Starting /dee2/code/volunteer_pipeline.sh SRR7171896 current disk space = 3089252253696 free memory = 1578204640 SRR7171896 SRAfilesize 3b5b5f5a5ae246b083fdab2fa8d2a0c9 SRR7171896.sra SRR7171896.sra file validated SRR7171896 is paired end SRR7171896 is conventional basespace SRR7171896 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171896_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.71 33.0 30.0 34.0 25.0 34.0 2 32.71375 33.0 33.0 34.0 31.0 34.0 3 32.88525 33.0 33.0 34.0 31.0 34.0 4 33.32525 34.0 33.0 34.0 33.0 34.0 5 33.47125 34.0 33.0 34.0 33.0 34.0 6 37.205 38.0 37.0 38.0 36.0 38.0 7 37.5615 38.0 38.0 38.0 37.0 38.0 8 37.63975 38.0 38.0 38.0 38.0 38.0 9 37.68175 38.0 38.0 38.0 38.0 38.0 10-14 37.693 38.0 38.0 38.0 38.0 38.0 15-19 37.674299999999995 38.0 38.0 38.0 38.0 38.0 20-24 37.68085 38.0 38.0 38.0 38.0 38.0 25-29 37.634499999999996 38.0 38.0 38.0 38.0 38.0 30-34 37.584999999999994 38.0 38.0 38.0 38.0 38.0 35-39 37.5692 38.0 38.0 38.0 38.0 38.0 40-44 37.538599999999995 38.0 38.0 38.0 38.0 38.0 45-49 37.481700000000004 38.0 38.0 38.0 37.6 38.0 50-54 37.452999999999996 38.0 38.0 38.0 37.2 38.0 55-59 37.41865 38.0 38.0 38.0 37.0 38.0 60-64 37.393 38.0 38.0 38.0 37.0 38.0 65-69 37.3328 38.0 38.0 38.0 37.0 38.0 70-74 37.25529999999999 38.0 38.0 38.0 36.4 38.0 75-79 37.21925 38.0 38.0 38.0 36.4 38.0 80-84 37.1913 38.0 38.0 38.0 36.0 38.0 85-89 37.07395 38.0 38.0 38.0 36.0 38.0 90-94 37.0198 38.0 38.0 38.0 36.0 38.0 95-99 36.8842 38.0 38.0 38.0 35.6 38.0 100-104 36.7663 38.0 38.0 38.0 35.0 38.0 105-109 36.607299999999995 38.0 38.0 38.0 34.4 38.0 110-114 36.4743 38.0 38.0 38.0 34.2 38.0 115-119 36.4604 38.0 38.0 38.0 34.0 38.0 120-124 36.27945 38.0 38.0 38.0 34.0 38.0 125-129 36.02365 38.0 37.2 38.0 33.2 38.0 130-134 35.79325 38.0 36.6 38.0 32.2 38.0 135-139 35.513749999999995 38.0 36.0 38.0 31.0 38.0 140-144 35.278650000000006 38.0 36.0 38.0 30.6 38.0 145-149 34.8045 38.0 35.6 38.0 28.6 38.0 150-151 31.985875 36.5 32.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 4.0 16 1.0 17 1.0 18 3.0 19 0.0 20 1.0 21 7.0 22 2.0 23 8.0 24 8.0 25 10.0 26 4.0 27 15.0 28 15.0 29 10.0 30 28.0 31 33.0 32 57.0 33 61.0 34 117.0 35 214.0 36 565.0 37 2835.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.5 14.499999999999998 11.0 34.0 2 20.075093867334168 18.197747183979978 36.32040050062578 25.406758448060074 3 19.2 26.0 26.650000000000002 28.15 4 22.825 34.075 21.925 21.175 5 21.85 36.4 23.3 18.45 6 19.175 35.85 24.25 20.724999999999998 7 14.099999999999998 22.325 44.2 19.375 8 17.375 23.200000000000003 30.45 28.975 9 17.825 23.599999999999998 32.625 25.95 10-14 19.96 29.275000000000002 26.85 23.915 15-19 20.330000000000002 28.7 27.04 23.93 20-24 19.96 28.560000000000002 27.515 23.965 25-29 19.73 28.83 27.794999999999998 23.645 30-34 20.369999999999997 27.994999999999997 27.950000000000003 23.685000000000002 35-39 20.25 28.310000000000002 27.560000000000002 23.880000000000003 40-44 20.064999999999998 27.99 27.939999999999998 24.005000000000003 45-49 20.615 27.675 27.839999999999996 23.87 50-54 20.345 28.315 27.605 23.735 55-59 21.07 27.279999999999998 27.43 24.22 60-64 20.97 28.32 27.42 23.29 65-69 20.51 27.655 27.474999999999998 24.36 70-74 20.75 27.845 27.42 23.985 75-79 20.635 27.79 27.465 24.11 80-84 20.669999999999998 27.905 27.195000000000004 24.23 85-89 20.46 27.994999999999997 27.075 24.47 90-94 20.585 28.735 27.3 23.380000000000003 95-99 20.89 27.42 27.415 24.275 100-104 20.815 28.22 27.450000000000003 23.515 105-109 20.785 28.08 27.445000000000004 23.69 110-114 20.875 27.615000000000002 27.6 23.91 115-119 21.044999999999998 27.47 27.284999999999997 24.2 120-124 20.765 28.32 27.435 23.48 125-129 21.05 27.810000000000002 27.384999999999998 23.755000000000003 130-134 21.785 27.365000000000002 26.590000000000003 24.26 135-139 21.065 28.16 27.005000000000003 23.77 140-144 21.105 28.24 26.775 23.880000000000003 145-149 21.04 28.470000000000002 26.450000000000003 24.04 150-151 21.65 27.6875 27.3625 23.3 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.5 22 0.5 23 1.5 24 2.0 25 0.5 26 4.0 27 5.5 28 6.0 29 9.0 30 13.0 31 20.5 32 22.5 33 30.0 34 44.5 35 59.0 36 69.5 37 89.5 38 129.0 39 163.0 40 190.0 41 221.0 42 256.5 43 270.5 44 269.0 45 270.0 46 260.5 47 250.0 48 241.0 49 209.0 50 183.0 51 154.0 52 122.5 53 100.5 54 81.5 55 64.0 56 41.5 57 34.5 58 25.5 59 18.0 60 13.0 61 12.0 62 12.0 63 7.0 64 5.5 65 5.0 66 3.5 67 2.5 68 1.0 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.125 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.92494370778083 99.85000000000001 2 0.07505629221916438 0.15 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.3 0.0 0.0 0.0 0.0 94-95 0.4 0.0 0.0 0.0 0.0 96-97 0.4125 0.0 0.0 0.0 0.0 98-99 0.5125 0.0 0.0 0.0 0.0 100-101 0.7250000000000001 0.0 0.0 0.0 0.0 102-103 0.8999999999999999 0.0 0.0 0.0 0.0 104-105 1.0750000000000002 0.0 0.0 0.0 0.0 106-107 1.2625000000000002 0.0 0.0 0.0 0.0 108-109 1.4 0.0 0.0 0.0 0.0 110-111 1.525 0.0 0.0 0.0 0.0 112-113 1.75 0.0 0.0 0.0 0.0 114-115 1.8875 0.0 0.0 0.0 0.0 116-117 2.1 0.0 0.0 0.0 0.0 118-119 2.4375 0.0 0.0 0.0 0.0 120-121 2.775 0.0 0.0 0.0 0.0 122-123 2.9875 0.0 0.0 0.0 0.0 124-125 3.2 0.0 0.0 0.0 0.0 126-127 3.425 0.0 0.0 0.0 0.0 128-129 3.7375 0.0 0.0 0.0 0.0 130-131 4.125 0.0 0.0 0.0 0.0 132-133 4.5 0.0 0.0 0.0 0.0 134-135 4.825 0.0 0.0 0.0 0.0 136-137 5.225 0.0 0.0 0.0 0.0 138-139 5.7375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCCATT 10 0.006830828 145.0 1 AAAAAAA 95 0.007278115 10.684211 135-139 >>END_MODULE SRR7171896 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171896_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.153 33.0 33.0 34.0 33.0 34.0 2 33.273 34.0 33.0 34.0 33.0 34.0 3 33.24625 34.0 33.0 34.0 33.0 34.0 4 33.2885 34.0 33.0 34.0 33.0 34.0 5 33.278 34.0 33.0 34.0 33.0 34.0 6 37.49075 38.0 38.0 38.0 38.0 38.0 7 37.46825 38.0 38.0 38.0 38.0 38.0 8 37.48675 38.0 38.0 38.0 38.0 38.0 9 37.45475 38.0 38.0 38.0 38.0 38.0 10-14 37.4473 38.0 38.0 38.0 38.0 38.0 15-19 37.43385 38.0 38.0 38.0 38.0 38.0 20-24 37.47195000000001 38.0 38.0 38.0 38.0 38.0 25-29 37.4653 38.0 38.0 38.0 38.0 38.0 30-34 37.38725 38.0 38.0 38.0 37.8 38.0 35-39 37.1435 38.0 38.0 38.0 37.4 38.0 40-44 36.72745 38.0 38.0 38.0 37.0 38.0 45-49 37.3199 38.0 38.0 38.0 37.0 38.0 50-54 37.34425 38.0 38.0 38.0 37.0 38.0 55-59 37.35039999999999 38.0 38.0 38.0 37.0 38.0 60-64 37.28715 38.0 38.0 38.0 37.0 38.0 65-69 37.231100000000005 38.0 38.0 38.0 36.8 38.0 70-74 37.172999999999995 38.0 38.0 38.0 37.0 38.0 75-79 37.139149999999994 38.0 38.0 38.0 36.8 38.0 80-84 37.044599999999996 38.0 38.0 38.0 36.4 38.0 85-89 36.94 38.0 38.0 38.0 36.0 38.0 90-94 36.856550000000006 38.0 38.0 38.0 36.0 38.0 95-99 36.74955 38.0 38.0 38.0 35.6 38.0 100-104 36.70399999999999 38.0 38.0 38.0 35.0 38.0 105-109 36.5531 38.0 38.0 38.0 35.0 38.0 110-114 36.43025 38.0 38.0 38.0 34.0 38.0 115-119 36.392649999999996 38.0 38.0 38.0 34.2 38.0 120-124 36.2421 38.0 38.0 38.0 34.0 38.0 125-129 35.963800000000006 38.0 37.8 38.0 33.2 38.0 130-134 35.645950000000006 38.0 36.6 38.0 32.4 38.0 135-139 35.56015 38.0 36.4 38.0 32.4 38.0 140-144 35.22494999999999 38.0 36.0 38.0 31.0 38.0 145-149 34.8294 38.0 36.0 38.0 29.6 38.0 150-151 31.304499999999997 35.5 31.0 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 1.0 4 1.0 5 0.0 6 1.0 7 0.0 8 1.0 9 0.0 10 0.0 11 1.0 12 1.0 13 0.0 14 3.0 15 2.0 16 2.0 17 1.0 18 4.0 19 4.0 20 2.0 21 7.0 22 5.0 23 9.0 24 6.0 25 11.0 26 9.0 27 14.0 28 24.0 29 17.0 30 31.0 31 42.0 32 49.0 33 82.0 34 112.0 35 186.0 36 530.0 37 2840.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.25 16.5 15.775 25.474999999999998 2 24.125 24.325 31.924999999999997 19.625 3 22.3 27.35 29.325000000000003 21.025 4 25.15 35.25 19.950000000000003 19.650000000000002 5 23.825 36.75 21.05 18.375 6 19.275000000000002 37.675 22.375 20.674999999999997 7 19.025 18.45 40.9 21.625 8 20.775 22.575 27.275 29.375 9 22.5 24.425 28.9 24.175 10-14 23.16 28.689999999999998 26.215 21.935 15-19 23.385 27.68 27.415 21.52 20-24 22.42 28.465 27.41 21.705 25-29 23.830000000000002 28.044999999999998 26.884999999999998 21.240000000000002 30-34 23.909127301841473 27.29183346677342 27.522017614091272 21.277021617293833 35-39 23.312018528774985 28.20099692865415 27.249383213332663 21.237601329238206 40-44 23.008130081300813 27.952235772357724 28.13008130081301 20.909552845528456 45-49 23.915 27.22 27.694999999999997 21.17 50-54 23.72 27.875 28.005000000000003 20.4 55-59 23.830000000000002 27.62 27.38 21.17 60-64 23.990000000000002 27.98 27.37 20.66 65-69 24.08 27.860000000000003 27.445000000000004 20.615 70-74 24.154999999999998 27.395000000000003 27.134999999999998 21.315 75-79 23.505000000000003 27.99 26.875 21.63 80-84 23.655 28.1 26.905 21.34 85-89 24.224999999999998 27.284999999999997 27.58 20.91 90-94 23.830000000000002 27.944999999999997 26.71 21.515 95-99 24.12 27.534999999999997 27.279999999999998 21.065 100-104 24.395 27.62 27.505000000000003 20.48 105-109 24.39 27.495000000000005 27.400000000000002 20.715 110-114 24.545 28.21 26.845000000000002 20.4 115-119 24.32 27.74 26.8 21.14 120-124 24.18 27.92 26.995 20.905 125-129 24.490000000000002 28.015 27.125 20.369999999999997 130-134 24.64 27.07 27.185 21.105 135-139 24.91 27.525 27.685 19.88 140-144 24.82 27.63 26.939999999999998 20.61 145-149 24.6 27.68 27.22 20.5 150-151 25.0625 28.15 26.7125 20.075000000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.5 23 0.5 24 0.5 25 1.0 26 1.0 27 2.0 28 4.0 29 7.5 30 8.5 31 10.0 32 15.5 33 23.5 34 31.5 35 43.0 36 58.5 37 83.5 38 113.0 39 148.5 40 182.5 41 219.0 42 254.0 43 281.5 44 289.5 45 279.5 46 285.0 47 273.5 48 244.5 49 209.5 50 183.0 51 182.0 52 151.0 53 104.0 54 77.5 55 56.0 56 43.5 57 30.5 58 26.0 59 21.5 60 14.0 61 11.0 62 6.0 63 5.5 64 4.0 65 3.0 66 3.5 67 1.5 68 1.5 69 1.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.08 35-39 0.695 40-44 1.6 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.3 0.0 0.0 0.0 0.0 94-95 0.425 0.0 0.0 0.0 0.0 96-97 0.4375 0.0 0.0 0.0 0.0 98-99 0.5375 0.0 0.0 0.0 0.0 100-101 0.75 0.0 0.0 0.0 0.0 102-103 0.925 0.0 0.0 0.0 0.0 104-105 1.1 0.0 0.0 0.0 0.0 106-107 1.3 0.0 0.0 0.0 0.0 108-109 1.4375 0.0 0.0 0.0 0.0 110-111 1.55 0.0 0.0 0.0 0.0 112-113 1.775 0.0 0.0 0.0 0.0 114-115 1.9125 0.0 0.0 0.0 0.0 116-117 2.125 0.0 0.0 0.0 0.0 118-119 2.5 0.0 0.0 0.0 0.0 120-121 2.85 0.0 0.0 0.0 0.0 122-123 3.0625 0.0 0.0 0.0 0.0 124-125 3.2750000000000004 0.0 0.0 0.0 0.0 126-127 3.5125 0.0 0.0 0.0 0.0 128-129 3.825 0.0 0.0 0.0 0.0 130-131 4.2125 0.0 0.0 0.0 0.0 132-133 4.6 0.0 0.0 0.0 0.0 134-135 4.95 0.0 0.0 0.0 0.0 136-137 5.325 0.0 0.0 0.0 0.0 138-139 5.8875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATGAAGG 10 0.0068484643 144.875 6 TGATAAT 10 0.0068484643 144.875 1 ATCTGTA 10 0.0068484643 144.875 6 >>END_MODULE Read 954040 spots for SRR7171896.sra Written 954040 spots for SRR7171896.sra Read 954040 spots for SRR7171896.sra Written 954040 spots for SRR7171896.sra Read 954040 spots for SRR7171896.sra Written 954040 spots for SRR7171896.sra Read 954040 spots for SRR7171896.sra Written 954040 spots for SRR7171896.sra Read 954040 spots for SRR7171896.sra Written 954040 spots for SRR7171896.sra Read 954040 spots for SRR7171896.sra Written 954040 spots for SRR7171896.sra Read 954040 spots for SRR7171896.sra Written 954040 spots for SRR7171896.sra Read 954040 spots for SRR7171896.sra Written 954040 spots for SRR7171896.sra Read 954040 spots for SRR7171896.sra Written 954040 spots for SRR7171896.sra Read 954040 spots for SRR7171896.sra Written 954040 spots for SRR7171896.sra Read 954040 spots for SRR7171896.sra Written 954040 spots for SRR7171896.sra Read 954040 spots for SRR7171896.sra Written 954040 spots for SRR7171896.sra Read 954040 spots for SRR7171896.sra Written 954040 spots for SRR7171896.sra Read 954040 spots for SRR7171896.sra Written 954040 spots for SRR7171896.sra Read 954040 spots for SRR7171896.sra Written 954040 spots for SRR7171896.sra Read 954040 spots for SRR7171896.sra Written 954040 spots for SRR7171896.sra Read 954040 spots for SRR7171896.sra Written 954040 spots for SRR7171896.sra Read 954040 spots for SRR7171896.sra Written 954040 spots for SRR7171896.sra Read 954040 spots for SRR7171896.sra Written 954040 spots for SRR7171896.sra Read 954043 spots for SRR7171896.sra Written 954043 spots for SRR7171896.sra SRR ids: ['SRR7171896.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rhqv6adh SRR7171896.sra spots: 19080803 blocks: [[1, 954040], [954041, 1908080], [1908081, 2862120], [2862121, 3816160], [3816161, 4770200], [4770201, 5724240], [5724241, 6678280], [6678281, 7632320], [7632321, 8586360], [8586361, 9540400], [9540401, 10494440], [10494441, 11448480], [11448481, 12402520], [12402521, 13356560], [13356561, 14310600], [14310601, 15264640], [15264641, 16218680], [16218681, 17172720], [17172721, 18126760], [18126761, 19080803]] SRR7171896 file size 6444157 SRR7171896 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171896 SRR7171896_1.fastq SRR7171896_2.fastq Input file: SRR7171896_1.fastq Paired file: SRR7171896_2.fastq trimmed: SRR7171896-trimmed-pair1.fastq, SRR7171896-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 23:35:04 2025 >> started Thu Feb 13 23:35:27 2025 >> done (23.314s) 19080803 read pairs processed; of these: 13667 ( 0.07%) short read pairs filtered out after trimming by size control 8640 ( 0.05%) empty read pairs filtered out after trimming by size control 19058496 (99.88%) read pairs available; of these: 8053025 (42.25%) trimmed read pairs available after processing 11005471 (57.75%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 5 0.00% 20 6 0.00% 21 7 0.00% 22 3 0.00% 23 10 0.00% 24 7 0.00% 25 8 0.00% 26 6 0.00% 27 7 0.00% 28 3 0.00% 29 5 0.00% 30 11 0.00% 31 7 0.00% 32 11 0.00% 33 6 0.00% 34 13 0.00% 35 12 0.00% 36 5 0.00% 37 13 0.00% 38 7 0.00% 39 12 0.00% 40 12 0.00% 41 14 0.00% 42 10 0.00% 43 12 0.00% 44 13 0.00% 45 20 0.00% 46 31 0.00% 47 23 0.00% 48 25 0.00% 49 27 0.00% 50 36 0.00% 51 51 0.00% 52 58 0.00% 53 72 0.00% 54 81 0.00% 55 76 0.00% 56 102 0.00% 57 111 0.00% 58 135 0.00% 59 142 0.00% 60 184 0.00% 61 196 0.00% 62 224 0.00% 63 217 0.00% 64 307 0.00% 65 293 0.00% 66 398 0.00% 67 404 0.00% 68 454 0.00% 69 534 0.00% 70 600 0.00% 71 717 0.00% 72 813 0.00% 73 956 0.01% 74 1096 0.01% 75 1263 0.01% 76 1513 0.01% 77 1569 0.01% 78 1813 0.01% 79 1916 0.01% 80 2221 0.01% 81 2615 0.01% 82 2831 0.01% 83 3314 0.02% 84 4285 0.02% 85 4964 0.03% 86 5469 0.03% 87 6125 0.03% 88 6392 0.03% 89 6942 0.04% 90 7502 0.04% 91 8116 0.04% 92 8645 0.05% 93 9476 0.05% 94 9880 0.05% 95 10574 0.06% 96 11079 0.06% 97 11679 0.06% 98 12297 0.06% 99 13225 0.07% 100 13998 0.07% 101 14706 0.08% 102 15854 0.08% 103 16667 0.09% 104 17705 0.09% 105 18623 0.10% 106 19719 0.10% 107 20376 0.11% 108 21242 0.11% 109 21835 0.11% 110 23114 0.12% 111 24289 0.13% 112 25758 0.14% 113 27153 0.14% 114 28402 0.15% 115 29535 0.15% 116 30395 0.16% 117 31359 0.16% 118 32139 0.17% 119 33433 0.18% 120 34567 0.18% 121 35847 0.19% 122 37585 0.20% 123 38830 0.20% 124 40864 0.21% 125 42268 0.22% 126 43732 0.23% 127 45560 0.24% 128 46359 0.24% 129 48529 0.25% 130 50217 0.26% 131 51921 0.27% 132 54888 0.29% 133 57266 0.30% 134 60361 0.32% 135 63692 0.33% 136 66784 0.35% 137 70166 0.37% 138 74033 0.39% 139 78230 0.41% 140 83712 0.44% 141 90595 0.48% 142 99195 0.52% 143 110459 0.58% 144 126752 0.67% 145 149578 0.78% 146 183266 0.96% 147 246337 1.29% 148 378440 1.99% 149 770000 4.04% 150 4142369 21.74% 151 11005471 57.75% 19058496 reads passed initial QC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=3.03 fanout-score-rank=26 prefix-density=0.49 prefix-fanout=2.1 sequence=CACTTGCAGCCATTCTCAGCACCA criterion=fanout-score sequence-density=0.06 sequence-density-rank=27 fanout-score=195.22 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=24.9 sequence=CAGCAGCAGCATGCACGCATATGATACTGACCGATCATTCATGCCTGTGCTGTTGGTAGCTGGGTAAGGTGATGATCCTCAATGTCTTTGCTGCAATGGATGCAAAACTCAAGCAACGTTTGAGGATCTGGAACGTTCTCATTTAGCTTCTCATATTCAAAAGTCCAGTGAGCCAAGCAGCTGCCCTCTCCTTTGGGAGTAGCTTGAACGATAATTATGAAATTCTTGTACTCCGTGGTGATGTCTCCTTCAATCACTTTGAAGGTGGTTGACAGCTTCTCATCGTCTATAGCTTCAATAACCTCCTTAGCAGTCTTAGCAACCCCATCATGTACATAACTCCAGCAGATTACAGTGCCCGGCTTCCCCCATTCACCTTCATGCAGATCAACATTCTGTATCTTGGCAGGGCTCATATTGGAAACGTGGTGTGGTCTGCAGCTGAAGATATCATGAAATGTTTCAGCAGAAACTTTGATCTCTACTTCAGCCTCCATCTTACCAAAGAGTG criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=2.81 fanout-score-rank=21 prefix-density=0.46 prefix-fanout=2.7 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.10 sequence-density-rank=26 fanout-score=28.63 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=8.2 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7171896 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 23:36:11 Started mapping on | Feb 13 23:36:11 Finished on | Feb 13 23:38:40 Mapping speed, Million of reads per hour | 460.47 Number of input reads | 19058496 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 17295466 Uniquely mapped reads % | 90.75% Average mapped length | 294.55 Number of splices: Total | 17686342 Number of splices: Annotated (sjdb) | 17387174 Number of splices: GT/AG | 17417061 Number of splices: GC/AG | 217640 Number of splices: AT/AC | 13277 Number of splices: Non-canonical | 38364 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.03% Deletion average length | 2.57 Insertion rate per base | 0.02% Insertion average length | 2.54 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 395068 % of reads mapped to multiple loci | 2.07% Number of reads mapped to too many loci | 49901 % of reads mapped to too many loci | 0.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.86% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1382680 1382680 1382680 N_multimapping 395068 395068 395068 N_noFeature 359213 17148912 418315 N_ambiguous 173292 1208 85022 UnstrandedReadsAssigned:16762961 PositiveStrandReadsAssigned:145346 NegativeStrandReadsAssigned:16792129 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7171896 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171896-trimmed-pair1.fastq SRR7171896-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,058,496 reads, 16,689,544 reads pseudoaligned [quant] estimated average fragment length: 238.886 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,161 rounds 52401 SRR7171896.ke.tsv 34699 SRR7171896.se.tsv 87100 total ==> SRR7171896.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1780.11 1573 50.8741 Potri.005G024800.1.v4.1 1035 797.114 371 26.796 Potri.004G059700.1.v4.1 961 723.122 18 1.4331 Potri.007G009000.2.v4.1 1416 1178.11 0 0 Potri.003G141000.2.v4.1 2943 2705.11 824.405 17.5457 Potri.016G087400.1.v4.1 270 78.6043 1253 917.742 Potri.015G069301.1.v4.1 564 329.43 0 0 Potri.010G195200.1.v4.1 1773 1535.11 245 9.18843 Potri.012G127500.1.v4.1 977 739.114 6267 488.162 ==> SRR7171896.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 21 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 350 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 143 SRR7171896 completed mapping pipeline successfully