Starting /dee2/code/volunteer_pipeline.sh SRR7171898 current disk space = 3089107668992 free memory = 1569559324 SRR7171898 SRAfilesize 37d5af1aefdcb32ea9bf1e29d58427a4 SRR7171898.sra SRR7171898.sra file validated SRR7171898 is paired end SRR7171898 is conventional basespace SRR7171898 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171898_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.9855 31.0 25.0 33.0 18.0 33.0 2 31.5935 33.0 31.0 33.0 29.0 33.0 3 31.77625 33.0 31.0 33.0 29.0 34.0 4 32.3545 33.0 33.0 33.0 31.0 34.0 5 32.51225 33.0 33.0 33.0 31.0 34.0 6 36.70125 38.0 37.0 38.0 34.0 38.0 7 37.02075 38.0 37.0 38.0 35.0 38.0 8 37.4545 38.0 38.0 38.0 37.0 38.0 9 37.49675 38.0 38.0 38.0 37.0 38.0 10-14 37.58245 38.0 38.0 38.0 38.0 38.0 15-19 37.560700000000004 38.0 38.0 38.0 38.0 38.0 20-24 37.5327 38.0 38.0 38.0 37.6 38.0 25-29 37.515550000000005 38.0 38.0 38.0 37.6 38.0 30-34 37.48755 38.0 38.0 38.0 37.6 38.0 35-39 37.4639 38.0 38.0 38.0 37.2 38.0 40-44 37.41465 38.0 38.0 38.0 37.0 38.0 45-49 37.35185 38.0 38.0 38.0 37.0 38.0 50-54 37.27669999999999 38.0 38.0 38.0 37.0 38.0 55-59 37.2506 38.0 38.0 38.0 36.8 38.0 60-64 37.140750000000004 38.0 38.0 38.0 36.2 38.0 65-69 37.128 38.0 38.0 38.0 36.0 38.0 70-74 37.0401 38.0 38.0 38.0 36.0 38.0 75-79 37.00095 38.0 38.0 38.0 36.0 38.0 80-84 36.8582 38.0 38.0 38.0 35.2 38.0 85-89 36.8316 38.0 38.0 38.0 35.2 38.0 90-94 36.7182 38.0 38.0 38.0 35.0 38.0 95-99 36.596199999999996 38.0 38.0 38.0 34.4 38.0 100-104 36.5067 38.0 38.0 38.0 34.0 38.0 105-109 36.27335 38.0 37.8 38.0 33.8 38.0 110-114 36.1952 38.0 37.4 38.0 33.8 38.0 115-119 36.0529 38.0 37.0 38.0 33.0 38.0 120-124 35.9142 38.0 37.0 38.0 32.8 38.0 125-129 35.663149999999995 38.0 36.4 38.0 31.4 38.0 130-134 35.2577 38.0 36.0 38.0 29.4 38.0 135-139 35.11985 38.0 35.8 38.0 29.4 38.0 140-144 34.6788 38.0 35.0 38.0 27.6 38.0 145-149 34.175149999999995 38.0 35.0 38.0 25.6 38.0 150-151 30.96575 36.5 31.0 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 0.0 10 1.0 11 0.0 12 1.0 13 0.0 14 1.0 15 1.0 16 3.0 17 3.0 18 4.0 19 1.0 20 5.0 21 6.0 22 7.0 23 6.0 24 14.0 25 8.0 26 8.0 27 15.0 28 22.0 29 26.0 30 31.0 31 45.0 32 55.0 33 81.0 34 159.0 35 283.0 36 721.0 37 2492.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.4 13.3 11.275 34.025 2 19.259629814907452 19.15957978989495 36.343171585792895 25.237618809404704 3 19.55 24.2 28.225 28.025 4 21.95 32.025 22.975 23.05 5 20.724999999999998 34.75 25.05 19.475 6 17.9 36.05 26.0 20.05 7 13.65 22.175 45.300000000000004 18.875 8 18.3 22.275 30.15 29.275000000000002 9 17.525 23.0 33.175 26.3 10-14 19.7 29.035 27.245 24.02 15-19 19.56 27.905 28.825 23.71 20-24 19.935 28.035 28.57 23.46 25-29 19.61 28.49 28.455000000000002 23.445 30-34 19.139999999999997 28.215 28.63 24.015 35-39 19.84 28.485 28.000000000000004 23.674999999999997 40-44 20.0 28.555000000000003 27.884999999999998 23.56 45-49 19.93 27.950000000000003 27.935 24.185000000000002 50-54 19.939999999999998 28.275 27.735 24.05 55-59 19.865 28.29 28.355000000000004 23.49 60-64 20.0 28.345 28.005000000000003 23.65 65-69 19.955000000000002 27.894999999999996 28.005000000000003 24.145 70-74 19.99 28.73 27.485 23.794999999999998 75-79 20.155 28.435 27.735 23.674999999999997 80-84 19.98 27.555000000000003 28.595 23.87 85-89 20.43 28.13 27.72 23.72 90-94 20.294999999999998 28.17 27.855 23.68 95-99 19.955000000000002 28.000000000000004 28.21 23.835 100-104 20.26 28.435 27.860000000000003 23.445 105-109 19.81 28.27 27.985 23.935000000000002 110-114 20.315 27.905 27.905 23.875 115-119 20.265 28.025 28.32 23.39 120-124 20.47 27.33 28.285 23.915 125-129 20.04 27.82 27.779999999999998 24.36 130-134 20.705000000000002 28.235 27.965 23.095 135-139 20.48 28.22 27.625 23.674999999999997 140-144 20.76 27.625 27.38 24.235 145-149 20.49 27.744999999999997 27.839999999999996 23.925 150-151 20.575 28.812500000000004 26.8625 23.75 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 1.5 24 2.5 25 3.0 26 4.5 27 6.0 28 9.0 29 13.5 30 18.0 31 20.5 32 28.5 33 39.0 34 49.0 35 60.5 36 86.0 37 117.0 38 133.0 39 157.5 40 195.0 41 228.0 42 260.5 43 285.0 44 295.0 45 291.0 46 283.5 47 265.0 48 225.5 49 196.0 50 180.0 51 141.0 52 98.0 53 84.0 54 62.5 55 42.0 56 27.0 57 13.5 58 15.0 59 17.5 60 14.5 61 8.5 62 4.5 63 3.0 64 2.5 65 1.5 66 1.0 67 1.0 68 1.5 69 1.5 70 1.5 71 1.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0125 0.0 84-85 0.05 0.0 0.0 0.025 0.0 86-87 0.05 0.0 0.0 0.025 0.0 88-89 0.0625 0.0 0.0 0.025 0.0 90-91 0.0875 0.0 0.0 0.025 0.0 92-93 0.1 0.0 0.0 0.025 0.0 94-95 0.1 0.0 0.0 0.025 0.0 96-97 0.1 0.0 0.0 0.025 0.0 98-99 0.1125 0.0 0.0 0.025 0.0 100-101 0.1375 0.0 0.0 0.025 0.0 102-103 0.1875 0.0 0.0 0.025 0.0 104-105 0.2375 0.0 0.0 0.025 0.0 106-107 0.3 0.0 0.0 0.025 0.0 108-109 0.36250000000000004 0.0 0.0 0.025 0.0 110-111 0.475 0.0 0.0 0.025 0.0 112-113 0.575 0.0 0.0 0.025 0.0 114-115 0.6625000000000001 0.0 0.0 0.025 0.0 116-117 0.7625 0.0 0.0 0.025 0.0 118-119 0.8374999999999999 0.0 0.0 0.025 0.0 120-121 0.9125000000000001 0.0 0.0 0.025 0.0 122-123 1.025 0.0 0.0 0.025 0.0 124-125 1.225 0.0 0.0 0.025 0.0 126-127 1.375 0.0 0.0 0.025 0.0 128-129 1.5625 0.0 0.0 0.025 0.0 130-131 1.8125 0.0 0.0 0.025 0.0 132-133 1.975 0.0 0.0 0.025 0.0 134-135 2.1 0.0 0.0 0.025 0.0 136-137 2.3125 0.0 0.0 0.025 0.0 138-139 2.45 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAAACAC 10 0.006830828 145.0 7 AATTAAA 10 0.006830828 145.0 4 TCACCTG 10 0.006830828 145.0 9 TTAAACA 10 0.006830828 145.0 6 AACACAC 10 0.006830828 145.0 9 >>END_MODULE SRR7171898 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171898_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.019 33.0 33.0 34.0 32.0 34.0 2 33.06025 34.0 33.0 34.0 32.0 34.0 3 33.076 34.0 33.0 34.0 32.0 34.0 4 33.05225 34.0 33.0 34.0 32.0 34.0 5 33.079 34.0 33.0 34.0 33.0 34.0 6 37.35025 38.0 38.0 38.0 37.0 38.0 7 37.34925 38.0 38.0 38.0 37.0 38.0 8 37.262 38.0 38.0 38.0 37.0 38.0 9 37.26025 38.0 38.0 38.0 37.0 38.0 10-14 37.2352 38.0 38.0 38.0 37.0 38.0 15-19 37.2158 38.0 38.0 38.0 37.0 38.0 20-24 37.2068 38.0 38.0 38.0 37.0 38.0 25-29 37.186350000000004 38.0 38.0 38.0 37.0 38.0 30-34 37.10635 38.0 38.0 38.0 36.8 38.0 35-39 36.8882 38.0 38.0 38.0 36.0 38.0 40-44 36.83315 38.0 38.0 38.0 36.0 38.0 45-49 37.043 38.0 38.0 38.0 36.2 38.0 50-54 36.99685 38.0 38.0 38.0 36.0 38.0 55-59 36.9565 38.0 38.0 38.0 36.0 38.0 60-64 36.944399999999995 38.0 38.0 38.0 36.0 38.0 65-69 36.85255 38.0 38.0 38.0 36.0 38.0 70-74 36.80135 38.0 38.0 38.0 35.6 38.0 75-79 36.80355 38.0 38.0 38.0 35.6 38.0 80-84 36.68145 38.0 38.0 38.0 35.0 38.0 85-89 36.60905 38.0 38.0 38.0 34.6 38.0 90-94 36.489700000000006 38.0 38.0 38.0 34.2 38.0 95-99 36.30035 38.0 37.8 38.0 33.8 38.0 100-104 36.24015 38.0 38.0 38.0 34.0 38.0 105-109 36.07 38.0 37.4 38.0 33.2 38.0 110-114 36.000299999999996 38.0 37.2 38.0 33.0 38.0 115-119 35.78145 38.0 37.0 38.0 31.6 38.0 120-124 35.6625 38.0 36.8 38.0 31.4 38.0 125-129 35.322500000000005 38.0 36.0 38.0 30.0 38.0 130-134 35.121449999999996 38.0 36.0 38.0 29.4 38.0 135-139 34.808949999999996 38.0 35.2 38.0 28.0 38.0 140-144 34.41565000000001 38.0 35.0 38.0 25.6 38.0 145-149 33.7858 38.0 35.0 38.0 22.8 38.0 150-151 30.295375 36.5 29.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 3.0 4 1.0 5 2.0 6 1.0 7 2.0 8 2.0 9 1.0 10 2.0 11 0.0 12 3.0 13 0.0 14 2.0 15 1.0 16 3.0 17 1.0 18 3.0 19 0.0 20 3.0 21 5.0 22 9.0 23 7.0 24 9.0 25 14.0 26 25.0 27 18.0 28 26.0 29 31.0 30 26.0 31 52.0 32 73.0 33 99.0 34 166.0 35 293.0 36 651.0 37 2460.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.725 18.125 16.05 25.1 2 24.625 25.1 33.650000000000006 16.625 3 19.525000000000002 28.125 31.85 20.5 4 24.4 34.125 22.35 19.125 5 23.875 37.0 21.575 17.549999999999997 6 19.925 37.5 24.025 18.55 7 19.0 18.099999999999998 40.949999999999996 21.95 8 21.45 22.725 27.200000000000003 28.625 9 20.925 25.6 30.0 23.474999999999998 10-14 22.965 29.244999999999997 26.619999999999997 21.17 15-19 23.35 27.765 27.845 21.04 20-24 22.945 28.765 27.544999999999998 20.745 25-29 23.085 28.03 27.894999999999996 20.990000000000002 30-34 22.46932131229652 28.524918607563237 28.37465564738292 20.631104432757326 35-39 23.071898708737375 28.06612068532382 27.744561121438977 21.117419484499823 40-44 23.06184012066365 28.964303670186027 27.22473604826546 20.749120160884868 45-49 23.345 27.400000000000002 28.43 20.825 50-54 23.335 27.685 28.17 20.810000000000002 55-59 23.365 28.305000000000003 27.185 21.145 60-64 23.745 28.27 27.405 20.580000000000002 65-69 23.45 28.055000000000003 27.37 21.125 70-74 23.765 28.189999999999998 27.97 20.075000000000003 75-79 24.325 27.54 27.384999999999998 20.75 80-84 23.244999999999997 28.37 27.47 20.915 85-89 24.01 27.92 27.52 20.549999999999997 90-94 23.995 28.255000000000003 27.36 20.39 95-99 23.61 28.785 27.52 20.085 100-104 23.925 28.415000000000003 27.295 20.365 105-109 24.03 27.79 27.705000000000002 20.474999999999998 110-114 23.905 27.66 27.785 20.65 115-119 23.95 28.715000000000003 27.525 19.81 120-124 23.799999999999997 28.415000000000003 27.584999999999997 20.200000000000003 125-129 23.974999999999998 28.310000000000002 27.284999999999997 20.43 130-134 23.77 28.315 27.46 20.455000000000002 135-139 23.915 28.575 27.045 20.465 140-144 23.785 28.87 26.795 20.549999999999997 145-149 24.27 28.52 26.865 20.345 150-151 24.55 28.287499999999998 27.450000000000003 19.7125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 1.0 24 1.5 25 3.0 26 3.5 27 3.5 28 6.5 29 7.0 30 9.0 31 17.5 32 21.0 33 25.5 34 41.5 35 51.5 36 67.0 37 97.0 38 129.0 39 163.0 40 187.0 41 224.0 42 279.5 43 296.0 44 300.0 45 314.5 46 309.5 47 268.5 48 233.0 49 209.5 50 169.0 51 134.5 52 109.5 53 84.5 54 60.5 55 50.0 56 33.5 57 23.0 58 19.0 59 11.0 60 10.0 61 8.0 62 4.0 63 2.5 64 3.0 65 2.0 66 1.0 67 1.5 68 1.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.17500000000000002 35-39 0.485 40-44 0.5499999999999999 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72382626161185 99.3 2 0.25106703489831783 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.025106703489831784 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTTGAGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTTATCC 8 0.2 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1125 0.0 0.0 0.0 0.0 100-101 0.1375 0.0 0.0 0.0 0.0 102-103 0.1875 0.0 0.0 0.0 0.0 104-105 0.2375 0.0 0.0 0.0 0.0 106-107 0.3 0.0 0.0 0.0 0.0 108-109 0.38749999999999996 0.0 0.0 0.0 0.0 110-111 0.5 0.0 0.0 0.0 0.0 112-113 0.6 0.0 0.0 0.0 0.0 114-115 0.6875 0.0 0.0 0.0 0.0 116-117 0.7875000000000001 0.0 0.0 0.0 0.0 118-119 0.8625 0.0 0.0 0.0 0.0 120-121 0.9375 0.0 0.0 0.0 0.0 122-123 1.0499999999999998 0.0 0.0 0.0 0.0 124-125 1.25 0.0 0.0 0.0 0.0 126-127 1.4 0.0 0.0 0.0 0.0 128-129 1.5875 0.0 0.0 0.0 0.0 130-131 1.8375 0.0 0.0 0.0 0.0 132-133 2.0 0.0 0.0 0.0 0.0 134-135 2.125 0.0 0.0 0.0 0.0 136-137 2.3375 0.0 0.0 0.0 0.0 138-139 2.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGCATC 10 0.0068573058 144.8125 9 AAAAAAA 35 0.0033111558 20.949366 35-39 >>END_MODULE Read 838910 spots for SRR7171898.sra Written 838910 spots for SRR7171898.sra Read 838910 spots for SRR7171898.sra Written 838910 spots for SRR7171898.sra Read 838910 spots for SRR7171898.sra Written 838910 spots for SRR7171898.sra Read 838910 spots for SRR7171898.sra Written 838910 spots for SRR7171898.sra Read 838910 spots for SRR7171898.sra Written 838910 spots for SRR7171898.sra Read 838910 spots for SRR7171898.sra Written 838910 spots for SRR7171898.sra Read 838910 spots for SRR7171898.sra Written 838910 spots for SRR7171898.sra Read 838910 spots for SRR7171898.sra Written 838910 spots for SRR7171898.sra Read 838910 spots for SRR7171898.sra Written 838910 spots for SRR7171898.sra Read 838910 spots for SRR7171898.sra Written 838910 spots for SRR7171898.sra Read 838910 spots for SRR7171898.sra Written 838910 spots for SRR7171898.sra Read 838910 spots for SRR7171898.sra Written 838910 spots for SRR7171898.sra Read 838910 spots for SRR7171898.sra Written 838910 spots for SRR7171898.sra Read 838914 spots for SRR7171898.sra Written 838914 spots for SRR7171898.sra Read 838910 spots for SRR7171898.sra Written 838910 spots for SRR7171898.sra Read 838910 spots for SRR7171898.sra Written 838910 spots for SRR7171898.sra Read 838910 spots for SRR7171898.sra Written 838910 spots for SRR7171898.sra Read 838910 spots for SRR7171898.sra Written 838910 spots for SRR7171898.sra Read 838910 spots for SRR7171898.sra Written 838910 spots for SRR7171898.sra Read 838910 spots for SRR7171898.sra Written 838910 spots for SRR7171898.sra SRR ids: ['SRR7171898.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pqa6cvgt SRR7171898.sra spots: 16778204 blocks: [[1, 838910], [838911, 1677820], [1677821, 2516730], [2516731, 3355640], [3355641, 4194550], [4194551, 5033460], [5033461, 5872370], [5872371, 6711280], [6711281, 7550190], [7550191, 8389100], [8389101, 9228010], [9228011, 10066920], [10066921, 10905830], [10905831, 11744740], [11744741, 12583650], [12583651, 13422560], [13422561, 14261470], [14261471, 15100380], [15100381, 15939290], [15939291, 16778204]] SRR7171898 file size 5663882 SRR7171898 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171898 SRR7171898_1.fastq SRR7171898_2.fastq Input file: SRR7171898_1.fastq Paired file: SRR7171898_2.fastq trimmed: SRR7171898-trimmed-pair1.fastq, SRR7171898-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 00:22:37 2025 >> started Fri Feb 14 00:22:55 2025 >> done (18.090s) 16778204 read pairs processed; of these: 17353 ( 0.10%) short read pairs filtered out after trimming by size control 11153 ( 0.07%) empty read pairs filtered out after trimming by size control 16749698 (99.83%) read pairs available; of these: 7250683 (43.29%) trimmed read pairs available after processing 9499015 (56.71%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 2 0.00% 20 4 0.00% 21 2 0.00% 22 1 0.00% 23 1 0.00% 24 4 0.00% 25 9 0.00% 26 4 0.00% 27 5 0.00% 28 1 0.00% 29 3 0.00% 30 3 0.00% 31 3 0.00% 32 3 0.00% 33 4 0.00% 34 3 0.00% 35 4 0.00% 36 4 0.00% 37 2 0.00% 38 3 0.00% 39 9 0.00% 40 11 0.00% 41 5 0.00% 42 10 0.00% 43 4 0.00% 44 11 0.00% 45 9 0.00% 46 13 0.00% 47 9 0.00% 48 22 0.00% 49 17 0.00% 50 19 0.00% 51 30 0.00% 52 26 0.00% 53 22 0.00% 54 30 0.00% 55 39 0.00% 56 39 0.00% 57 50 0.00% 58 63 0.00% 59 47 0.00% 60 51 0.00% 61 79 0.00% 62 78 0.00% 63 86 0.00% 64 96 0.00% 65 104 0.00% 66 145 0.00% 67 141 0.00% 68 115 0.00% 69 178 0.00% 70 189 0.00% 71 213 0.00% 72 230 0.00% 73 244 0.00% 74 301 0.00% 75 355 0.00% 76 398 0.00% 77 498 0.00% 78 514 0.00% 79 624 0.00% 80 632 0.00% 81 783 0.00% 82 912 0.01% 83 1014 0.01% 84 1883 0.01% 85 2350 0.01% 86 2456 0.01% 87 2701 0.02% 88 2765 0.02% 89 3018 0.02% 90 3166 0.02% 91 3175 0.02% 92 3526 0.02% 93 3749 0.02% 94 3912 0.02% 95 4128 0.02% 96 4479 0.03% 97 4822 0.03% 98 4790 0.03% 99 5161 0.03% 100 5598 0.03% 101 6061 0.04% 102 6521 0.04% 103 6874 0.04% 104 7228 0.04% 105 7837 0.05% 106 8283 0.05% 107 8907 0.05% 108 9184 0.05% 109 9620 0.06% 110 10414 0.06% 111 10874 0.06% 112 11865 0.07% 113 12335 0.07% 114 13000 0.08% 115 13831 0.08% 116 14679 0.09% 117 15305 0.09% 118 17392 0.10% 119 15432 0.09% 120 17463 0.10% 121 18371 0.11% 122 19591 0.12% 123 20834 0.12% 124 21973 0.13% 125 23118 0.14% 126 24572 0.15% 127 25582 0.15% 128 27309 0.16% 129 28641 0.17% 130 30744 0.18% 131 32420 0.19% 132 34949 0.21% 133 37340 0.22% 134 40366 0.24% 135 40245 0.24% 136 43723 0.26% 137 48422 0.29% 138 52890 0.32% 139 58413 0.35% 140 63833 0.38% 141 71940 0.43% 142 82595 0.49% 143 95150 0.57% 144 113935 0.68% 145 138443 0.83% 146 181035 1.08% 147 257283 1.54% 148 409678 2.45% 149 857559 5.12% 150 4056412 24.22% 151 9499015 56.71% 16749698 reads passed initial QC criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=3.51 fanout-score-rank=24 prefix-density=0.42 prefix-fanout=3.1 sequence=CCACATTTGCAGCCA criterion=fanout-score sequence-density=0.11 sequence-density-rank=26 fanout-score=31.87 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=10.0 sequence=ACACCAGCAATGATTGT criterion=sequence-density sequence-density=0.74 sequence-density-rank=1 fanout-score=2.44 fanout-score-rank=34 prefix-density=0.76 prefix-fanout=2.4 sequence=ATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=139.90 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=9.2 sequence=GAAAAATGGCGACTCCAATGAAGTACATTTGCTTGTTTATGTTTCTTGCAATTCTCAGCATTGCTGGGCTCAATCAAGTTGACGGGGCTGGTGAATGTGGGAAAAACACCACTCCTGACATGGAGGCTTTCAAGATGGCTCCTTGTGCATCAGCAGCACAGGATGAGAATTCTTCAGTTTCGAGCCAGTGCTGCGCTCGGGTGAAGAAAATTGGACAGAACCCAGCGTGCCTTTGTGCTGTTATGCTTTCCAACACTGCTAAGAGCTCTGGAATCAAGCCAGAAATTGCAATGACCATTCCCAAACGATGCAACATTGCTGATCGTCCTGTGGGCTACAAGTGTGGAG SRR7171898 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 00:23:40 Started mapping on | Feb 14 00:23:40 Finished on | Feb 14 00:25:22 Mapping speed, Million of reads per hour | 591.17 Number of input reads | 16749698 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 15740609 Uniquely mapped reads % | 93.98% Average mapped length | 296.78 Number of splices: Total | 15610101 Number of splices: Annotated (sjdb) | 15252110 Number of splices: GT/AG | 15340874 Number of splices: GC/AG | 209802 Number of splices: AT/AC | 13903 Number of splices: Non-canonical | 45522 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.65 Insertion rate per base | 0.02% Insertion average length | 2.57 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 432311 % of reads mapped to multiple loci | 2.58% Number of reads mapped to too many loci | 43797 % of reads mapped to too many loci | 0.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.09% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 593415 593415 593415 N_multimapping 432311 432311 432311 N_noFeature 496053 15587218 572317 N_ambiguous 173846 1093 95951 UnstrandedReadsAssigned:15070710 PositiveStrandReadsAssigned:152298 NegativeStrandReadsAssigned:15072341 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7171898 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171898-trimmed-pair1.fastq SRR7171898-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,749,698 reads, 14,913,654 reads pseudoaligned [quant] estimated average fragment length: 266.668 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,118 rounds 52401 SRR7171898.ke.tsv 34699 SRR7171898.se.tsv 87100 total ==> SRR7171898.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1752.33 1837 65.5646 Potri.005G024800.1.v4.1 1035 769.332 380 30.892 Potri.004G059700.1.v4.1 961 695.371 5 0.449707 Potri.007G009000.2.v4.1 1416 1150.33 0 0 Potri.003G141000.2.v4.1 2943 2677.33 644 15.0439 Potri.016G087400.1.v4.1 270 65.5723 652.495 622.348 Potri.015G069301.1.v4.1 564 303.434 0 0 Potri.010G195200.1.v4.1 1773 1507.33 1165.71 48.368 Potri.012G127500.1.v4.1 977 711.366 13700 1204.49 ==> SRR7171898.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 24 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 530 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 460 SRR7171898 completed mapping pipeline successfully