Starting /dee2/code/volunteer_pipeline.sh SRR7171897 current disk space = 3089241993216 free memory = 1405909696 SRR7171897 SRAfilesize 74771ad0a6e7a80f718fd6006c407f4b SRR7171897.sra SRR7171897.sra file validated SRR7171897 is paired end SRR7171897 is conventional basespace SRR7171897 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171897_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.36275 33.0 33.0 33.0 32.0 34.0 2 32.826 33.0 33.0 34.0 31.0 34.0 3 32.27175 33.0 32.0 33.0 31.0 34.0 4 31.534 33.0 31.0 33.0 29.0 34.0 5 32.05 33.0 32.0 33.0 31.0 34.0 6 36.257 38.0 36.0 38.0 33.0 38.0 7 36.983 38.0 37.0 38.0 35.0 38.0 8 37.177 38.0 38.0 38.0 36.0 38.0 9 37.36925 38.0 38.0 38.0 36.0 38.0 10-14 37.467600000000004 38.0 38.0 38.0 37.0 38.0 15-19 37.529250000000005 38.0 38.0 38.0 37.6 38.0 20-24 37.5604 38.0 38.0 38.0 38.0 38.0 25-29 37.54845 38.0 38.0 38.0 38.0 38.0 30-34 37.54665 38.0 38.0 38.0 38.0 38.0 35-39 37.518049999999995 38.0 38.0 38.0 37.6 38.0 40-44 37.492599999999996 38.0 38.0 38.0 37.4 38.0 45-49 37.45635 38.0 38.0 38.0 37.2 38.0 50-54 37.3999 38.0 38.0 38.0 37.0 38.0 55-59 37.38885 38.0 38.0 38.0 37.0 38.0 60-64 37.31655 38.0 38.0 38.0 37.0 38.0 65-69 37.289649999999995 38.0 38.0 38.0 37.0 38.0 70-74 37.226200000000006 38.0 38.0 38.0 36.0 38.0 75-79 37.19315 38.0 38.0 38.0 36.2 38.0 80-84 37.1066 38.0 38.0 38.0 36.0 38.0 85-89 37.12510000000001 38.0 38.0 38.0 36.0 38.0 90-94 37.007 38.0 38.0 38.0 35.8 38.0 95-99 36.89695 38.0 38.0 38.0 35.2 38.0 100-104 36.7738 38.0 38.0 38.0 35.0 38.0 105-109 36.702749999999995 38.0 38.0 38.0 34.6 38.0 110-114 36.45705 38.0 37.8 38.0 34.0 38.0 115-119 36.371300000000005 38.0 38.0 38.0 34.0 38.0 120-124 36.21810000000001 38.0 37.4 38.0 33.8 38.0 125-129 36.1851 38.0 37.4 38.0 33.8 38.0 130-134 35.8857 38.0 36.6 38.0 32.2 38.0 135-139 35.6228 38.0 36.0 38.0 31.4 38.0 140-144 35.30165 38.0 36.0 38.0 30.4 38.0 145-149 34.9578 38.0 35.4 38.0 30.4 38.0 150-151 31.834 36.5 31.5 38.0 14.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 0.0 16 1.0 17 3.0 18 0.0 19 1.0 20 1.0 21 2.0 22 4.0 23 5.0 24 5.0 25 8.0 26 12.0 27 17.0 28 25.0 29 19.0 30 28.0 31 38.0 32 43.0 33 67.0 34 117.0 35 241.0 36 639.0 37 2723.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.08352088022005 16.054013503375845 11.202800700175043 38.65966491622906 2 18.775 20.4 35.575 25.25 3 17.724999999999998 27.025 23.65 31.6 4 21.025 35.199999999999996 19.05 24.725 5 18.775 39.324999999999996 21.975 19.925 6 18.05 36.075 25.55 20.325 7 13.25 23.724999999999998 42.449999999999996 20.575 8 17.525 23.474999999999998 32.1 26.900000000000002 9 17.8 22.7 32.775 26.724999999999998 10-14 19.37 30.17 27.01 23.45 15-19 19.759999999999998 28.694999999999997 27.689999999999998 23.855 20-24 19.75 28.935 27.51 23.805 25-29 19.32 29.38 27.32 23.98 30-34 19.2 28.965000000000003 27.32 24.515 35-39 19.39 28.74 27.839999999999996 24.03 40-44 20.015 28.58 27.27 24.135 45-49 19.66 28.544999999999998 27.85 23.945 50-54 20.150000000000002 28.804999999999996 26.974999999999998 24.07 55-59 19.975 28.299999999999997 27.525 24.2 60-64 20.4 28.660000000000004 27.24 23.7 65-69 19.625 28.59 27.525 24.26 70-74 19.830000000000002 28.62 27.37 24.18 75-79 20.505000000000003 28.110000000000003 27.51 23.875 80-84 20.195 28.525 27.58 23.7 85-89 19.85 28.28 27.834999999999997 24.035 90-94 19.97 28.139999999999997 27.32 24.57 95-99 20.49 28.435 27.35 23.724999999999998 100-104 20.385 28.139999999999997 27.48 23.995 105-109 20.66 28.43 27.18 23.73 110-114 20.36 28.310000000000002 27.845 23.485 115-119 20.24 28.37 27.765 23.625 120-124 20.724999999999998 28.084999999999997 27.185 24.005000000000003 125-129 20.89 28.275 26.740000000000002 24.095 130-134 20.395 28.060000000000002 27.38 24.165 135-139 19.8 28.725 27.42 24.055 140-144 20.105 28.634999999999998 27.685 23.575 145-149 20.395 28.299999999999997 27.060000000000002 24.245 150-151 21.025 27.6125 27.537499999999998 23.825 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 2.0 23 2.5 24 1.5 25 2.0 26 5.0 27 8.5 28 12.0 29 12.5 30 16.0 31 26.0 32 27.5 33 33.5 34 52.0 35 70.0 36 94.0 37 117.0 38 132.5 39 157.0 40 189.0 41 213.0 42 231.0 43 256.0 44 274.5 45 285.5 46 291.5 47 262.5 48 235.5 49 215.0 50 173.5 51 146.5 52 120.0 53 86.5 54 61.0 55 51.5 56 38.5 57 22.5 58 18.5 59 13.5 60 10.0 61 8.0 62 8.0 63 6.0 64 3.5 65 2.5 66 1.5 67 0.5 68 0.0 69 1.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.30000000000000004 0.0 0.0 0.0 0.0 98-99 0.3875 0.0 0.0 0.0 0.0 100-101 0.4375 0.0 0.0 0.0 0.0 102-103 0.5 0.0 0.0 0.0 0.0 104-105 0.6000000000000001 0.0 0.0 0.0 0.0 106-107 0.7375 0.0 0.0 0.0 0.0 108-109 0.85 0.0 0.0 0.0 0.0 110-111 1.0375 0.0 0.0 0.0 0.0 112-113 1.15 0.0 0.0 0.0 0.0 114-115 1.2625 0.0 0.0 0.0 0.0 116-117 1.3250000000000002 0.0 0.0 0.0 0.0 118-119 1.4125 0.0 0.0 0.0 0.0 120-121 1.5625 0.0 0.0 0.0 0.0 122-123 1.7125 0.0 0.0 0.0 0.0 124-125 1.9 0.0 0.0 0.0 0.0 126-127 2.225 0.0 0.0 0.0 0.0 128-129 2.4125 0.0 0.0 0.0 0.0 130-131 2.6625 0.0 0.0 0.0 0.0 132-133 2.8499999999999996 0.0 0.0 0.0 0.0 134-135 3.15 0.0 0.0 0.0 0.0 136-137 3.425 0.0 0.0 0.0 0.0 138-139 3.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7171897 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171897_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.02025 33.0 33.0 34.0 32.0 34.0 2 33.1215 34.0 33.0 34.0 33.0 34.0 3 33.1685 34.0 33.0 34.0 33.0 34.0 4 33.1215 34.0 33.0 34.0 33.0 34.0 5 33.16975 34.0 33.0 34.0 33.0 34.0 6 37.28875 38.0 38.0 38.0 37.0 38.0 7 37.39875 38.0 38.0 38.0 38.0 38.0 8 37.34975 38.0 38.0 38.0 37.0 38.0 9 37.337 38.0 38.0 38.0 37.0 38.0 10-14 37.245349999999995 38.0 38.0 38.0 37.0 38.0 15-19 37.251900000000006 38.0 38.0 38.0 37.0 38.0 20-24 37.2705 38.0 38.0 38.0 37.0 38.0 25-29 37.2331 38.0 38.0 38.0 37.0 38.0 30-34 37.211650000000006 38.0 38.0 38.0 37.0 38.0 35-39 36.904849999999996 38.0 38.0 38.0 36.6 38.0 40-44 36.76825 38.0 38.0 38.0 36.0 38.0 45-49 37.09545 38.0 38.0 38.0 36.6 38.0 50-54 37.1089 38.0 38.0 38.0 36.8 38.0 55-59 37.07855 38.0 38.0 38.0 36.2 38.0 60-64 37.03394999999999 38.0 38.0 38.0 36.0 38.0 65-69 37.02235 38.0 38.0 38.0 36.2 38.0 70-74 36.97245 38.0 38.0 38.0 36.0 38.0 75-79 36.92274999999999 38.0 38.0 38.0 36.0 38.0 80-84 36.85665 38.0 38.0 38.0 36.0 38.0 85-89 36.7102 38.0 38.0 38.0 35.2 38.0 90-94 36.658249999999995 38.0 38.0 38.0 34.8 38.0 95-99 36.58515 38.0 38.0 38.0 34.6 38.0 100-104 36.403150000000004 38.0 38.0 38.0 34.0 38.0 105-109 36.340900000000005 38.0 38.0 38.0 34.0 38.0 110-114 36.26825 38.0 38.0 38.0 34.0 38.0 115-119 36.15220000000001 38.0 37.8 38.0 33.8 38.0 120-124 35.81885 38.0 37.0 38.0 32.6 38.0 125-129 35.66845 38.0 36.4 38.0 31.8 38.0 130-134 35.44539999999999 38.0 36.2 38.0 31.0 38.0 135-139 35.178399999999996 38.0 36.0 38.0 29.6 38.0 140-144 34.872400000000006 38.0 35.8 38.0 28.2 38.0 145-149 34.39155 38.0 35.4 38.0 27.4 38.0 150-151 31.061875 36.5 29.5 38.0 14.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 3.0 4 0.0 5 1.0 6 1.0 7 1.0 8 0.0 9 2.0 10 0.0 11 1.0 12 1.0 13 3.0 14 2.0 15 2.0 16 3.0 17 2.0 18 6.0 19 2.0 20 3.0 21 4.0 22 9.0 23 12.0 24 14.0 25 13.0 26 15.0 27 18.0 28 24.0 29 31.0 30 26.0 31 26.0 32 54.0 33 96.0 34 138.0 35 225.0 36 558.0 37 2701.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.875 17.375 16.150000000000002 28.599999999999998 2 25.25 23.3 34.599999999999994 16.85 3 21.05 28.9 29.925 20.125 4 24.4 34.849999999999994 23.225 17.525 5 24.775 37.2 20.05 17.974999999999998 6 19.3 38.275 23.95 18.475 7 20.225 17.525 41.325 20.925 8 22.8 22.875 27.400000000000002 26.924999999999997 9 22.650000000000002 26.150000000000002 27.474999999999998 23.724999999999998 10-14 23.885 28.605000000000004 25.985000000000003 21.525 15-19 23.47 27.725 27.85 20.955 20-24 24.044999999999998 28.689999999999998 27.005000000000003 20.26 25-29 23.95 28.215 27.42 20.415 30-34 23.255581139253177 28.51136249874862 27.390129142056264 20.842927219941938 35-39 23.70848243536112 28.22438385162038 27.402852678796428 20.664281034222064 40-44 23.803996770286638 28.4517561566411 27.058942268873636 20.68530480419863 45-49 23.275000000000002 28.084999999999997 27.889999999999997 20.75 50-54 24.14 27.744999999999997 27.51 20.605 55-59 23.11 28.165000000000003 27.944999999999997 20.78 60-64 24.21 27.889999999999997 27.63 20.27 65-69 24.275 27.76 27.98 19.985 70-74 23.985 27.68 27.85 20.485 75-79 23.925 27.325 28.110000000000003 20.64 80-84 23.965 28.395 27.565 20.075000000000003 85-89 24.04 27.49 27.775 20.695 90-94 24.12 27.375 28.02 20.485 95-99 24.255 27.415 27.765 20.565 100-104 24.060000000000002 27.305 28.18 20.455000000000002 105-109 24.15 27.800000000000004 27.87 20.18 110-114 24.104999999999997 28.175 27.74 19.98 115-119 24.404999999999998 27.944999999999997 27.675 19.975 120-124 23.855 27.785 27.72 20.64 125-129 24.595 27.644999999999996 27.26 20.5 130-134 24.465 27.76 28.060000000000002 19.715 135-139 24.54 28.000000000000004 27.77 19.689999999999998 140-144 24.765 27.715 27.83 19.689999999999998 145-149 25.009999999999998 27.27 28.12 19.6 150-151 25.837500000000002 26.9625 27.825 19.375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.5 24 0.5 25 3.0 26 3.5 27 1.5 28 5.5 29 8.5 30 8.5 31 12.5 32 19.0 33 28.0 34 40.5 35 49.5 36 67.5 37 89.5 38 113.0 39 154.0 40 186.5 41 229.0 42 267.0 43 282.5 44 299.0 45 294.0 46 279.5 47 266.0 48 250.0 49 224.5 50 200.5 51 161.0 52 115.5 53 82.5 54 60.0 55 54.5 56 43.5 57 30.0 58 18.0 59 16.5 60 13.0 61 4.5 62 4.0 63 3.5 64 2.0 65 2.5 66 1.5 67 0.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.11 35-39 0.795 40-44 0.9199999999999999 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59768669851647 99.02499999999999 2 0.3268795574553684 0.65 3 0.025144581342720643 0.075 4 0.025144581342720643 0.1 5 0.0 0.0 6 0.025144581342720643 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTAGGCTTGAGCAGATTCATTCGCCAACTAACCCTTTAATTTATCCTAT 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.30000000000000004 0.0 0.0 0.0 0.0 98-99 0.3875 0.0 0.0 0.0 0.0 100-101 0.4375 0.0 0.0 0.0 0.0 102-103 0.5 0.0 0.0 0.0 0.0 104-105 0.6000000000000001 0.0 0.0 0.0 0.0 106-107 0.7375 0.0 0.0 0.0 0.0 108-109 0.85 0.0 0.0 0.0 0.0 110-111 1.05 0.0 0.0 0.0 0.0 112-113 1.1749999999999998 0.0 0.0 0.0 0.0 114-115 1.2875 0.0 0.0 0.0 0.0 116-117 1.35 0.0 0.0 0.0 0.0 118-119 1.45 0.0 0.0 0.0 0.0 120-121 1.6124999999999998 0.0 0.0 0.0 0.0 122-123 1.7875 0.0 0.0 0.0 0.0 124-125 1.9749999999999999 0.0 0.0 0.0 0.0 126-127 2.3125 0.0 0.0 0.0 0.0 128-129 2.4875 0.0 0.0 0.0 0.0 130-131 2.7 0.0 0.0 0.0 0.0 132-133 2.875 0.0 0.0 0.0 0.0 134-135 3.175 0.0 0.0 0.0 0.0 136-137 3.45 0.0 0.0 0.0 0.0 138-139 3.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGCAGC 40 0.005648267 54.309376 9 >>END_MODULE Read 771481 spots for SRR7171897.sra Written 771481 spots for SRR7171897.sra Read 771481 spots for SRR7171897.sra Written 771481 spots for SRR7171897.sra Read 771481 spots for SRR7171897.sra Written 771481 spots for SRR7171897.sra Read 771481 spots for SRR7171897.sra Written 771481 spots for SRR7171897.sra Read 771481 spots for SRR7171897.sra Written 771481 spots for SRR7171897.sra Read 771481 spots for SRR7171897.sra Written 771481 spots for SRR7171897.sra Read 771481 spots for SRR7171897.sra Written 771481 spots for SRR7171897.sra Read 771481 spots for SRR7171897.sra Written 771481 spots for SRR7171897.sra Read 771481 spots for SRR7171897.sra Written 771481 spots for SRR7171897.sra Read 771481 spots for SRR7171897.sra Written 771481 spots for SRR7171897.sra Read 771481 spots for SRR7171897.sra Written 771481 spots for SRR7171897.sra Read 771481 spots for SRR7171897.sra Written 771481 spots for SRR7171897.sra Read 771481 spots for SRR7171897.sra Written 771481 spots for SRR7171897.sra Read 771481 spots for SRR7171897.sra Written 771481 spots for SRR7171897.sra Read 771481 spots for SRR7171897.sra Written 771481 spots for SRR7171897.sra Read 771481 spots for SRR7171897.sra Written 771481 spots for SRR7171897.sra Read 771481 spots for SRR7171897.sra Written 771481 spots for SRR7171897.sra Read 771481 spots for SRR7171897.sra Written 771481 spots for SRR7171897.sra Read 771481 spots for SRR7171897.sra Written 771481 spots for SRR7171897.sra Read 771491 spots for SRR7171897.sra Written 771491 spots for SRR7171897.sra SRR ids: ['SRR7171897.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_it672mz8 SRR7171897.sra spots: 15429630 blocks: [[1, 771481], [771482, 1542962], [1542963, 2314443], [2314444, 3085924], [3085925, 3857405], [3857406, 4628886], [4628887, 5400367], [5400368, 6171848], [6171849, 6943329], [6943330, 7714810], [7714811, 8486291], [8486292, 9257772], [9257773, 10029253], [10029254, 10800734], [10800735, 11572215], [11572216, 12343696], [12343697, 13115177], [13115178, 13886658], [13886659, 14658139], [14658140, 15429630]] SRR7171897 file size 5206894 SRR7171897 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171897 SRR7171897_1.fastq SRR7171897_2.fastq Input file: SRR7171897_1.fastq Paired file: SRR7171897_2.fastq trimmed: SRR7171897-trimmed-pair1.fastq, SRR7171897-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 23:30:24 2025 >> started Thu Feb 13 23:30:42 2025 >> done (17.487s) 15429630 read pairs processed; of these: 10513 ( 0.07%) short read pairs filtered out after trimming by size control 7300 ( 0.05%) empty read pairs filtered out after trimming by size control 15411817 (99.88%) read pairs available; of these: 6055313 (39.29%) trimmed read pairs available after processing 9356504 (60.71%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 4 0.00% 21 1 0.00% 22 3 0.00% 23 0 0.00% 24 5 0.00% 25 3 0.00% 26 1 0.00% 27 1 0.00% 28 2 0.00% 29 5 0.00% 30 3 0.00% 31 3 0.00% 32 2 0.00% 33 0 0.00% 34 2 0.00% 35 3 0.00% 36 4 0.00% 37 6 0.00% 38 1 0.00% 39 7 0.00% 40 4 0.00% 41 9 0.00% 42 10 0.00% 43 5 0.00% 44 8 0.00% 45 8 0.00% 46 9 0.00% 47 7 0.00% 48 13 0.00% 49 26 0.00% 50 15 0.00% 51 12 0.00% 52 27 0.00% 53 27 0.00% 54 24 0.00% 55 30 0.00% 56 38 0.00% 57 45 0.00% 58 52 0.00% 59 58 0.00% 60 76 0.00% 61 78 0.00% 62 98 0.00% 63 102 0.00% 64 112 0.00% 65 126 0.00% 66 149 0.00% 67 153 0.00% 68 183 0.00% 69 199 0.00% 70 235 0.00% 71 263 0.00% 72 314 0.00% 73 370 0.00% 74 437 0.00% 75 476 0.00% 76 573 0.00% 77 633 0.00% 78 646 0.00% 79 760 0.00% 80 801 0.01% 81 990 0.01% 82 1192 0.01% 83 1312 0.01% 84 1872 0.01% 85 2390 0.02% 86 2469 0.02% 87 2789 0.02% 88 2810 0.02% 89 3105 0.02% 90 3348 0.02% 91 3695 0.02% 92 4047 0.03% 93 4130 0.03% 94 4417 0.03% 95 4766 0.03% 96 5143 0.03% 97 5454 0.04% 98 5771 0.04% 99 6225 0.04% 100 6528 0.04% 101 7113 0.05% 102 7764 0.05% 103 8317 0.05% 104 8828 0.06% 105 9255 0.06% 106 9923 0.06% 107 10324 0.07% 108 10745 0.07% 109 11359 0.07% 110 11967 0.08% 111 12780 0.08% 112 13412 0.09% 113 14091 0.09% 114 14784 0.10% 115 15566 0.10% 116 16431 0.11% 117 16923 0.11% 118 17734 0.12% 119 18419 0.12% 120 18919 0.12% 121 20168 0.13% 122 20991 0.14% 123 22134 0.14% 124 23142 0.15% 125 24754 0.16% 126 25734 0.17% 127 26882 0.17% 128 27548 0.18% 129 29052 0.19% 130 30156 0.20% 131 31807 0.21% 132 33688 0.22% 133 35335 0.23% 134 37729 0.24% 135 40056 0.26% 136 42332 0.27% 137 44837 0.29% 138 48249 0.31% 139 51852 0.34% 140 56154 0.36% 141 61718 0.40% 142 68618 0.45% 143 77996 0.51% 144 91442 0.59% 145 109670 0.71% 146 137672 0.89% 147 189755 1.23% 148 299501 1.94% 149 617888 4.01% 150 3394077 22.02% 151 9356504 60.71% 15411817 reads passed initial QC criterion=sequence-density sequence-density=0.77 sequence-density-rank=1 fanout-score=2.71 fanout-score-rank=25 prefix-density=1.04 prefix-fanout=2.0 sequence=CACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.03 sequence-density-rank=31 fanout-score=73.02 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=8.1 sequence=CAAGAACAAAGATCATGCCACCAAAGGCCCAAGCGAT criterion=sequence-density sequence-density=0.99 sequence-density-rank=1 fanout-score=2.68 fanout-score-rank=20 prefix-density=1.01 prefix-fanout=2.6 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.15 sequence-density-rank=19 fanout-score=49.74 fanout-score-rank=1 prefix-density=0.52 prefix-fanout=13.9 sequence=TTGGTGCTGAGA SRR7171897 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 23:31:25 Started mapping on | Feb 13 23:31:25 Finished on | Feb 13 23:32:56 Mapping speed, Million of reads per hour | 609.70 Number of input reads | 15411817 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 14632735 Uniquely mapped reads % | 94.94% Average mapped length | 296.55 Number of splices: Total | 15000489 Number of splices: Annotated (sjdb) | 14726698 Number of splices: GT/AG | 14768255 Number of splices: GC/AG | 186047 Number of splices: AT/AC | 12181 Number of splices: Non-canonical | 34006 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.69 Insertion rate per base | 0.02% Insertion average length | 2.55 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 346174 % of reads mapped to multiple loci | 2.25% Number of reads mapped to too many loci | 29064 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.57% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 443033 443033 443033 N_multimapping 346174 346174 346174 N_noFeature 362757 14508842 410788 N_ambiguous 148648 592 72574 UnstrandedReadsAssigned:14121330 PositiveStrandReadsAssigned:123301 NegativeStrandReadsAssigned:14149373 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7171897 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171897-trimmed-pair1.fastq SRR7171897-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,411,817 reads, 13,951,489 reads pseudoaligned [quant] estimated average fragment length: 250.252 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,122 rounds 52401 SRR7171897.ke.tsv 34699 SRR7171897.se.tsv 87100 total ==> SRR7171897.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1768.75 1521 55.691 Potri.005G024800.1.v4.1 1035 785.748 920 75.8274 Potri.004G059700.1.v4.1 961 711.748 22 2.00179 Potri.007G009000.2.v4.1 1416 1166.75 0 0 Potri.003G141000.2.v4.1 2943 2693.75 1034 24.8591 Potri.016G087400.1.v4.1 270 69.9077 995 921.765 Potri.015G069301.1.v4.1 564 317.378 0 0 Potri.010G195200.1.v4.1 1773 1523.75 369 15.6832 Potri.012G127500.1.v4.1 977 727.748 4505 400.899 ==> SRR7171897.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 32 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 450 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 429 SRR7171897 completed mapping pipeline successfully