Starting /dee2/code/volunteer_pipeline.sh SRR7171899 current disk space = 3089313083392 free memory = 1449999748 SRR7171899 SRAfilesize 6a282b2aa190500abba2e253b43c2273 SRR7171899.sra SRR7171899.sra file validated SRR7171899 is paired end SRR7171899 is conventional basespace SRR7171899 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171899_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.29325 33.0 33.0 33.0 32.0 34.0 2 31.006 33.0 31.0 33.0 25.0 34.0 3 32.4725 33.0 33.0 34.0 31.0 34.0 4 32.4045 33.0 33.0 34.0 31.0 34.0 5 31.468 33.0 31.0 33.0 29.0 34.0 6 36.0 38.0 36.0 38.0 33.0 38.0 7 36.714 38.0 37.0 38.0 34.0 38.0 8 37.12975 38.0 38.0 38.0 36.0 38.0 9 37.297 38.0 38.0 38.0 37.0 38.0 10-14 37.39365 38.0 38.0 38.0 37.0 38.0 15-19 37.47855 38.0 38.0 38.0 37.0 38.0 20-24 37.416700000000006 38.0 38.0 38.0 37.0 38.0 25-29 37.34974999999999 38.0 38.0 38.0 37.0 38.0 30-34 37.4141 38.0 38.0 38.0 37.0 38.0 35-39 37.332499999999996 38.0 38.0 38.0 37.0 38.0 40-44 37.322900000000004 38.0 38.0 38.0 37.0 38.0 45-49 37.2348 38.0 38.0 38.0 36.8 38.0 50-54 37.2297 38.0 38.0 38.0 36.8 38.0 55-59 37.1789 38.0 38.0 38.0 36.0 38.0 60-64 37.12795 38.0 38.0 38.0 36.0 38.0 65-69 37.084050000000005 38.0 38.0 38.0 36.0 38.0 70-74 37.0903 38.0 38.0 38.0 36.0 38.0 75-79 37.03095 38.0 38.0 38.0 36.0 38.0 80-84 36.959250000000004 38.0 38.0 38.0 35.8 38.0 85-89 36.87865000000001 38.0 38.0 38.0 35.4 38.0 90-94 36.7714 38.0 38.0 38.0 35.0 38.0 95-99 36.7033 38.0 38.0 38.0 35.0 38.0 100-104 36.580949999999994 38.0 38.0 38.0 34.2 38.0 105-109 36.51865 38.0 38.0 38.0 34.0 38.0 110-114 36.3933 38.0 37.8 38.0 34.0 38.0 115-119 36.259499999999996 38.0 37.4 38.0 33.8 38.0 120-124 36.10085 38.0 37.2 38.0 33.0 38.0 125-129 35.902 38.0 36.8 38.0 32.2 38.0 130-134 35.676 38.0 36.2 38.0 31.6 38.0 135-139 35.3354 38.0 36.0 38.0 29.8 38.0 140-144 35.11585 38.0 35.6 38.0 28.8 38.0 145-149 34.56575 38.0 35.2 38.0 28.0 38.0 150-151 31.612000000000002 36.5 32.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 0.0 15 1.0 16 2.0 17 1.0 18 4.0 19 0.0 20 4.0 21 1.0 22 6.0 23 6.0 24 11.0 25 8.0 26 14.0 27 21.0 28 18.0 29 40.0 30 34.0 31 47.0 32 72.0 33 92.0 34 123.0 35 244.0 36 629.0 37 2621.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.15 17.525 7.875 37.45 2 21.099999999999998 20.275000000000002 36.325 22.3 3 19.475 28.525 24.349999999999998 27.650000000000002 4 28.749999999999996 37.15 18.4 15.7 5 28.225 36.6 19.875 15.299999999999999 6 17.25 38.475 24.375 19.900000000000002 7 13.125 23.724999999999998 43.425000000000004 19.725 8 18.35 22.225 30.825000000000003 28.599999999999998 9 18.15 23.1 31.45 27.3 10-14 19.475 30.04 26.900000000000002 23.585 15-19 19.615 28.935 27.91 23.54 20-24 19.384999999999998 29.035 28.13 23.45 25-29 19.325 29.265 28.000000000000004 23.41 30-34 19.455 29.395 27.894999999999996 23.255 35-39 19.42 29.335 27.47 23.775 40-44 19.7 29.79 27.534999999999997 22.975 45-49 19.814999999999998 29.235 27.6 23.35 50-54 20.255000000000003 28.999999999999996 27.71 23.035 55-59 20.150000000000002 28.875 27.634999999999998 23.34 60-64 19.41 28.665000000000003 28.299999999999997 23.625 65-69 19.515 28.595 28.235 23.655 70-74 20.255000000000003 28.78 27.845 23.119999999999997 75-79 20.135 29.315 26.724999999999998 23.825 80-84 19.825 29.044999999999998 27.175 23.955000000000002 85-89 19.73 28.965000000000003 27.58 23.724999999999998 90-94 19.825 28.77 27.665 23.74 95-99 20.145 28.560000000000002 27.944999999999997 23.35 100-104 20.080000000000002 28.365000000000002 28.134999999999998 23.419999999999998 105-109 19.939999999999998 28.675 28.025 23.36 110-114 20.11 28.29 27.985 23.615 115-119 20.57 28.32 27.82 23.29 120-124 20.265 28.725 27.265 23.745 125-129 20.380000000000003 28.035 28.27 23.315 130-134 20.155 27.860000000000003 28.675 23.31 135-139 20.07 28.444999999999997 28.12 23.365 140-144 20.549999999999997 28.299999999999997 27.55 23.599999999999998 145-149 20.16 28.744999999999997 27.62 23.474999999999998 150-151 20.3625 28.325 26.674999999999997 24.637500000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.0 19 0.0 20 0.5 21 1.5 22 1.5 23 1.0 24 3.5 25 4.5 26 5.5 27 6.5 28 9.0 29 14.0 30 28.5 31 36.5 32 28.5 33 40.5 34 63.0 35 77.5 36 99.5 37 119.5 38 147.5 39 180.5 40 205.0 41 232.5 42 267.0 43 266.0 44 265.0 45 286.5 46 261.5 47 237.5 48 225.0 49 186.5 50 160.0 51 129.0 52 100.0 53 81.0 54 54.0 55 43.5 56 33.5 57 21.5 58 18.0 59 14.5 60 7.0 61 5.5 62 5.5 63 4.5 64 4.5 65 4.0 66 2.5 67 1.5 68 1.5 69 2.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59819186338524 99.15 2 0.3515821195379206 0.7000000000000001 3 0.05022601707684581 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.1875 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.30000000000000004 0.0 0.0 0.0 0.0 106-107 0.3625 0.0 0.0 0.0 0.0 108-109 0.3875 0.0 0.0 0.0 0.0 110-111 0.4375 0.0 0.0 0.0 0.0 112-113 0.475 0.0 0.0 0.0 0.0 114-115 0.525 0.0 0.0 0.0 0.0 116-117 0.5625 0.0 0.0 0.0 0.0 118-119 0.625 0.0 0.0 0.0 0.0 120-121 0.7 0.0 0.0 0.0 0.0 122-123 0.7875 0.0 0.0 0.0 0.0 124-125 0.825 0.0 0.0 0.0 0.0 126-127 0.8625 0.0 0.0 0.0 0.0 128-129 1.0125 0.0 0.0 0.0 0.0 130-131 1.2125 0.0 0.0 0.0 0.0 132-133 1.2625 0.0 0.0 0.0 0.0 134-135 1.4249999999999998 0.0 0.0 0.0 0.0 136-137 1.525 0.0 0.0 0.0 0.0 138-139 1.6625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCATTGT 10 0.006830828 145.0 6 TCATTTA 10 0.006830828 145.0 7 >>END_MODULE SRR7171899 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171899_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.88 33.0 33.0 34.0 32.0 34.0 2 32.98475 34.0 33.0 34.0 32.0 34.0 3 33.02325 34.0 33.0 34.0 32.0 34.0 4 32.91725 34.0 33.0 34.0 32.0 34.0 5 32.89825 34.0 33.0 34.0 32.0 34.0 6 37.05775 38.0 38.0 38.0 36.0 38.0 7 37.10275 38.0 38.0 38.0 37.0 38.0 8 37.226 38.0 38.0 38.0 37.0 38.0 9 37.06125 38.0 38.0 38.0 37.0 38.0 10-14 36.9928 38.0 38.0 38.0 36.2 38.0 15-19 37.0427 38.0 38.0 38.0 36.4 38.0 20-24 37.0269 38.0 38.0 38.0 36.6 38.0 25-29 36.9784 38.0 38.0 38.0 36.0 38.0 30-34 36.8782 38.0 38.0 38.0 35.8 38.0 35-39 36.636250000000004 38.0 38.0 38.0 35.6 38.0 40-44 36.39925 38.0 38.0 38.0 35.0 38.0 45-49 36.75425 38.0 38.0 38.0 35.2 38.0 50-54 36.7912 38.0 38.0 38.0 35.8 38.0 55-59 36.70145 38.0 38.0 38.0 35.2 38.0 60-64 36.69865 38.0 38.0 38.0 35.0 38.0 65-69 36.6291 38.0 38.0 38.0 34.8 38.0 70-74 36.54355 38.0 38.0 38.0 34.2 38.0 75-79 36.5762 38.0 38.0 38.0 34.6 38.0 80-84 36.55795 38.0 38.0 38.0 34.4 38.0 85-89 36.35209999999999 38.0 38.0 38.0 34.0 38.0 90-94 36.248200000000004 38.0 38.0 38.0 34.0 38.0 95-99 36.0605 38.0 37.8 38.0 33.4 38.0 100-104 35.96585 38.0 37.2 38.0 32.6 38.0 105-109 35.80454999999999 38.0 37.0 38.0 32.0 38.0 110-114 35.67184999999999 38.0 37.0 38.0 31.2 38.0 115-119 35.490449999999996 38.0 37.0 38.0 31.0 38.0 120-124 35.373599999999996 38.0 36.2 38.0 29.8 38.0 125-129 35.1177 38.0 36.0 38.0 28.2 38.0 130-134 34.7685 38.0 35.2 38.0 27.4 38.0 135-139 34.45105 38.0 35.0 38.0 25.8 38.0 140-144 34.10595 38.0 35.0 38.0 23.8 38.0 145-149 33.49315 38.0 34.6 38.0 20.2 38.0 150-151 30.343625 36.5 29.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 3.0 4 2.0 5 2.0 6 2.0 7 0.0 8 2.0 9 0.0 10 2.0 11 3.0 12 0.0 13 4.0 14 4.0 15 4.0 16 2.0 17 7.0 18 7.0 19 3.0 20 7.0 21 6.0 22 11.0 23 9.0 24 25.0 25 13.0 26 28.0 27 27.0 28 39.0 29 43.0 30 41.0 31 46.0 32 77.0 33 96.0 34 175.0 35 287.0 36 655.0 37 2368.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.9 17.075000000000003 16.45 28.575 2 25.174999999999997 23.599999999999998 35.025 16.2 3 20.150000000000002 28.050000000000004 31.25 20.549999999999997 4 25.0 35.525 21.75 17.724999999999998 5 24.349999999999998 36.825 21.55 17.275 6 18.825 38.025 24.05 19.1 7 18.825 17.275 43.3 20.599999999999998 8 20.8 22.6 28.125 28.475 9 22.025 24.2 29.15 24.625 10-14 23.0 29.080000000000002 26.82 21.099999999999998 15-19 22.705000000000002 28.155 27.815 21.325 20-24 22.56 29.17 27.775 20.495 25-29 23.169999999999998 28.499999999999996 27.650000000000002 20.68 30-34 22.34729101005553 28.640752413827602 28.370603832107662 20.641352744009207 35-39 22.57821144754049 28.483049994970326 27.834221909264663 21.104516648224525 40-44 23.74955747736813 27.95731553128003 27.78536388003844 20.507763111313405 45-49 23.055 28.075 28.475 20.395 50-54 23.115 28.189999999999998 27.88 20.815 55-59 23.580000000000002 28.155 27.985 20.28 60-64 22.97 28.105000000000004 28.515 20.41 65-69 23.73 27.834999999999997 27.800000000000004 20.635 70-74 23.625 27.98 27.975 20.419999999999998 75-79 23.73 28.410000000000004 27.425 20.435 80-84 23.965 28.4 27.33 20.305 85-89 23.400000000000002 28.665000000000003 28.105000000000004 19.830000000000002 90-94 23.055 28.625 27.975 20.345 95-99 23.635 28.64 27.58 20.145 100-104 23.615 27.889999999999997 27.615000000000002 20.880000000000003 105-109 23.72 27.73 27.87 20.68 110-114 23.445 28.125 28.325 20.105 115-119 23.47 28.27 28.09 20.169999999999998 120-124 23.73 27.884999999999998 28.27 20.115 125-129 23.794999999999998 28.565 27.700000000000003 19.939999999999998 130-134 23.82 27.694999999999997 28.28 20.205000000000002 135-139 23.724999999999998 27.79 28.299999999999997 20.185 140-144 24.02 27.900000000000002 27.98 20.1 145-149 23.990000000000002 27.534999999999997 28.360000000000003 20.115 150-151 23.275000000000002 26.35 29.125 21.25 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.5 22 2.0 23 1.5 24 1.5 25 1.0 26 2.0 27 3.0 28 7.0 29 8.0 30 12.5 31 16.5 32 20.5 33 28.0 34 45.0 35 61.5 36 76.0 37 119.5 38 165.5 39 182.5 40 212.5 41 245.5 42 271.0 43 297.5 44 278.5 45 275.5 46 287.0 47 257.0 48 227.0 49 203.5 50 160.5 51 119.0 52 104.0 53 84.5 54 61.0 55 48.0 56 33.0 57 23.0 58 16.0 59 10.0 60 7.5 61 5.5 62 5.0 63 3.5 64 2.5 65 2.5 66 1.0 67 1.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.055 35-39 0.59 40-44 1.135 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37075257991442 98.7 2 0.5789076264787314 1.15 3 0.05033979360684621 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.1875 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.30000000000000004 0.0 0.0 0.0 0.0 106-107 0.3625 0.0 0.0 0.0 0.0 108-109 0.3875 0.0 0.0 0.0 0.0 110-111 0.44999999999999996 0.0 0.0 0.0 0.0 112-113 0.5 0.0 0.0 0.0 0.0 114-115 0.55 0.0 0.0 0.0 0.0 116-117 0.5875 0.0 0.0 0.0 0.0 118-119 0.675 0.0 0.0 0.0 0.0 120-121 0.75 0.0 0.0 0.0 0.0 122-123 0.8375 0.0 0.0 0.0 0.0 124-125 0.875 0.0 0.0 0.0 0.0 126-127 0.9125000000000001 0.0 0.0 0.0 0.0 128-129 1.0375 0.0 0.0 0.0 0.0 130-131 1.2375 0.0 0.0 0.0 0.0 132-133 1.2875 0.0 0.0 0.0 0.0 134-135 1.4500000000000002 0.0 0.0 0.0 0.0 136-137 1.5499999999999998 0.0 0.0 0.0 0.0 138-139 1.6875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 820996 spots for SRR7171899.sra Written 820996 spots for SRR7171899.sra Read 820996 spots for SRR7171899.sra Written 820996 spots for SRR7171899.sra Read 820996 spots for SRR7171899.sra Written 820996 spots for SRR7171899.sra Read 820996 spots for SRR7171899.sra Written 820996 spots for SRR7171899.sra Read 820996 spots for SRR7171899.sra Written 820996 spots for SRR7171899.sra Read 820996 spots for SRR7171899.sra Written 820996 spots for SRR7171899.sra Read 820996 spots for SRR7171899.sra Written 820996 spots for SRR7171899.sra Read 820996 spots for SRR7171899.sra Written 820996 spots for SRR7171899.sra Read 820996 spots for SRR7171899.sra Written 820996 spots for SRR7171899.sra Read 820996 spots for SRR7171899.sra Written 820996 spots for SRR7171899.sra Read 820996 spots for SRR7171899.sra Written 820996 spots for SRR7171899.sra Read 820996 spots for SRR7171899.sra Written 820996 spots for SRR7171899.sra Read 820996 spots for SRR7171899.sra Written 820996 spots for SRR7171899.sra Read 820996 spots for SRR7171899.sra Written 820996 spots for SRR7171899.sra Read 820996 spots for SRR7171899.sra Written 820996 spots for SRR7171899.sra Read 820996 spots for SRR7171899.sra Written 820996 spots for SRR7171899.sra Read 820996 spots for SRR7171899.sra Written 820996 spots for SRR7171899.sra Read 820996 spots for SRR7171899.sra Written 820996 spots for SRR7171899.sra Read 820996 spots for SRR7171899.sra Written 820996 spots for SRR7171899.sra Read 820996 spots for SRR7171899.sra Written 820996 spots for SRR7171899.sra SRR ids: ['SRR7171899.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_i470yhy8 SRR7171899.sra spots: 16419920 blocks: [[1, 820996], [820997, 1641992], [1641993, 2462988], [2462989, 3283984], [3283985, 4104980], [4104981, 4925976], [4925977, 5746972], [5746973, 6567968], [6567969, 7388964], [7388965, 8209960], [8209961, 9030956], [9030957, 9851952], [9851953, 10672948], [10672949, 11493944], [11493945, 12314940], [12314941, 13135936], [13135937, 13956932], [13956933, 14777928], [14777929, 15598924], [15598925, 16419920]] SRR7171899 file size 5542471 SRR7171899 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171899 SRR7171899_1.fastq SRR7171899_2.fastq Input file: SRR7171899_1.fastq Paired file: SRR7171899_2.fastq trimmed: SRR7171899-trimmed-pair1.fastq, SRR7171899-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 23:51:38 2025 >> started Thu Feb 13 23:51:56 2025 >> done (17.908s) 16419920 read pairs processed; of these: 13744 ( 0.08%) short read pairs filtered out after trimming by size control 9381 ( 0.06%) empty read pairs filtered out after trimming by size control 16396795 (99.86%) read pairs available; of these: 6213197 (37.89%) trimmed read pairs available after processing 10183598 (62.11%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 4 0.00% 20 1 0.00% 21 1 0.00% 22 2 0.00% 23 6 0.00% 24 3 0.00% 25 4 0.00% 26 1 0.00% 27 1 0.00% 28 3 0.00% 29 3 0.00% 30 4 0.00% 31 6 0.00% 32 5 0.00% 33 4 0.00% 34 6 0.00% 35 1 0.00% 36 1 0.00% 37 4 0.00% 38 7 0.00% 39 3 0.00% 40 3 0.00% 41 13 0.00% 42 8 0.00% 43 6 0.00% 44 7 0.00% 45 11 0.00% 46 8 0.00% 47 12 0.00% 48 13 0.00% 49 14 0.00% 50 20 0.00% 51 15 0.00% 52 16 0.00% 53 18 0.00% 54 25 0.00% 55 24 0.00% 56 26 0.00% 57 32 0.00% 58 38 0.00% 59 38 0.00% 60 48 0.00% 61 55 0.00% 62 55 0.00% 63 64 0.00% 64 63 0.00% 65 75 0.00% 66 87 0.00% 67 82 0.00% 68 108 0.00% 69 132 0.00% 70 137 0.00% 71 175 0.00% 72 182 0.00% 73 209 0.00% 74 232 0.00% 75 278 0.00% 76 389 0.00% 77 371 0.00% 78 409 0.00% 79 440 0.00% 80 501 0.00% 81 605 0.00% 82 647 0.00% 83 779 0.00% 84 1541 0.01% 85 1921 0.01% 86 2126 0.01% 87 2745 0.02% 88 2616 0.02% 89 2509 0.02% 90 2554 0.02% 91 2595 0.02% 92 2850 0.02% 93 2958 0.02% 94 3097 0.02% 95 3200 0.02% 96 3329 0.02% 97 3573 0.02% 98 3631 0.02% 99 3981 0.02% 100 4233 0.03% 101 4515 0.03% 102 4878 0.03% 103 5080 0.03% 104 5189 0.03% 105 5721 0.03% 106 6075 0.04% 107 6390 0.04% 108 6755 0.04% 109 7055 0.04% 110 7669 0.05% 111 8483 0.05% 112 8603 0.05% 113 9206 0.06% 114 9686 0.06% 115 10503 0.06% 116 10821 0.07% 117 11569 0.07% 118 11870 0.07% 119 12615 0.08% 120 13096 0.08% 121 13852 0.08% 122 14228 0.09% 123 15367 0.09% 124 16356 0.10% 125 17412 0.11% 126 18310 0.11% 127 19152 0.12% 128 20218 0.12% 129 21415 0.13% 130 22805 0.14% 131 24330 0.15% 132 26228 0.16% 133 28285 0.17% 134 30876 0.19% 135 33076 0.20% 136 36378 0.22% 137 39356 0.24% 138 42822 0.26% 139 46829 0.29% 140 52697 0.32% 141 59331 0.36% 142 67758 0.41% 143 79650 0.49% 144 95372 0.58% 145 117157 0.71% 146 151741 0.93% 147 213266 1.30% 148 339421 2.07% 149 702350 4.28% 150 3625378 22.11% 151 10183598 62.11% 16396795 reads passed initial QC criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=2.33 fanout-score-rank=26 prefix-density=0.60 prefix-fanout=2.2 sequence=CAGGTGCAGTTTGATCC criterion=fanout-score sequence-density=0.15 sequence-density-rank=9 fanout-score=24.31 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=9.0 sequence=ACACCAGCAATGATTGT criterion=sequence-density sequence-density=0.74 sequence-density-rank=1 fanout-score=2.79 fanout-score-rank=14 prefix-density=0.75 prefix-fanout=2.7 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.12 sequence-density-rank=23 fanout-score=23.79 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=9.9 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7171899 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 23:52:43 Started mapping on | Feb 13 23:52:43 Finished on | Feb 13 23:55:07 Mapping speed, Million of reads per hour | 409.92 Number of input reads | 16396795 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 15292769 Uniquely mapped reads % | 93.27% Average mapped length | 297.64 Number of splices: Total | 15420634 Number of splices: Annotated (sjdb) | 15110328 Number of splices: GT/AG | 15173873 Number of splices: GC/AG | 194443 Number of splices: AT/AC | 13277 Number of splices: Non-canonical | 39041 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.63 Insertion rate per base | 0.02% Insertion average length | 2.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 398833 % of reads mapped to multiple loci | 2.43% Number of reads mapped to too many loci | 44399 % of reads mapped to too many loci | 0.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.96% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 719810 719810 719810 N_multimapping 398833 398833 398833 N_noFeature 439450 15144574 500349 N_ambiguous 175648 1093 87706 UnstrandedReadsAssigned:14677671 PositiveStrandReadsAssigned:147102 NegativeStrandReadsAssigned:14704714 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171899 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171899-trimmed-pair1.fastq SRR7171899-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,396,795 reads, 14,519,931 reads pseudoaligned [quant] estimated average fragment length: 278.647 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,108 rounds 52401 SRR7171899.ke.tsv 34699 SRR7171899.se.tsv 87100 total ==> SRR7171899.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1740.35 1676 59.1231 Potri.005G024800.1.v4.1 1035 757.353 437 35.4245 Potri.004G059700.1.v4.1 961 683.369 23 2.0663 Potri.007G009000.2.v4.1 1416 1138.35 0 0 Potri.003G141000.2.v4.1 2943 2665.35 750 17.2754 Potri.016G087400.1.v4.1 270 59.2384 805 834.282 Potri.015G069301.1.v4.1 564 291.204 0 0 Potri.010G195200.1.v4.1 1773 1495.35 387 15.8887 Potri.012G127500.1.v4.1 977 699.369 5948 522.138 ==> SRR7171899.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 138 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 503 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 294 SRR7171899 completed mapping pipeline successfully