Starting /dee2/code/volunteer_pipeline.sh SRR7171895 current disk space = 3089087459328 free memory = 1581974576 SRR7171895 SRAfilesize a6b0baa41d913c9001d2ccb3a4d41436 SRR7171895.sra SRR7171895.sra file validated SRR7171895 is paired end SRR7171895 is conventional basespace SRR7171895 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171895_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.84075 33.0 33.0 34.0 32.0 34.0 2 33.12925 34.0 33.0 34.0 33.0 34.0 3 32.45475 33.0 32.0 33.0 31.0 34.0 4 32.09925 33.0 31.0 33.0 31.0 34.0 5 32.85575 33.0 33.0 33.0 32.0 34.0 6 36.56925 38.0 37.0 38.0 34.0 38.0 7 37.12825 38.0 38.0 38.0 36.0 38.0 8 37.3825 38.0 38.0 38.0 37.0 38.0 9 37.51775 38.0 38.0 38.0 37.0 38.0 10-14 37.56139999999999 38.0 38.0 38.0 38.0 38.0 15-19 37.58285 38.0 38.0 38.0 38.0 38.0 20-24 37.54795 38.0 38.0 38.0 38.0 38.0 25-29 37.5019 38.0 38.0 38.0 37.8 38.0 30-34 37.4378 38.0 38.0 38.0 37.0 38.0 35-39 37.45165 38.0 38.0 38.0 37.2 38.0 40-44 37.39635 38.0 38.0 38.0 37.0 38.0 45-49 37.40265 38.0 38.0 38.0 37.0 38.0 50-54 37.379450000000006 38.0 38.0 38.0 37.0 38.0 55-59 37.3325 38.0 38.0 38.0 37.0 38.0 60-64 37.1904 38.0 38.0 38.0 36.6 38.0 65-69 37.120999999999995 38.0 38.0 38.0 36.0 38.0 70-74 37.0646 38.0 38.0 38.0 36.0 38.0 75-79 37.0382 38.0 38.0 38.0 36.0 38.0 80-84 36.9656 38.0 38.0 38.0 36.0 38.0 85-89 36.90575 38.0 38.0 38.0 36.0 38.0 90-94 36.810649999999995 38.0 38.0 38.0 35.0 38.0 95-99 36.71815 38.0 38.0 38.0 34.8 38.0 100-104 36.552949999999996 38.0 38.0 38.0 34.2 38.0 105-109 36.483549999999994 38.0 38.0 38.0 34.0 38.0 110-114 36.2512 38.0 37.4 38.0 33.8 38.0 115-119 36.14035 38.0 37.2 38.0 33.4 38.0 120-124 35.94045 38.0 37.0 38.0 32.8 38.0 125-129 35.97645 38.0 37.0 38.0 33.0 38.0 130-134 35.563550000000006 38.0 36.0 38.0 31.0 38.0 135-139 35.285199999999996 38.0 36.0 38.0 30.4 38.0 140-144 35.01695 38.0 35.6 38.0 28.8 38.0 145-149 34.52355 38.0 35.0 38.0 27.6 38.0 150-151 31.408875000000002 36.5 31.5 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 0.0 11 0.0 12 3.0 13 0.0 14 3.0 15 2.0 16 1.0 17 2.0 18 3.0 19 4.0 20 1.0 21 1.0 22 3.0 23 3.0 24 16.0 25 13.0 26 11.0 27 11.0 28 12.0 29 19.0 30 28.0 31 37.0 32 63.0 33 75.0 34 132.0 35 240.0 36 703.0 37 2612.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.425000000000004 15.375 11.85 36.35 2 20.200000000000003 19.650000000000002 34.625 25.525 3 19.275000000000002 28.125 25.05 27.55 4 21.425 33.725 22.475 22.375 5 21.55 35.75 24.2 18.5 6 18.95 35.75 24.7 20.599999999999998 7 12.675 23.875 44.05 19.400000000000002 8 16.825000000000003 24.5 29.299999999999997 29.375 9 17.075000000000003 23.425 33.575 25.924999999999997 10-14 19.455 30.320000000000004 26.505000000000003 23.72 15-19 20.04 29.549999999999997 27.37 23.04 20-24 19.81 29.67 27.01 23.51 25-29 19.675 29.299999999999997 27.105 23.919999999999998 30-34 19.98 28.835 27.389999999999997 23.794999999999998 35-39 20.34 28.63 27.52 23.51 40-44 19.689999999999998 28.96 27.62 23.73 45-49 20.03 28.775000000000002 27.35 23.845 50-54 20.52 28.410000000000004 27.175 23.895 55-59 19.675 28.749999999999996 27.245 24.33 60-64 19.56 28.615000000000002 27.76 24.065 65-69 20.395 28.405 27.61 23.59 70-74 20.52 28.345 27.365000000000002 23.77 75-79 20.515 28.305000000000003 27.485 23.695 80-84 20.169999999999998 28.294999999999998 27.615000000000002 23.919999999999998 85-89 19.89 28.075 28.04 23.995 90-94 20.25 28.62 27.18 23.95 95-99 20.51 27.605 27.92 23.965 100-104 20.585 28.16 27.295 23.96 105-109 20.74 27.855 27.6 23.805 110-114 20.655 27.700000000000003 27.345000000000002 24.3 115-119 21.224999999999998 27.98 26.985 23.810000000000002 120-124 20.294999999999998 27.915 27.705000000000002 24.085 125-129 21.195 28.005000000000003 26.950000000000003 23.849999999999998 130-134 20.66 27.79 27.165 24.385 135-139 21.029999999999998 27.700000000000003 27.485 23.785 140-144 20.785 27.72 27.015 24.48 145-149 21.279999999999998 27.79 27.21 23.72 150-151 21.3125 28.012500000000003 27.1 23.575 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.5 5 1.0 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 1.5 17 1.5 18 0.0 19 0.5 20 1.0 21 0.5 22 0.5 23 1.5 24 3.0 25 4.0 26 4.0 27 8.0 28 12.0 29 12.0 30 14.5 31 29.0 32 41.5 33 45.0 34 61.5 35 79.5 36 88.5 37 111.0 38 128.0 39 152.5 40 184.0 41 213.5 42 242.5 43 254.0 44 260.5 45 261.5 46 276.0 47 251.0 48 218.5 49 208.5 50 179.5 51 146.5 52 120.0 53 96.5 54 71.5 55 52.5 56 36.5 57 29.0 58 22.0 59 13.0 60 10.0 61 13.0 62 9.5 63 8.0 64 7.0 65 1.5 66 0.5 67 1.0 68 0.5 69 2.0 70 2.0 71 0.5 72 0.5 73 0.5 74 1.0 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.16249999999999998 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.2625 0.0 0.0 0.0 0.0 98-99 0.2875 0.0 0.0 0.0 0.0 100-101 0.3375 0.0 0.0 0.0 0.0 102-103 0.3625 0.0 0.0 0.0 0.0 104-105 0.4375 0.0 0.0 0.0 0.0 106-107 0.5375 0.0 0.0 0.0 0.0 108-109 0.675 0.0 0.0 0.0 0.0 110-111 0.7875 0.0 0.0 0.0 0.0 112-113 0.95 0.0 0.0 0.0 0.0 114-115 1.05 0.0 0.0 0.0 0.0 116-117 1.2000000000000002 0.0 0.0 0.0 0.0 118-119 1.3125 0.0 0.0 0.0 0.0 120-121 1.4125 0.0 0.0 0.0 0.0 122-123 1.5499999999999998 0.0 0.0 0.0 0.0 124-125 1.7999999999999998 0.0 0.0 0.0 0.0 126-127 2.05 0.0 0.0 0.0 0.0 128-129 2.3875 0.0 0.0 0.0 0.0 130-131 2.6 0.0 0.0 0.0 0.0 132-133 2.8 0.0 0.0 0.0 0.0 134-135 3.0 0.0 0.0 0.0 0.0 136-137 3.275 0.0 0.0 0.0 0.0 138-139 3.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7171895 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171895_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.913 33.0 33.0 34.0 32.0 34.0 2 33.021 34.0 33.0 34.0 32.0 34.0 3 33.03875 34.0 33.0 34.0 32.0 34.0 4 33.02175 34.0 33.0 34.0 33.0 34.0 5 33.031 34.0 33.0 34.0 33.0 34.0 6 37.056 38.0 38.0 38.0 37.0 38.0 7 37.234 38.0 38.0 38.0 37.0 38.0 8 37.20475 38.0 38.0 38.0 37.0 38.0 9 37.1415 38.0 38.0 38.0 37.0 38.0 10-14 37.08075 38.0 38.0 38.0 36.6 38.0 15-19 37.0536 38.0 38.0 38.0 36.4 38.0 20-24 37.09075 38.0 38.0 38.0 36.8 38.0 25-29 37.082049999999995 38.0 38.0 38.0 37.0 38.0 30-34 37.0327 38.0 38.0 38.0 36.6 38.0 35-39 36.74445 38.0 38.0 38.0 36.0 38.0 40-44 36.5614 38.0 38.0 38.0 35.8 38.0 45-49 36.95915 38.0 38.0 38.0 36.0 38.0 50-54 36.8998 38.0 38.0 38.0 36.0 38.0 55-59 36.8457 38.0 38.0 38.0 36.0 38.0 60-64 36.81305 38.0 38.0 38.0 36.0 38.0 65-69 36.797349999999994 38.0 38.0 38.0 35.6 38.0 70-74 36.74605 38.0 38.0 38.0 35.4 38.0 75-79 36.6366 38.0 38.0 38.0 35.0 38.0 80-84 36.601549999999996 38.0 38.0 38.0 35.0 38.0 85-89 36.43415 38.0 38.0 38.0 34.4 38.0 90-94 36.303250000000006 38.0 38.0 38.0 34.0 38.0 95-99 36.27045 38.0 38.0 38.0 34.0 38.0 100-104 36.16515 38.0 38.0 38.0 34.0 38.0 105-109 35.9405 38.0 37.2 38.0 33.2 38.0 110-114 35.87935 38.0 37.0 38.0 33.0 38.0 115-119 35.8228 38.0 37.0 38.0 32.8 38.0 120-124 35.42229999999999 38.0 36.4 38.0 30.4 38.0 125-129 35.243100000000005 38.0 36.2 38.0 29.4 38.0 130-134 35.022800000000004 38.0 36.0 38.0 28.2 38.0 135-139 34.77995 38.0 35.6 38.0 28.4 38.0 140-144 34.401599999999995 38.0 35.0 38.0 26.0 38.0 145-149 33.83905 38.0 34.6 38.0 23.2 38.0 150-151 30.30475 36.5 29.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 1.0 4 3.0 5 1.0 6 4.0 7 1.0 8 2.0 9 2.0 10 1.0 11 4.0 12 2.0 13 2.0 14 3.0 15 3.0 16 4.0 17 2.0 18 3.0 19 2.0 20 4.0 21 9.0 22 7.0 23 10.0 24 15.0 25 17.0 26 20.0 27 19.0 28 22.0 29 31.0 30 44.0 31 45.0 32 68.0 33 95.0 34 166.0 35 268.0 36 626.0 37 2488.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.699999999999996 17.05 16.650000000000002 25.6 2 24.325 25.124999999999996 31.65 18.9 3 21.725 27.875 29.875 20.525 4 22.5 35.325 22.275 19.900000000000002 5 23.875 37.574999999999996 21.125 17.424999999999997 6 18.55 39.2 22.875 19.375 7 19.2 18.0 39.45 23.35 8 21.349999999999998 23.45 27.150000000000002 28.050000000000004 9 21.95 25.525 27.675 24.85 10-14 23.53 28.57 26.095000000000002 21.805 15-19 23.794999999999998 28.07 27.02 21.115000000000002 20-24 22.99 28.235 27.58 21.195 25-29 23.31 28.23 27.155 21.305 30-34 23.593311974369243 28.088706447737284 27.027432919503404 21.29054865839007 35-39 23.40339734865669 28.196985735168102 27.098140027219113 21.3014768889561 40-44 23.116542112704504 27.989295091900622 27.40860432235912 21.485558473035752 45-49 23.965 27.715 27.334999999999997 20.985 50-54 24.375 27.625 27.32 20.68 55-59 23.86 27.755000000000003 27.334999999999997 21.05 60-64 24.16 28.244999999999997 26.83 20.765 65-69 24.29 27.694999999999997 27.04 20.974999999999998 70-74 24.349999999999998 27.96 27.01 20.68 75-79 24.12 27.544999999999998 27.994999999999997 20.34 80-84 23.665 27.61 27.41 21.315 85-89 23.935000000000002 27.650000000000002 27.860000000000003 20.555 90-94 23.905 27.99 27.625 20.48 95-99 23.515 28.134999999999998 27.625 20.724999999999998 100-104 24.495 27.74 27.185 20.580000000000002 105-109 23.990000000000002 27.950000000000003 27.894999999999996 20.165 110-114 24.060000000000002 27.68 27.71 20.549999999999997 115-119 23.48 27.735 28.315 20.47 120-124 24.515 27.66 27.49 20.335 125-129 24.455 27.725 27.474999999999998 20.345 130-134 24.19 27.925 26.919999999999998 20.965 135-139 24.27 27.905 27.6 20.225 140-144 24.83 27.61 27.400000000000002 20.16 145-149 24.325 28.38 27.295 20.0 150-151 26.787499999999998 26.9125 26.7625 19.537499999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 1.0 19 1.0 20 0.5 21 0.0 22 0.0 23 1.0 24 1.0 25 1.0 26 2.5 27 3.5 28 5.5 29 7.5 30 9.5 31 15.5 32 21.5 33 28.5 34 33.5 35 46.5 36 65.5 37 83.0 38 109.5 39 147.0 40 184.0 41 227.0 42 251.0 43 253.0 44 279.0 45 302.0 46 293.0 47 268.5 48 242.5 49 214.5 50 180.0 51 155.5 52 134.5 53 100.5 54 77.0 55 64.0 56 51.5 57 37.5 58 26.5 59 20.5 60 15.0 61 9.5 62 5.5 63 5.0 64 7.0 65 4.5 66 1.0 67 1.5 68 1.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.12 35-39 0.8049999999999999 40-44 0.98 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.16249999999999998 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.2625 0.0 0.0 0.0 0.0 98-99 0.2875 0.0 0.0 0.0 0.0 100-101 0.3375 0.0 0.0 0.0 0.0 102-103 0.3625 0.0 0.0 0.0 0.0 104-105 0.4375 0.0 0.0 0.0 0.0 106-107 0.5375 0.0 0.0 0.0 0.0 108-109 0.675 0.0 0.0 0.0 0.0 110-111 0.7625 0.0 0.0 0.0 0.0 112-113 0.925 0.0 0.0 0.0 0.0 114-115 1.025 0.0 0.0 0.0 0.0 116-117 1.1749999999999998 0.0 0.0 0.0 0.0 118-119 1.2875 0.0 0.0 0.0 0.0 120-121 1.3875 0.0 0.0 0.0 0.0 122-123 1.5499999999999998 0.0 0.0 0.0 0.0 124-125 1.775 0.0 0.0 0.0 0.0 126-127 2.0375 0.0 0.0 0.0 0.0 128-129 2.3875 0.0 0.0 0.0 0.0 130-131 2.6 0.0 0.0 0.0 0.0 132-133 2.7875 0.0 0.0 0.0 0.0 134-135 2.975 0.0 0.0 0.0 0.0 136-137 3.3 0.0 0.0 0.0 0.0 138-139 3.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 753021 spots for SRR7171895.sra Written 753021 spots for SRR7171895.sra Read 753021 spots for SRR7171895.sra Written 753021 spots for SRR7171895.sra Read 753021 spots for SRR7171895.sra Written 753021 spots for SRR7171895.sra Read 753021 spots for SRR7171895.sra Written 753021 spots for SRR7171895.sra Read 753021 spots for SRR7171895.sra Written 753021 spots for SRR7171895.sra Read 753021 spots for SRR7171895.sra Written 753021 spots for SRR7171895.sra Read 753021 spots for SRR7171895.sra Written 753021 spots for SRR7171895.sra Read 753021 spots for SRR7171895.sra Written 753021 spots for SRR7171895.sra Read 753021 spots for SRR7171895.sra Written 753021 spots for SRR7171895.sra Read 753021 spots for SRR7171895.sra Written 753021 spots for SRR7171895.sra Read 753021 spots for SRR7171895.sra Written 753021 spots for SRR7171895.sra Read 753021 spots for SRR7171895.sra Written 753021 spots for SRR7171895.sra Read 753021 spots for SRR7171895.sra Written 753021 spots for SRR7171895.sra Read 753021 spots for SRR7171895.sra Written 753021 spots for SRR7171895.sra Read 753021 spots for SRR7171895.sra Written 753021 spots for SRR7171895.sra Read 753028 spots for SRR7171895.sra Written 753028 spots for SRR7171895.sra Read 753021 spots for SRR7171895.sra Written 753021 spots for SRR7171895.sra Read 753021 spots for SRR7171895.sra Written 753021 spots for SRR7171895.sra Read 753021 spots for SRR7171895.sra Written 753021 spots for SRR7171895.sra Read 753021 spots for SRR7171895.sra Written 753021 spots for SRR7171895.sra SRR ids: ['SRR7171895.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_n6zzkdg7 SRR7171895.sra spots: 15060427 blocks: [[1, 753021], [753022, 1506042], [1506043, 2259063], [2259064, 3012084], [3012085, 3765105], [3765106, 4518126], [4518127, 5271147], [5271148, 6024168], [6024169, 6777189], [6777190, 7530210], [7530211, 8283231], [8283232, 9036252], [9036253, 9789273], [9789274, 10542294], [10542295, 11295315], [11295316, 12048336], [12048337, 12801357], [12801358, 13554378], [13554379, 14307399], [14307400, 15060427]] SRR7171895 file size 5081784 SRR7171895 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171895 SRR7171895_1.fastq SRR7171895_2.fastq Input file: SRR7171895_1.fastq Paired file: SRR7171895_2.fastq trimmed: SRR7171895-trimmed-pair1.fastq, SRR7171895-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 00:27:38 2025 >> started Fri Feb 14 00:27:54 2025 >> done (15.930s) 15060427 read pairs processed; of these: 20978 ( 0.14%) short read pairs filtered out after trimming by size control 15378 ( 0.10%) empty read pairs filtered out after trimming by size control 15024071 (99.76%) read pairs available; of these: 6174185 (41.10%) trimmed read pairs available after processing 8849886 (58.90%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 3 0.00% 20 3 0.00% 21 4 0.00% 22 2 0.00% 23 7 0.00% 24 4 0.00% 25 5 0.00% 26 9 0.00% 27 2 0.00% 28 7 0.00% 29 3 0.00% 30 7 0.00% 31 13 0.00% 32 5 0.00% 33 5 0.00% 34 2 0.00% 35 6 0.00% 36 4 0.00% 37 5 0.00% 38 6 0.00% 39 11 0.00% 40 9 0.00% 41 17 0.00% 42 7 0.00% 43 11 0.00% 44 9 0.00% 45 15 0.00% 46 16 0.00% 47 16 0.00% 48 12 0.00% 49 21 0.00% 50 21 0.00% 51 20 0.00% 52 28 0.00% 53 41 0.00% 54 30 0.00% 55 46 0.00% 56 40 0.00% 57 53 0.00% 58 53 0.00% 59 68 0.00% 60 70 0.00% 61 89 0.00% 62 73 0.00% 63 74 0.00% 64 129 0.00% 65 129 0.00% 66 128 0.00% 67 170 0.00% 68 185 0.00% 69 197 0.00% 70 206 0.00% 71 300 0.00% 72 276 0.00% 73 315 0.00% 74 399 0.00% 75 476 0.00% 76 523 0.00% 77 618 0.00% 78 628 0.00% 79 664 0.00% 80 777 0.01% 81 862 0.01% 82 1076 0.01% 83 1258 0.01% 84 2145 0.01% 85 2820 0.02% 86 2997 0.02% 87 3199 0.02% 88 3287 0.02% 89 3461 0.02% 90 3560 0.02% 91 3793 0.03% 92 4157 0.03% 93 4320 0.03% 94 4430 0.03% 95 4740 0.03% 96 5005 0.03% 97 5285 0.04% 98 5688 0.04% 99 5977 0.04% 100 6410 0.04% 101 6780 0.05% 102 7400 0.05% 103 7809 0.05% 104 8413 0.06% 105 8977 0.06% 106 9448 0.06% 107 9874 0.07% 108 10700 0.07% 109 10860 0.07% 110 11917 0.08% 111 12216 0.08% 112 13156 0.09% 113 13728 0.09% 114 14744 0.10% 115 15761 0.10% 116 16068 0.11% 117 17118 0.11% 118 17578 0.12% 119 18373 0.12% 120 18950 0.13% 121 20291 0.14% 122 21293 0.14% 123 22118 0.15% 124 23675 0.16% 125 24454 0.16% 126 25520 0.17% 127 27062 0.18% 128 27968 0.19% 129 29569 0.20% 130 30980 0.21% 131 32185 0.21% 132 34169 0.23% 133 36542 0.24% 134 38547 0.26% 135 41370 0.28% 136 43655 0.29% 137 47020 0.31% 138 50735 0.34% 139 54287 0.36% 140 58997 0.39% 141 65391 0.44% 142 72406 0.48% 143 82277 0.55% 144 96313 0.64% 145 115658 0.77% 146 146580 0.98% 147 202898 1.35% 148 319090 2.12% 149 653966 4.35% 150 3397752 22.62% 151 8849886 58.90% 15024071 reads passed initial QC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=3.00 fanout-score-rank=31 prefix-density=0.37 prefix-fanout=2.3 sequence=CACTTGCAGCCATTCTCAGCACCAGAGTTCATCTCAGACCTCTC criterion=fanout-score sequence-density=0.08 sequence-density-rank=20 fanout-score=376.41 fanout-score-rank=1 prefix-density=0.90 prefix-fanout=34.9 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=2.94 fanout-score-rank=27 prefix-density=0.34 prefix-fanout=2.9 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.09 sequence-density-rank=22 fanout-score=77.77 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=20.4 sequence=TTGTTGGTGATGG SRR7171895 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 00:28:38 Started mapping on | Feb 14 00:28:38 Finished on | Feb 14 00:30:21 Mapping speed, Million of reads per hour | 525.11 Number of input reads | 15024071 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 13978600 Uniquely mapped reads % | 93.04% Average mapped length | 296.26 Number of splices: Total | 14031931 Number of splices: Annotated (sjdb) | 13782682 Number of splices: GT/AG | 13822026 Number of splices: GC/AG | 165089 Number of splices: AT/AC | 9854 Number of splices: Non-canonical | 34962 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.66 Insertion rate per base | 0.02% Insertion average length | 2.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 375431 % of reads mapped to multiple loci | 2.50% Number of reads mapped to too many loci | 121685 % of reads mapped to too many loci | 0.81% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.51% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 689068 689068 689068 N_multimapping 375431 375431 375431 N_noFeature 309381 13828924 373896 N_ambiguous 153723 681 68236 UnstrandedReadsAssigned:13515496 PositiveStrandReadsAssigned:148995 NegativeStrandReadsAssigned:13536468 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7171895 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171895-trimmed-pair1.fastq SRR7171895-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,024,071 reads, 13,469,929 reads pseudoaligned [quant] estimated average fragment length: 251.54 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,109 rounds 52401 SRR7171895.ke.tsv 34699 SRR7171895.se.tsv 87100 total ==> SRR7171895.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1767.46 1433 51.0497 Potri.005G024800.1.v4.1 1035 784.46 2409 193.358 Potri.004G059700.1.v4.1 961 710.48 4 0.354491 Potri.007G009000.2.v4.1 1416 1165.46 0 0 Potri.003G141000.2.v4.1 2943 2692.46 854 19.9712 Potri.016G087400.1.v4.1 270 70.1224 1185 1064.04 Potri.015G069301.1.v4.1 564 316.822 0 0 Potri.010G195200.1.v4.1 1773 1522.46 330 13.6479 Potri.012G127500.1.v4.1 977 726.467 3750 325.021 ==> SRR7171895.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 0 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 391 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 53 Potri.001G452600.v4.1 75 SRR7171895 completed mapping pipeline successfully