999995 38.0 36.8 38.0 32.6 38.0 130-134 35.6128 38.0 36.0 38.0 31.0 38.0 135-139 35.429500000000004 38.0 36.0 38.0 31.0 38.0 140-144 35.0642 38.0 35.6 38.0 28.8 38.0 145-149 34.66625 38.0 35.0 38.0 28.0 38.0 150-151 31.782999999999998 36.5 32.0 38.0 13.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 2.0 17 0.0 18 1.0 19 3.0 20 3.0 21 2.0 22 0.0 23 7.0 24 10.0 25 3.0 26 17.0 27 20.0 28 27.0 29 31.0 30 45.0 31 50.0 32 61.0 33 79.0 34 134.0 35 271.0 36 686.0 37 2546.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.375 15.675 7.675 32.275 2 21.875 18.6 34.050000000000004 25.474999999999998 3 18.5 28.875 24.7 27.925 4 24.7 33.15 22.2 19.950000000000003 5 23.375 33.95 23.875 18.8 6 18.4 35.675000000000004 25.650000000000002 20.275000000000002 7 14.099999999999998 22.825 43.675000000000004 19.400000000000002 8 18.675 22.775000000000002 30.275000000000002 28.275 9 17.65 24.25 31.825 26.275 10-14 19.27 30.06 26.905 23.765 15-19 19.825 28.535 27.975 23.665 20-24 19.925 28.645 27.725 23.705000000000002 25-29 20.54 28.910000000000004 27.345000000000002 23.205000000000002 30-34 19.925 28.970000000000002 27.58 23.525 35-39 20.135 28.794999999999998 27.38 23.69 40-44 20.435 28.4 27.35 23.815 45-49 20.064999999999998 28.349999999999998 27.655 23.93 50-54 20.26 28.48 27.91 23.35 55-59 20.23 28.155 27.384999999999998 24.23 60-64 20.18 28.794999999999998 27.79 23.235 65-69 20.424999999999997 28.560000000000002 27.384999999999998 23.630000000000003 70-74 20.525 28.42 27.884999999999998 23.169999999999998 75-79 20.535 28.139999999999997 27.445000000000004 23.880000000000003 80-84 20.200000000000003 28.265 27.560000000000002 23.974999999999998 85-89 20.369999999999997 28.199999999999996 27.575 23.855 90-94 20.47 28.060000000000002 27.525 23.945 95-99 20.62 27.939999999999998 27.6 23.84 100-104 20.65 28.4 27.485 23.465 105-109 20.735 28.139999999999997 27.6 23.525 110-114 20.485 27.560000000000002 27.92 24.035 115-119 20.525 28.449999999999996 27.189999999999998 23.835 120-124 21.075 27.57 28.050000000000004 23.305 125-129 20.549999999999997 27.975 27.67 23.805 130-134 21.025 28.015 27.195000000000004 23.765 135-139 21.165 27.455000000000002 27.66 23.72 140-144 20.31 28.15 27.650000000000002 23.89 145-149 21.37 27.810000000000002 27.215 23.605 150-151 20.825 27.750000000000004 27.675 23.75 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 2.0 25 5.0 26 6.0 27 5.5 28 6.0 29 9.0 30 13.5 31 21.5 32 32.5 33 37.5 34 45.5 35 65.0 36 85.5 37 102.5 38 127.5 39 147.5 40 182.5 41 228.5 42 260.5 43 271.0 44 277.0 45 290.0 46 276.5 47 255.0 48 241.0 49 213.0 50 172.5 51 151.5 52 133.5 53 96.5 54 64.5 55 46.5 56 34.5 57 27.5 58 19.0 59 12.5 60 10.5 61 6.5 62 4.5 63 4.0 64 2.5 65 2.0 66 1.5 67 0.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.1375 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.2375 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.3125 0.0 0.0 0.0 0.0 106-107 0.45 0.0 0.0 0.0 0.0 108-109 0.5125 0.0 0.0 0.0 0.0 110-111 0.6 0.0 0.0 0.0 0.0 112-113 0.7375 0.0125 0.0 0.0 0.0 114-115 0.925 0.025 0.0 0.0 0.0 116-117 1.0750000000000002 0.025 0.0 0.0 0.0 118-119 1.1875 0.025 0.0 0.0 0.0 120-121 1.3250000000000002 0.025 0.0 0.0 0.0 122-123 1.5375 0.025 0.0 0.0 0.0 124-125 1.6625 0.025 0.0 0.0 0.0 126-127 1.775 0.025 0.0 0.0 0.0 128-129 1.9375 0.025 0.0 0.0 0.0 130-131 2.1625 0.025 0.0 0.0 0.0 132-133 2.3499999999999996 0.025 0.0 0.0 0.0 134-135 2.6875 0.025 0.0 0.0 0.0 136-137 2.9875 0.025 0.0 0.0 0.0 138-139 3.2625 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTGCAA 10 0.006830828 145.0 7 >>END_MODULE SRR7171893 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171893_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.827 33.0 33.0 34.0 32.0 34.0 2 32.9455 33.0 33.0 34.0 32.0 34.0 3 32.9725 34.0 33.0 34.0 32.0 34.0 4 32.96275 34.0 33.0 34.0 32.0 34.0 5 32.84875 34.0 33.0 34.0 32.0 34.0 6 37.0735 38.0 38.0 38.0 36.0 38.0 7 37.01575 38.0 38.0 38.0 36.0 38.0 8 37.12675 38.0 38.0 38.0 37.0 38.0 9 37.02275 38.0 38.0 38.0 37.0 38.0 10-14 37.0041 38.0 38.0 38.0 36.2 38.0 15-19 37.0221 38.0 38.0 38.0 36.4 38.0 20-24 36.98565 38.0 38.0 38.0 36.0 38.0 25-29 36.8712 38.0 38.0 38.0 36.0 38.0 30-34 36.8523 38.0 38.0 38.0 35.8 38.0 35-39 36.573899999999995 38.0 38.0 38.0 35.2 38.0 40-44 36.263 38.0 38.0 38.0 34.4 38.0 45-49 36.702600000000004 38.0 38.0 38.0 35.4 38.0 50-54 36.76825 38.0 38.0 38.0 35.6 38.0 55-59 36.7821 38.0 38.0 38.0 35.8 38.0 60-64 36.713899999999995 38.0 38.0 38.0 35.2 38.0 65-69 36.607350000000004 38.0 38.0 38.0 34.8 38.0 70-74 36.564099999999996 38.0 38.0 38.0 34.2 38.0 75-79 36.49255000000001 38.0 38.0 38.0 34.2 38.0 80-84 36.49995 38.0 38.0 38.0 34.0 38.0 85-89 36.3014 38.0 38.0 38.0 33.8 38.0 90-94 36.209599999999995 38.0 38.0 38.0 33.8 38.0 95-99 36.0882 38.0 37.8 38.0 33.0 38.0 100-104 35.979699999999994 38.0 37.4 38.0 32.8 38.0 105-109 35.814 38.0 37.0 38.0 32.8 38.0 110-114 35.6819 38.0 37.0 38.0 31.4 38.0 115-119 35.59235 38.0 37.0 38.0 31.2 38.0 120-124 35.318 38.0 36.4 38.0 29.8 38.0 125-129 35.059900000000006 38.0 36.0 38.0 28.4 38.0 130-134 34.58685 38.0 35.0 38.0 26.8 38.0 135-139 34.34475 38.0 35.0 38.0 24.8 38.0 140-144 34.00385 38.0 35.0 38.0 23.0 38.0 145-149 33.3498 38.0 34.4 38.0 18.6 38.0 150-151 30.048375 36.5 28.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 3.0 4 3.0 5 1.0 6 1.0 7 1.0 8 0.0 9 1.0 10 0.0 11 1.0 12 1.0 13 3.0 14 6.0 15 2.0 16 2.0 17 4.0 18 7.0 19 6.0 20 6.0 21 11.0 22 9.0 23 9.0 24 16.0 25 18.0 26 21.0 27 29.0 28 31.0 29 35.0 30 48.0 31 52.0 32 79.0 33 120.0 34 177.0 35 277.0 36 725.0 37 2288.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.9 20.974999999999998 13.450000000000001 22.675 2 25.45 24.375 32.625 17.549999999999997 3 21.375 26.825 31.4 20.4 4 23.25 34.65 22.775000000000002 19.325 5 23.474999999999998 36.775000000000006 21.625 18.125 6 20.25 35.449999999999996 24.349999999999998 19.950000000000003 7 19.125 18.675 41.125 21.075 8 21.125 23.425 27.400000000000002 28.050000000000004 9 21.8 23.974999999999998 29.425 24.8 10-14 23.005 28.725 26.745 21.525 15-19 23.005 27.565 27.715 21.715 20-24 22.86 27.82 27.605 21.715 25-29 22.98 28.32 27.975 20.724999999999998 30-34 23.37486863834259 28.364109493069105 27.288194965720862 20.972826902867435 35-39 23.851501108200683 27.846060850292165 27.498488817247633 20.803949224259522 40-44 23.488537228646784 27.27733820247515 27.91641306553053 21.317711503347535 45-49 23.419999999999998 28.075 27.515 20.990000000000002 50-54 23.24 27.845 27.675 21.240000000000002 55-59 23.955000000000002 28.345 27.125 20.575 60-64 23.9 28.185 27.36 20.555 65-69 23.415 27.055 28.494999999999997 21.035 70-74 23.785 27.815 27.589999999999996 20.810000000000002 75-79 23.380000000000003 27.865000000000002 27.439999999999998 21.315 80-84 23.445 27.52 27.950000000000003 21.085 85-89 24.990000000000002 27.08 27.839999999999996 20.09 90-94 23.835 28.01 27.435 20.72 95-99 23.494999999999997 28.305000000000003 27.33 20.87 100-104 24.169999999999998 27.77 27.150000000000002 20.91 105-109 23.54 27.935 27.85 20.674999999999997 110-114 23.330000000000002 28.605000000000004 27.465 20.599999999999998 115-119 23.985 28.015 27.415 20.585 120-124 24.025 27.950000000000003 27.61 20.415 125-129 24.01 28.155 27.18 20.655 130-134 24.465 27.529999999999998 27.195000000000004 20.810000000000002 135-139 24.279999999999998 27.715 28.1 19.905 140-144 24.975 27.925 26.88 20.22 145-149 24.175 27.765 27.465 20.595 150-151 24.65 27.8375 27.700000000000003 19.8125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.0 23 0.5 24 0.5 25 3.5 26 4.5 27 2.5 28 5.0 29 6.5 30 6.0 31 10.5 32 18.5 33 25.0 34 32.0 35 46.5 36 68.0 37 90.0 38 118.0 39 151.5 40 205.0 41 236.5 42 250.5 43 286.0 44 286.0 45 290.5 46 301.5 47 276.0 48 242.0 49 215.0 50 177.5 51 139.5 52 121.5 53 101.0 54 81.0 55 58.5 56 37.0 57 29.5 58 22.0 59 14.5 60 9.5 61 4.5 62 2.5 63 5.0 64 6.5 65 2.5 66 0.0 67 0.5 68 1.5 69 1.0 70 0.0 71 0.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.08499999999999999 35-39 0.74 40-44 1.4200000000000002 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.1375 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.2375 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.3125 0.0 0.0 0.0 0.0 106-107 0.4625 0.0 0.0 0.0 0.0 108-109 0.5375000000000001 0.0 0.0 0.0 0.0 110-111 0.625 0.0 0.0 0.0 0.0 112-113 0.7625 0.0 0.0 0.0 0.0 114-115 0.95 0.0 0.0 0.0 0.0 116-117 1.1 0.0 0.0 0.0 0.0 118-119 1.2125 0.0 0.0 0.0 0.0 120-121 1.35 0.0 0.0 0.0 0.0 122-123 1.5499999999999998 0.0 0.0 0.0 0.0 124-125 1.65 0.0 0.0 0.0 0.0 126-127 1.725 0.0 0.0 0.0 0.0 128-129 1.9 0.0 0.0 0.0 0.0 130-131 2.1375 0.0 0.0 0.0 0.0 132-133 2.325 0.0 0.0 0.0 0.0 134-135 2.6625 0.0 0.0 0.0 0.0 136-137 2.9375 0.0 0.0 0.0 0.0 138-139 3.1875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AACCCAG 10 0.0068502324 144.8625 5 GGAGGAC 10 0.0068502324 144.8625 1 >>END_MODULE Read 717765 spots for SRR7171893.sra Written 717765 spots for SRR7171893.sra Read 717765 spots for SRR7171893.sra Written 717765 spots for SRR7171893.sra Read 717765 spots for SRR7171893.sra Written 717765 spots for SRR7171893.sra Read 717765 spots for SRR7171893.sra Written 717765 spots for SRR7171893.sra Read 717765 spots for SRR7171893.sra Written 717765 spots for SRR7171893.sra Read 717765 spots for SRR7171893.sra Written 717765 spots for SRR7171893.sra Read 717765 spots for SRR7171893.sra Written 717765 spots for SRR7171893.sra Read 717765 spots for SRR7171893.sra Written 717765 spots for SRR7171893.sra Read 717765 spots for SRR7171893.sra Written 717765 spots for SRR7171893.sra Read 717765 spots for SRR7171893.sra Written 717765 spots for SRR7171893.sra Read 717765 spots for SRR7171893.sra Written 717765 spots for SRR7171893.sra Read 717765 spots for SRR7171893.sra Written 717765 spots for SRR7171893.sra Read 717765 spots for SRR7171893.sra Written 717765 spots for SRR7171893.sra Read 717765 spots for SRR7171893.sra Written 717765 spots for SRR7171893.sra Read 717765 spots for SRR7171893.sra Written 717765 spots for SRR7171893.sra Read 717765 spots for SRR7171893.sra Written 717765 spots for SRR7171893.sra Read 717765 spots for SRR7171893.sra Written 717765 spots for SRR7171893.sra Read 717780 spots for SRR7171893.sra Written 717780 spots for SRR7171893.sra Read 717765 spots for SRR7171893.sra Written 717765 spots for SRR7171893.sra Read 717765 spots for SRR7171893.sra Written 717765 spots for SRR7171893.sra SRR ids: ['SRR7171893.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5qz51lw5 SRR7171893.sra spots: 14355315 blocks: [[1, 717765], [717766, 1435530], [1435531, 2153295], [2153296, 2871060], [2871061, 3588825], [3588826, 4306590], [4306591, 5024355], [5024356, 5742120], [5742121, 6459885], [6459886, 7177650], [7177651, 7895415], [7895416, 8613180], [8613181, 9330945], [9330946, 10048710], [10048711, 10766475], [10766476, 11484240], [11484241, 12202005], [12202006, 12919770], [12919771, 13637535], [13637536, 14355315]] SRR7171893 file size 4842844 SRR7171893 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171893 SRR7171893_1.fastq SRR7171893_2.fastq Input file: SRR7171893_1.fastq Paired file: SRR7171893_2.fastq trimmed: SRR7171893-trimmed-pair1.fastq, SRR7171893-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 23:12:10 2025 >> started Thu Feb 13 23:12:27 2025 >> done (16.778s) 14355315 read pairs processed; of these: 16172 ( 0.11%) short read pairs filtered out after trimming by size control 10889 ( 0.08%) empty read pairs filtered out after trimming by size control 14328254 (99.81%) read pairs available; of these: 5624907 (39.26%) trimmed read pairs available after processing 8703347 (60.74%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 4 0.00% 20 4 0.00% 21 4 0.00% 22 3 0.00% 23 4 0.00% 24 3 0.00% 25 6 0.00% 26 9 0.00% 27 9 0.00% 28 7 0.00% 29 7 0.00% 30 2 0.00% 31 6 0.00% 32 4 0.00% 33 5 0.00% 34 8 0.00% 35 5 0.00% 36 4 0.00% 37 7 0.00% 38 12 0.00% 39 3 0.00% 40 8 0.00% 41 7 0.00% 42 7 0.00% 43 6 0.00% 44 7 0.00% 45 18 0.00% 46 12 0.00% 47 18 0.00% 48 14 0.00% 49 17 0.00% 50 26 0.00% 51 20 0.00% 52 29 0.00% 53 25 0.00% 54 23 0.00% 55 38 0.00% 56 36 0.00% 57 41 0.00% 58 25 0.00% 59 60 0.00% 60 64 0.00% 61 80 0.00% 62 61 0.00% 63 95 0.00% 64 102 0.00% 65 101 0.00% 66 110 0.00% 67 154 0.00% 68 134 0.00% 69 175 0.00% 70 203 0.00% 71 224 0.00% 72 271 0.00% 73 330 0.00% 74 349 0.00% 75 354 0.00% 76 490 0.00% 77 507 0.00% 78 487 0.00% 79 591 0.00% 80 703 0.00% 81 785 0.01% 82 922 0.01% 83 1075 0.01% 84 1818 0.01% 85 2360 0.02% 86 2620 0.02% 87 3238 0.02% 88 3132 0.02% 89 2980 0.02% 90 3254 0.02% 91 3295 0.02% 92 3569 0.02% 93 3826 0.03% 94 3903 0.03% 95 4090 0.03% 96 4398 0.03% 97 4635 0.03% 98 4758 0.03% 99 5139 0.04% 100 5388 0.04% 101 5556 0.04% 102 6115 0.04% 103 6612 0.05% 104 7077 0.05% 105 7468 0.05% 106 7859 0.05% 107 8267 0.06% 108 8578 0.06% 109 9146 0.06% 110 9731 0.07% 111 10621 0.07% 112 10993 0.08% 113 11495 0.08% 114 12325 0.09% 115 12955 0.09% 116 13632 0.10% 117 14098 0.10% 118 14419 0.10% 119 15174 0.11% 120 16096 0.11% 121 16998 0.12% 122 17401 0.12% 123 18746 0.13% 124 19838 0.14% 125 20534 0.14% 126 22073 0.15% 127 23326 0.16% 128 23726 0.17% 129 25253 0.18% 130 26504 0.18% 131 28062 0.20% 132 30011 0.21% 133 31980 0.22% 134 34627 0.24% 135 36952 0.26% 136 39915 0.28% 137 42449 0.30% 138 45422 0.32% 139 49768 0.35% 140 53907 0.38% 141 60073 0.42% 142 67457 0.47% 143 77243 0.54% 144 91437 0.64% 145 109597 0.76% 146 139665 0.97% 147 191672 1.34% 148 297434 2.08% 149 606909 4.24% 150 3096386 21.61% 151 8703347 60.74% 14328254 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=6.48 fanout-score-rank=11 prefix-density=0.30 prefix-fanout=3.8 sequence=TCCTTGTCCTGGATCTTGGCCTT criterion=fanout-score sequence-density=0.05 sequence-density-rank=30 fanout-score=43.95 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=7.4 sequence=CAAGAACAAAGATCATGCCACCAAAGGCCCAAGCGAT criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=4.57 fanout-score-rank=23 prefix-density=0.43 prefix-fanout=3.3 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.03 sequence-density-rank=33 fanout-score=68.73 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=10.8 sequence=TGGTGATGCAGTGCCTTGGTGCCATATGCGGTGCTGGTGTGGTGAAAGGATTTTACGGGAAAACAAACTACGAGTTGCATAATGGTGGTGCCAATATGGTCGCTCATGGTTACACCAAAGGTGATGGCCTTGGTGCTGAGATTGTTGGCACTTTTATTCTTGTCTAC SRR7171893 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 23:13:55 Started mapping on | Feb 13 23:13:55 Finished on | Feb 13 23:15:41 Mapping speed, Million of reads per hour | 486.62 Number of input reads | 14328254 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 13419961 Uniquely mapped reads % | 93.66% Average mapped length | 296.74 Number of splices: Total | 13980845 Number of splices: Annotated (sjdb) | 13765103 Number of splices: GT/AG | 13769876 Number of splices: GC/AG | 171918 Number of splices: AT/AC | 10499 Number of splices: Non-canonical | 28552 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.47 Insertion rate per base | 0.02% Insertion average length | 2.57 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 372801 % of reads mapped to multiple loci | 2.60% Number of reads mapped to too many loci | 36007 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.42% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 551969 551969 551969 N_multimapping 372801 372801 372801 N_noFeature 248932 13285671 313613 N_ambiguous 140117 720 70106 UnstrandedReadsAssigned:13030912 PositiveStrandReadsAssigned:133570 NegativeStrandReadsAssigned:13036242 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7171893 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171893-trimmed-pair1.fastq SRR7171893-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,328,254 reads, 12,917,499 reads pseudoaligned [quant] estimated average fragment length: 266.582 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,161 rounds 52401 SRR7171893.ke.tsv 34699 SRR7171893.se.tsv 87100 total ==> SRR7171893.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1752.42 798 32.7854 Potri.005G024800.1.v4.1 1035 769.418 346 32.3765 Potri.004G059700.1.v4.1 961 695.424 17 1.76001 Potri.007G009000.2.v4.1 1416 1150.42 0 0 Potri.003G141000.2.v4.1 2943 2677.42 448 12.047 Potri.016G087400.1.v4.1 270 67.266 1032 1104.59 Potri.015G069301.1.v4.1 564 303.707 0 0 Potri.010G195200.1.v4.1 1773 1507.42 215 10.2688 Potri.012G127500.1.v4.1 977 711.418 1554 157.268 ==> SRR7171893.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 56 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 323 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 77 SRR7171893 completed mapping pipeline successfully