Starting /dee2/code/volunteer_pipeline.sh SRR7171894 current disk space = 3089321947136 free memory = 1448983508 SRR7171894 SRAfilesize e899a72a2541b4242edae54b106fcfc8 SRR7171894.sra SRR7171894.sra file validated SRR7171894 is paired end SRR7171894 is conventional basespace SRR7171894 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171894_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.99875 32.0 18.0 33.0 18.0 33.0 2 29.55025 31.0 29.0 33.0 25.0 33.0 3 31.398 32.0 32.0 33.0 27.0 33.0 4 31.2235 32.0 32.0 33.0 27.0 33.0 5 32.50675 33.0 33.0 33.0 32.0 34.0 6 35.7125 37.0 35.0 38.0 31.0 38.0 7 37.1415 38.0 37.0 38.0 36.0 38.0 8 37.45125 38.0 38.0 38.0 37.0 38.0 9 37.649 38.0 38.0 38.0 38.0 38.0 10-14 37.61305 38.0 38.0 38.0 38.0 38.0 15-19 37.58875 38.0 38.0 38.0 37.8 38.0 20-24 37.58225 38.0 38.0 38.0 37.8 38.0 25-29 37.59035 38.0 38.0 38.0 38.0 38.0 30-34 37.541199999999996 38.0 38.0 38.0 38.0 38.0 35-39 37.536 38.0 38.0 38.0 37.4 38.0 40-44 37.47915 38.0 38.0 38.0 37.2 38.0 45-49 37.47255 38.0 38.0 38.0 37.0 38.0 50-54 37.42295 38.0 38.0 38.0 37.0 38.0 55-59 37.38125 38.0 38.0 38.0 37.0 38.0 60-64 37.355900000000005 38.0 38.0 38.0 37.0 38.0 65-69 37.2863 38.0 38.0 38.0 36.4 38.0 70-74 37.18125 38.0 38.0 38.0 36.0 38.0 75-79 37.13365 38.0 38.0 38.0 36.0 38.0 80-84 37.10365 38.0 38.0 38.0 36.0 38.0 85-89 36.97695 38.0 38.0 38.0 36.0 38.0 90-94 36.937400000000004 38.0 38.0 38.0 35.4 38.0 95-99 36.8458 38.0 38.0 38.0 35.0 38.0 100-104 36.78575 38.0 38.0 38.0 35.0 38.0 105-109 36.585350000000005 38.0 38.0 38.0 34.2 38.0 110-114 36.50905 38.0 37.8 38.0 34.0 38.0 115-119 36.2131 38.0 37.2 38.0 33.4 38.0 120-124 36.154399999999995 38.0 37.0 38.0 33.2 38.0 125-129 36.02225 38.0 37.0 38.0 33.0 38.0 130-134 35.7207 38.0 36.0 38.0 31.4 38.0 135-139 35.54795 38.0 36.0 38.0 31.0 38.0 140-144 35.28314999999999 38.0 35.8 38.0 31.0 38.0 145-149 34.7067 38.0 35.0 38.0 28.0 38.0 150-151 31.706875 36.5 31.5 38.0 14.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 2.0 16 0.0 17 3.0 18 3.0 19 1.0 20 2.0 21 0.0 22 1.0 23 3.0 24 6.0 25 3.0 26 11.0 27 13.0 28 12.0 29 23.0 30 20.0 31 38.0 32 63.0 33 97.0 34 148.0 35 250.0 36 776.0 37 2524.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.525 12.625 12.65 36.199999999999996 2 21.205301325331334 18.504626156539132 37.43435858964741 22.85571392848212 3 19.25 25.7 27.224999999999998 27.825 4 23.025000000000002 32.824999999999996 22.475 21.675 5 20.525 36.775000000000006 23.775 18.925 6 16.1 39.074999999999996 24.925 19.900000000000002 7 13.575000000000001 21.825 44.25 20.349999999999998 8 17.4 22.725 31.225 28.65 9 19.225 21.349999999999998 33.800000000000004 25.624999999999996 10-14 19.655 29.445 26.86 24.04 15-19 20.52 28.52 27.389999999999997 23.57 20-24 20.560000000000002 28.345 27.935 23.16 25-29 20.064999999999998 28.360000000000003 27.779999999999998 23.794999999999998 30-34 20.380000000000003 28.18 28.1 23.34 35-39 20.25 28.57 27.43 23.75 40-44 20.175 28.675 27.72 23.43 45-49 20.294999999999998 28.54 27.889999999999997 23.275000000000002 50-54 20.685000000000002 28.53 27.55 23.235 55-59 20.705000000000002 28.28 27.77 23.244999999999997 60-64 19.71 28.499999999999996 28.205000000000002 23.585 65-69 20.36 27.805000000000003 28.355000000000004 23.48 70-74 20.365 27.750000000000004 27.595 24.29 75-79 20.41 27.884999999999998 27.689999999999998 24.015 80-84 20.205000000000002 28.29 27.62 23.885 85-89 20.74 28.185 27.900000000000002 23.175 90-94 20.485 27.915 27.765 23.835 95-99 20.115 28.955 27.365000000000002 23.565 100-104 20.405 28.360000000000003 27.775 23.46 105-109 20.330000000000002 28.27 27.605 23.794999999999998 110-114 20.765 28.01 27.950000000000003 23.275000000000002 115-119 21.185000000000002 27.61 28.035 23.169999999999998 120-124 20.695 28.050000000000004 27.77 23.485 125-129 20.44 27.529999999999998 28.050000000000004 23.98 130-134 20.560000000000002 28.199999999999996 27.96 23.28 135-139 20.990000000000002 27.755000000000003 27.689999999999998 23.565 140-144 20.735 27.894999999999996 27.425 23.945 145-149 21.04 27.900000000000002 27.939999999999998 23.119999999999997 150-151 21.0125 27.8875 26.450000000000003 24.65 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 1.0 22 1.0 23 0.5 24 0.5 25 0.5 26 3.0 27 6.0 28 11.5 29 14.5 30 12.0 31 18.0 32 30.0 33 36.0 34 44.5 35 60.0 36 84.5 37 116.5 38 149.0 39 168.0 40 186.5 41 212.0 42 261.5 43 289.0 44 281.0 45 272.5 46 267.0 47 248.0 48 225.5 49 210.0 50 176.0 51 141.0 52 115.0 53 90.0 54 68.0 55 58.5 56 37.5 57 27.0 58 22.5 59 11.5 60 9.0 61 10.0 62 7.5 63 3.0 64 2.0 65 3.0 66 2.5 67 1.0 68 0.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.94997498749375 99.9 2 0.05002501250625312 0.1 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.0625 0.0 0.0 0.0 0.0 106-107 0.075 0.0 0.0 0.0 0.0 108-109 0.0875 0.0 0.0 0.0 0.0 110-111 0.125 0.0 0.0 0.0 0.0 112-113 0.1875 0.0 0.0 0.0 0.0 114-115 0.25 0.0 0.0 0.0 0.0 116-117 0.2875 0.0 0.0 0.0 0.0 118-119 0.4 0.0 0.0 0.0 0.0 120-121 0.5 0.0 0.0 0.0 0.0 122-123 0.5375000000000001 0.0 0.0 0.0 0.0 124-125 0.625 0.0 0.0 0.0 0.0 126-127 0.7375 0.0 0.0 0.0 0.0 128-129 0.9125 0.0 0.0 0.0 0.0 130-131 1.05 0.0 0.0 0.0 0.0 132-133 1.2999999999999998 0.0 0.0 0.0 0.0 134-135 1.4874999999999998 0.0 0.0 0.0 0.0 136-137 1.65 0.0 0.0 0.0 0.0 138-139 1.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGCCATT 10 0.006830828 145.0 145 >>END_MODULE SRR7171894 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171894_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.09675 33.0 33.0 34.0 32.0 34.0 2 33.1465 34.0 33.0 34.0 32.0 34.0 3 33.2095 34.0 33.0 34.0 33.0 34.0 4 33.1335 34.0 33.0 34.0 33.0 34.0 5 33.10975 34.0 33.0 34.0 33.0 34.0 6 37.36925 38.0 38.0 38.0 37.0 38.0 7 37.31875 38.0 38.0 38.0 37.0 38.0 8 37.25575 38.0 38.0 38.0 37.0 38.0 9 37.3625 38.0 38.0 38.0 37.0 38.0 10-14 37.253049999999995 38.0 38.0 38.0 37.0 38.0 15-19 37.2154 38.0 38.0 38.0 37.0 38.0 20-24 37.25515 38.0 38.0 38.0 37.0 38.0 25-29 37.22325 38.0 38.0 38.0 37.0 38.0 30-34 37.214200000000005 38.0 38.0 38.0 37.0 38.0 35-39 37.051300000000005 38.0 38.0 38.0 36.6 38.0 40-44 37.0252 38.0 38.0 38.0 36.2 38.0 45-49 37.1191 38.0 38.0 38.0 36.6 38.0 50-54 37.0406 38.0 38.0 38.0 36.2 38.0 55-59 37.07535 38.0 38.0 38.0 36.0 38.0 60-64 37.02565 38.0 38.0 38.0 36.0 38.0 65-69 36.92405 38.0 38.0 38.0 36.0 38.0 70-74 36.867650000000005 38.0 38.0 38.0 35.8 38.0 75-79 36.7528 38.0 38.0 38.0 35.0 38.0 80-84 36.75645 38.0 38.0 38.0 34.8 38.0 85-89 36.67775 38.0 38.0 38.0 34.6 38.0 90-94 36.550749999999994 38.0 38.0 38.0 34.2 38.0 95-99 36.3891 38.0 38.0 38.0 34.0 38.0 100-104 36.27329999999999 38.0 37.8 38.0 33.8 38.0 105-109 36.0726 38.0 37.2 38.0 33.2 38.0 110-114 35.9317 38.0 37.0 38.0 33.0 38.0 115-119 35.874199999999995 38.0 37.0 38.0 32.2 38.0 120-124 35.6211 38.0 36.4 38.0 31.0 38.0 125-129 35.3842 38.0 36.0 38.0 30.4 38.0 130-134 35.0264 38.0 35.8 38.0 28.2 38.0 135-139 34.68805 38.0 35.0 38.0 27.2 38.0 140-144 34.39035 38.0 35.0 38.0 26.2 38.0 145-149 33.89835000000001 38.0 34.6 38.0 22.0 38.0 150-151 30.07025 36.0 29.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 2.0 4 1.0 5 1.0 6 0.0 7 0.0 8 1.0 9 0.0 10 2.0 11 2.0 12 0.0 13 2.0 14 2.0 15 0.0 16 4.0 17 0.0 18 4.0 19 5.0 20 2.0 21 10.0 22 3.0 23 7.0 24 15.0 25 14.0 26 17.0 27 12.0 28 29.0 29 23.0 30 50.0 31 49.0 32 74.0 33 93.0 34 155.0 35 288.0 36 681.0 37 2448.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.125 16.975 16.375 27.525 2 24.474999999999998 23.925 34.050000000000004 17.549999999999997 3 20.125 28.325 29.075 22.475 4 23.849999999999998 35.35 22.3 18.5 5 23.9 35.975 21.6 18.525 6 19.1 36.775000000000006 24.725 19.400000000000002 7 17.549999999999997 16.725 44.2 21.525 8 20.45 22.225 28.449999999999996 28.875 9 22.900000000000002 24.099999999999998 28.499999999999996 24.5 10-14 22.335 28.725 27.01 21.93 15-19 22.535 28.705000000000002 27.16 21.6 20-24 22.720000000000002 28.54 27.095000000000002 21.645 25-29 22.82 28.415000000000003 27.865000000000002 20.9 30-34 22.530771540078053 28.494946462523767 27.88451916341439 21.089762833983787 35-39 22.592926560464882 29.275623685001502 27.552349463981564 20.57910029055205 40-44 23.007873226016752 28.67960483426107 27.62649816960032 20.68602377012186 45-49 23.215 28.165000000000003 27.384999999999998 21.235 50-54 22.89 28.075 27.61 21.425 55-59 22.955000000000002 28.015 28.060000000000002 20.97 60-64 23.169999999999998 28.225 27.325 21.279999999999998 65-69 23.1 27.845 28.155 20.9 70-74 23.62 28.044999999999998 27.450000000000003 20.885 75-79 24.04 28.155 27.195000000000004 20.61 80-84 23.32 28.215 27.57 20.895 85-89 23.705000000000002 28.64 27.145000000000003 20.51 90-94 23.94 27.825 27.97 20.265 95-99 23.630000000000003 28.53 27.18 20.66 100-104 23.695 27.71 27.560000000000002 21.035 105-109 22.93 28.265 27.655 21.15 110-114 23.445 27.525 28.044999999999998 20.985 115-119 23.325000000000003 28.28 27.73 20.665 120-124 23.27 28.07 27.639999999999997 21.02 125-129 23.925 28.555000000000003 26.91 20.61 130-134 23.78 27.775 28.13 20.315 135-139 24.575 28.444999999999997 26.96 20.02 140-144 23.41 28.725 27.555000000000003 20.31 145-149 24.095 27.860000000000003 27.485 20.560000000000002 150-151 24.087500000000002 27.762500000000003 27.3375 20.8125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 1.0 22 1.5 23 1.0 24 1.5 25 2.5 26 3.5 27 4.5 28 3.5 29 8.0 30 14.0 31 14.0 32 19.0 33 28.0 34 42.5 35 55.5 36 74.5 37 105.0 38 135.5 39 158.5 40 187.5 41 237.0 42 276.0 43 297.5 44 300.0 45 285.5 46 262.5 47 254.0 48 236.0 49 194.0 50 169.5 51 149.0 52 128.0 53 100.0 54 72.0 55 53.5 56 40.5 57 25.5 58 11.0 59 9.5 60 8.0 61 7.0 62 6.5 63 4.5 64 2.5 65 3.5 66 3.5 67 0.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.06999999999999999 35-39 0.19 40-44 0.295 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82460536206464 99.6 2 0.15033826108744675 0.3 3 0.0 0.0 4 0.025056376847907794 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.0625 0.0 0.0 0.0 0.0 106-107 0.075 0.0 0.0 0.0 0.0 108-109 0.0875 0.0 0.0 0.0 0.0 110-111 0.15 0.0 0.0 0.0 0.0 112-113 0.21250000000000002 0.0 0.0 0.0 0.0 114-115 0.25 0.0 0.0 0.0 0.0 116-117 0.2875 0.0 0.0 0.0 0.0 118-119 0.4 0.0 0.0 0.0 0.0 120-121 0.5 0.0 0.0 0.0 0.0 122-123 0.5375000000000001 0.0 0.0 0.0 0.0 124-125 0.625 0.0 0.0 0.0 0.0 126-127 0.7250000000000001 0.0 0.0 0.0 0.0 128-129 0.8999999999999999 0.0 0.0 0.0 0.0 130-131 1.05 0.0 0.0 0.0 0.0 132-133 1.2999999999999998 0.0 0.0 0.0 0.0 134-135 1.475 0.0 0.0 0.0 0.0 136-137 1.625 0.0 0.0 0.0 0.0 138-139 1.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 649088 spots for SRR7171894.sra Written 649088 spots for SRR7171894.sra Read 649088 spots for SRR7171894.sra Written 649088 spots for SRR7171894.sra Read 649088 spots for SRR7171894.sra Written 649088 spots for SRR7171894.sra Read 649088 spots for SRR7171894.sra Written 649088 spots for SRR7171894.sra Read 649088 spots for SRR7171894.sra Written 649088 spots for SRR7171894.sra Read 649099 spots for SRR7171894.sra Written 649099 spots for SRR7171894.sra Read 649088 spots for SRR7171894.sra Written 649088 spots for SRR7171894.sra Read 649088 spots for SRR7171894.sra Written 649088 spots for SRR7171894.sra Read 649088 spots for SRR7171894.sra Written 649088 spots for SRR7171894.sra Read 649088 spots for SRR7171894.sra Written 649088 spots for SRR7171894.sra Read 649088 spots for SRR7171894.sra Written 649088 spots for SRR7171894.sra Read 649088 spots for SRR7171894.sra Written 649088 spots for SRR7171894.sra Read 649088 spots for SRR7171894.sra Written 649088 spots for SRR7171894.sra Read 649088 spots for SRR7171894.sra Written 649088 spots for SRR7171894.sra Read 649088 spots for SRR7171894.sra Written 649088 spots for SRR7171894.sra Read 649088 spots for SRR7171894.sra Written 649088 spots for SRR7171894.sra Read 649088 spots for SRR7171894.sra Written 649088 spots for SRR7171894.sra Read 649088 spots for SRR7171894.sra Written 649088 spots for SRR7171894.sra Read 649088 spots for SRR7171894.sra Written 649088 spots for SRR7171894.sra Read 649088 spots for SRR7171894.sra Written 649088 spots for SRR7171894.sra SRR ids: ['SRR7171894.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__lgqfzm8 SRR7171894.sra spots: 12981771 blocks: [[1, 649088], [649089, 1298176], [1298177, 1947264], [1947265, 2596352], [2596353, 3245440], [3245441, 3894528], [3894529, 4543616], [4543617, 5192704], [5192705, 5841792], [5841793, 6490880], [6490881, 7139968], [7139969, 7789056], [7789057, 8438144], [8438145, 9087232], [9087233, 9736320], [9736321, 10385408], [10385409, 11034496], [11034497, 11683584], [11683585, 12332672], [12332673, 12981771]] SRR7171894 file size 4377395 SRR7171894 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171894 SRR7171894_1.fastq SRR7171894_2.fastq Input file: SRR7171894_1.fastq Paired file: SRR7171894_2.fastq trimmed: SRR7171894-trimmed-pair1.fastq, SRR7171894-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 23:13:10 2025 >> started Thu Feb 13 23:13:26 2025 >> done (15.313s) 12981771 read pairs processed; of these: 7820 ( 0.06%) short read pairs filtered out after trimming by size control 5338 ( 0.04%) empty read pairs filtered out after trimming by size control 12968613 (99.90%) read pairs available; of these: 5394489 (41.60%) trimmed read pairs available after processing 7574124 (58.40%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 2 0.00% 20 3 0.00% 21 0 0.00% 22 1 0.00% 23 4 0.00% 24 7 0.00% 25 4 0.00% 26 3 0.00% 27 5 0.00% 28 4 0.00% 29 5 0.00% 30 2 0.00% 31 2 0.00% 32 2 0.00% 33 5 0.00% 34 5 0.00% 35 9 0.00% 36 3 0.00% 37 2 0.00% 38 1 0.00% 39 4 0.00% 40 6 0.00% 41 4 0.00% 42 3 0.00% 43 3 0.00% 44 5 0.00% 45 5 0.00% 46 9 0.00% 47 10 0.00% 48 12 0.00% 49 9 0.00% 50 8 0.00% 51 20 0.00% 52 21 0.00% 53 17 0.00% 54 19 0.00% 55 17 0.00% 56 24 0.00% 57 34 0.00% 58 34 0.00% 59 36 0.00% 60 39 0.00% 61 36 0.00% 62 55 0.00% 63 66 0.00% 64 51 0.00% 65 77 0.00% 66 70 0.00% 67 77 0.00% 68 84 0.00% 69 92 0.00% 70 110 0.00% 71 148 0.00% 72 158 0.00% 73 184 0.00% 74 199 0.00% 75 239 0.00% 76 241 0.00% 77 313 0.00% 78 298 0.00% 79 352 0.00% 80 372 0.00% 81 469 0.00% 82 550 0.00% 83 623 0.00% 84 1142 0.01% 85 1325 0.01% 86 1531 0.01% 87 1711 0.01% 88 1824 0.01% 89 1881 0.01% 90 1978 0.02% 91 2225 0.02% 92 2218 0.02% 93 2459 0.02% 94 2519 0.02% 95 2630 0.02% 96 2840 0.02% 97 3082 0.02% 98 3197 0.02% 99 3399 0.03% 100 3634 0.03% 101 3949 0.03% 102 4168 0.03% 103 4652 0.04% 104 4814 0.04% 105 5187 0.04% 106 5581 0.04% 107 5788 0.04% 108 6256 0.05% 109 6695 0.05% 110 7152 0.06% 111 7382 0.06% 112 8075 0.06% 113 8537 0.07% 114 9169 0.07% 115 9566 0.07% 116 10060 0.08% 117 10484 0.08% 118 10878 0.08% 119 11661 0.09% 120 12075 0.09% 121 12828 0.10% 122 13454 0.10% 123 14269 0.11% 124 14812 0.11% 125 15788 0.12% 126 16836 0.13% 127 17717 0.14% 128 18640 0.14% 129 19589 0.15% 130 20775 0.16% 131 22317 0.17% 132 23892 0.18% 133 25751 0.20% 134 27670 0.21% 135 28917 0.22% 136 31963 0.25% 137 34125 0.26% 138 37435 0.29% 139 41030 0.32% 140 45385 0.35% 141 51172 0.39% 142 57699 0.44% 143 67085 0.52% 144 80074 0.62% 145 99040 0.76% 146 129956 1.00% 147 184422 1.42% 148 299169 2.31% 149 632377 4.88% 150 3113304 24.01% 151 7574124 58.40% 12968613 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.82 fanout-score-rank=26 prefix-density=0.33 prefix-fanout=2.1 sequence=CACTTGCAGCCATTCTCAGCACCA criterion=fanout-score sequence-density=0.04 sequence-density-rank=29 fanout-score=64.22 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=9.2 sequence=CAAGAACAAAGATCATGCCACCAAAGGCCCAAGCGAT criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=3.06 fanout-score-rank=24 prefix-density=0.34 prefix-fanout=3.0 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.10 sequence-density-rank=19 fanout-score=43.55 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=14.1 sequence=CTCTCTTCTTCTTTGCCTTGTTGTCCTTCTCAGCTGTGTCGGTCAGGCCGGC SRR7171894 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 23:14:16 Started mapping on | Feb 13 23:14:16 Finished on | Feb 13 23:15:51 Mapping speed, Million of reads per hour | 491.44 Number of input reads | 12968613 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 12300427 Uniquely mapped reads % | 94.85% Average mapped length | 297.38 Number of splices: Total | 12793788 Number of splices: Annotated (sjdb) | 12577327 Number of splices: GT/AG | 12595149 Number of splices: GC/AG | 159059 Number of splices: AT/AC | 9994 Number of splices: Non-canonical | 29586 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.72 Insertion rate per base | 0.02% Insertion average length | 2.56 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 296383 % of reads mapped to multiple loci | 2.29% Number of reads mapped to too many loci | 35745 % of reads mapped to too many loci | 0.28% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.54% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 381172 381172 381172 N_multimapping 296383 296383 296383 N_noFeature 292859 12180080 353807 N_ambiguous 124532 680 64704 UnstrandedReadsAssigned:11883036 PositiveStrandReadsAssigned:119667 NegativeStrandReadsAssigned:11881916 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7171894 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171894-trimmed-pair1.fastq SRR7171894-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,968,613 reads, 11,764,434 reads pseudoaligned [quant] estimated average fragment length: 271.541 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,049 rounds 52401 SRR7171894.ke.tsv 34699 SRR7171894.se.tsv 87100 total ==> SRR7171894.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1747.46 1024 48.6131 Potri.005G024800.1.v4.1 1035 764.459 412 44.7099 Potri.004G059700.1.v4.1 961 690.483 14 1.68204 Potri.007G009000.2.v4.1 1416 1145.46 0 0 Potri.003G141000.2.v4.1 2943 2672.46 646.384 20.0651 Potri.016G087400.1.v4.1 270 65.1317 818 1041.89 Potri.015G069301.1.v4.1 564 299.469 0 0 Potri.010G195200.1.v4.1 1773 1502.46 191.629 10.5808 Potri.012G127500.1.v4.1 977 706.477 2515 295.325 ==> SRR7171894.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 17 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 230 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 99 SRR7171894 completed mapping pipeline successfully