Starting /dee2/code/volunteer_pipeline.sh SRR7171900 current disk space = 3089321684992 free memory = 1390262644 SRR7171900 SRAfilesize a106a84542e9bb05c82b48f689aa5530 SRR7171900.sra SRR7171900.sra file validated SRR7171900 is paired end SRR7171900 is conventional basespace SRR7171900 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171900_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.334 32.0 25.0 33.0 18.0 33.0 2 29.6885 31.0 29.0 33.0 25.0 34.0 3 31.6315 33.0 32.0 33.0 27.0 33.0 4 32.32375 33.0 32.0 33.0 32.0 34.0 5 32.61775 33.0 33.0 33.0 32.0 34.0 6 36.37325 38.0 36.0 38.0 34.0 38.0 7 36.82325 38.0 37.0 38.0 34.0 38.0 8 37.3495 38.0 38.0 38.0 36.0 38.0 9 37.566 38.0 38.0 38.0 37.0 38.0 10-14 37.61035 38.0 38.0 38.0 37.8 38.0 15-19 37.563050000000004 38.0 38.0 38.0 37.8 38.0 20-24 37.54925 38.0 38.0 38.0 37.6 38.0 25-29 37.52915 38.0 38.0 38.0 37.6 38.0 30-34 37.512950000000004 38.0 38.0 38.0 37.2 38.0 35-39 37.4901 38.0 38.0 38.0 37.0 38.0 40-44 37.47175 38.0 38.0 38.0 37.0 38.0 45-49 37.46085000000001 38.0 38.0 38.0 37.0 38.0 50-54 37.39465 38.0 38.0 38.0 37.0 38.0 55-59 37.35105 38.0 38.0 38.0 37.0 38.0 60-64 37.345749999999995 38.0 38.0 38.0 37.0 38.0 65-69 37.23925 38.0 38.0 38.0 36.2 38.0 70-74 37.171299999999995 38.0 38.0 38.0 36.0 38.0 75-79 37.07785 38.0 38.0 38.0 36.0 38.0 80-84 37.02145 38.0 38.0 38.0 36.0 38.0 85-89 36.96825 38.0 38.0 38.0 35.8 38.0 90-94 36.9217 38.0 38.0 38.0 35.2 38.0 95-99 36.8455 38.0 38.0 38.0 35.0 38.0 100-104 36.7331 38.0 38.0 38.0 34.6 38.0 105-109 36.535000000000004 38.0 38.0 38.0 34.0 38.0 110-114 36.45745 38.0 38.0 38.0 34.0 38.0 115-119 36.2745 38.0 37.2 38.0 34.0 38.0 120-124 36.164550000000006 38.0 37.0 38.0 33.6 38.0 125-129 36.01435 38.0 36.6 38.0 33.0 38.0 130-134 35.67659999999999 38.0 36.0 38.0 31.0 38.0 135-139 35.46585 38.0 36.0 38.0 31.0 38.0 140-144 35.305949999999996 38.0 36.0 38.0 30.6 38.0 145-149 34.6645 38.0 35.0 38.0 28.0 38.0 150-151 31.592 36.5 31.5 38.0 14.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 2.0 16 0.0 17 2.0 18 2.0 19 2.0 20 2.0 21 6.0 22 4.0 23 2.0 24 6.0 25 6.0 26 10.0 27 6.0 28 11.0 29 19.0 30 38.0 31 30.0 32 56.0 33 96.0 34 139.0 35 288.0 36 774.0 37 2498.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.925000000000004 13.075000000000001 11.175 33.825 2 21.224999999999998 18.825 39.5 20.45 3 20.674999999999997 25.2 27.35 26.775 4 23.400000000000002 34.425 22.325 19.85 5 20.825 37.25 23.849999999999998 18.075 6 17.925 35.075 26.700000000000003 20.3 7 14.875 20.599999999999998 45.025 19.5 8 18.224999999999998 21.7 30.349999999999998 29.725 9 19.475 22.825 31.674999999999997 26.025 10-14 20.21 29.470000000000002 26.77 23.549999999999997 15-19 20.544999999999998 28.410000000000004 27.63 23.415 20-24 20.599999999999998 28.244999999999997 28.060000000000002 23.095 25-29 20.47 28.78 27.58 23.169999999999998 30-34 20.61 28.4 27.825 23.165 35-39 20.355 28.075 28.139999999999997 23.43 40-44 21.09 28.910000000000004 27.125 22.875 45-49 20.655 27.85 27.800000000000004 23.695 50-54 20.52 28.565 27.195000000000004 23.72 55-59 20.51 28.235 27.884999999999998 23.369999999999997 60-64 20.385 27.650000000000002 28.134999999999998 23.830000000000002 65-69 20.25 28.560000000000002 27.950000000000003 23.24 70-74 20.52 28.83 27.345000000000002 23.305 75-79 20.01 28.395 27.6 23.995 80-84 20.385 27.905 27.85 23.86 85-89 20.724999999999998 28.499999999999996 27.565 23.21 90-94 20.7 28.470000000000002 27.534999999999997 23.294999999999998 95-99 20.235 27.985 27.955000000000002 23.825 100-104 20.549999999999997 28.4 27.685 23.365 105-109 20.665 27.96 27.915 23.46 110-114 21.055 27.834999999999997 27.76 23.35 115-119 20.815 28.115000000000002 28.1 22.97 120-124 20.365 28.134999999999998 27.605 23.895 125-129 20.935000000000002 28.205000000000002 27.744999999999997 23.115 130-134 20.985 28.084999999999997 27.515 23.415 135-139 21.135 27.944999999999997 27.99 22.93 140-144 20.855 27.66 28.255000000000003 23.23 145-149 20.84 28.294999999999998 27.615000000000002 23.25 150-151 21.05 27.737499999999997 27.8125 23.400000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 1.0 24 3.0 25 5.0 26 8.5 27 6.0 28 3.0 29 7.5 30 12.0 31 19.5 32 27.0 33 37.0 34 49.5 35 58.5 36 75.0 37 101.5 38 124.0 39 166.0 40 213.5 41 239.0 42 257.0 43 283.5 44 293.5 45 286.0 46 274.0 47 237.5 48 222.5 49 203.5 50 166.5 51 134.0 52 113.0 53 99.5 54 69.0 55 45.5 56 38.0 57 31.0 58 26.0 59 19.5 60 12.5 61 9.5 62 4.5 63 2.5 64 2.0 65 2.5 66 2.5 67 1.5 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.21250000000000002 0.0 0.0 0.0 0.0 98-99 0.2375 0.0 0.0 0.0 0.0 100-101 0.3 0.0 0.0 0.0 0.0 102-103 0.35 0.0 0.0 0.0 0.0 104-105 0.35 0.0 0.0 0.0 0.0 106-107 0.4 0.0 0.0 0.0 0.0 108-109 0.4625 0.0 0.0 0.0 0.0 110-111 0.5 0.0 0.0 0.0 0.0 112-113 0.6375 0.0 0.0 0.0 0.0 114-115 0.8 0.0 0.0 0.0 0.0 116-117 0.9 0.0 0.0 0.0 0.0 118-119 1.0 0.0 0.0 0.0 0.0 120-121 1.0499999999999998 0.0 0.0 0.0 0.0 122-123 1.2000000000000002 0.0 0.0 0.0 0.0 124-125 1.275 0.0 0.0 0.0 0.0 126-127 1.4375 0.0 0.0 0.0 0.0 128-129 1.5375 0.0 0.0 0.0 0.0 130-131 1.7375 0.0 0.0 0.0 0.0 132-133 1.9375 0.0 0.0 0.0 0.0 134-135 2.2125 0.0 0.0 0.0 0.0 136-137 2.375 0.0 0.0 0.0 0.0 138-139 2.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGATAAA 10 0.006830828 145.0 1 TTGATCG 10 0.006830828 145.0 7 >>END_MODULE SRR7171900 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171900_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.083 33.0 33.0 34.0 32.0 34.0 2 33.15275 34.0 33.0 34.0 33.0 34.0 3 33.199 34.0 33.0 34.0 33.0 34.0 4 33.21675 34.0 33.0 34.0 33.0 34.0 5 33.132 34.0 33.0 34.0 33.0 34.0 6 37.335 38.0 38.0 38.0 37.0 38.0 7 37.33075 38.0 38.0 38.0 37.0 38.0 8 37.3675 38.0 38.0 38.0 37.0 38.0 9 37.459 38.0 38.0 38.0 38.0 38.0 10-14 37.294399999999996 38.0 38.0 38.0 37.0 38.0 15-19 37.2608 38.0 38.0 38.0 37.0 38.0 20-24 37.26944999999999 38.0 38.0 38.0 37.0 38.0 25-29 37.28945 38.0 38.0 38.0 37.0 38.0 30-34 37.22985 38.0 38.0 38.0 37.0 38.0 35-39 37.0218 38.0 38.0 38.0 36.2 38.0 40-44 36.949650000000005 38.0 38.0 38.0 36.0 38.0 45-49 37.1367 38.0 38.0 38.0 36.6 38.0 50-54 37.03895 38.0 38.0 38.0 36.0 38.0 55-59 37.08149999999999 38.0 38.0 38.0 36.0 38.0 60-64 37.0002 38.0 38.0 38.0 36.0 38.0 65-69 36.966150000000006 38.0 38.0 38.0 36.0 38.0 70-74 36.9057 38.0 38.0 38.0 36.0 38.0 75-79 36.8801 38.0 38.0 38.0 35.6 38.0 80-84 36.7307 38.0 38.0 38.0 34.8 38.0 85-89 36.6794 38.0 38.0 38.0 35.0 38.0 90-94 36.583600000000004 38.0 38.0 38.0 34.2 38.0 95-99 36.42125 38.0 38.0 38.0 34.2 38.0 100-104 36.2707 38.0 37.6 38.0 33.6 38.0 105-109 36.174099999999996 38.0 37.4 38.0 33.6 38.0 110-114 36.0396 38.0 37.0 38.0 33.0 38.0 115-119 35.86855 38.0 37.0 38.0 32.4 38.0 120-124 35.5969 38.0 36.6 38.0 31.0 38.0 125-129 35.3939 38.0 36.0 38.0 31.0 38.0 130-134 35.10745 38.0 35.8 38.0 28.6 38.0 135-139 34.845 38.0 35.2 38.0 28.0 38.0 140-144 34.380700000000004 38.0 35.0 38.0 25.6 38.0 145-149 33.74185 38.0 34.6 38.0 21.4 38.0 150-151 30.025 36.5 29.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 2.0 4 0.0 5 1.0 6 0.0 7 1.0 8 0.0 9 1.0 10 2.0 11 1.0 12 0.0 13 2.0 14 1.0 15 1.0 16 0.0 17 3.0 18 5.0 19 4.0 20 6.0 21 6.0 22 15.0 23 6.0 24 9.0 25 12.0 26 13.0 27 14.0 28 23.0 29 40.0 30 34.0 31 51.0 32 59.0 33 99.0 34 145.0 35 295.0 36 741.0 37 2406.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.675 17.075000000000003 15.275 26.974999999999998 2 22.45 25.5 35.05 17.0 3 20.599999999999998 26.6 30.675 22.125 4 23.9 34.575 22.075 19.45 5 22.625 37.4 21.925 18.05 6 18.099999999999998 37.6 24.775 19.525000000000002 7 18.0 17.724999999999998 43.325 20.95 8 21.0 23.25 27.075 28.675 9 22.55 24.025 28.599999999999998 24.825 10-14 22.6 28.88 26.41 22.11 15-19 22.875 28.02 27.76 21.345 20-24 22.305 28.470000000000002 27.500000000000004 21.725 25-29 22.58 28.425 27.76 21.235 30-34 22.931371076738248 27.786954998247985 28.062271612354206 21.219402312659557 35-39 22.530477098279235 28.064014448402148 28.089098479907694 21.316409973410927 40-44 22.918446309230692 27.56645394703784 28.149339229184463 21.36576051454701 45-49 22.085 27.855 28.384999999999998 21.675 50-54 22.645 28.01 28.525 20.82 55-59 23.080000000000002 28.1 27.74 21.08 60-64 23.13 28.405 27.875 20.59 65-69 23.5 27.785 27.810000000000002 20.905 70-74 23.169999999999998 28.1 26.995 21.735 75-79 23.330000000000002 27.91 27.965 20.794999999999998 80-84 23.494999999999997 28.12 27.62 20.765 85-89 23.265 28.384999999999998 27.775 20.575 90-94 23.23 28.535 27.49 20.745 95-99 23.330000000000002 28.754999999999995 27.13 20.785 100-104 23.5 28.52 27.355 20.625 105-109 23.48 27.88 27.01 21.63 110-114 22.765 28.515 27.334999999999997 21.385 115-119 23.75 28.249999999999996 27.62 20.380000000000003 120-124 23.455000000000002 27.925 27.215 21.404999999999998 125-129 23.25 28.050000000000004 27.58 21.12 130-134 23.915 28.37 27.145000000000003 20.57 135-139 23.29 27.625 27.900000000000002 21.185000000000002 140-144 23.880000000000003 28.1 27.72 20.3 145-149 24.065 28.060000000000002 27.18 20.695 150-151 23.799999999999997 27.8125 28.175 20.2125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 0.5 22 1.0 23 1.5 24 2.0 25 2.0 26 2.0 27 2.0 28 5.5 29 8.5 30 11.0 31 18.0 32 20.5 33 26.0 34 35.5 35 56.0 36 83.0 37 117.0 38 144.5 39 166.5 40 192.5 41 222.0 42 264.5 43 288.5 44 289.0 45 279.0 46 273.5 47 270.0 48 249.0 49 202.5 50 166.0 51 146.5 52 118.5 53 82.0 54 63.0 55 55.5 56 41.0 57 28.5 58 17.0 59 11.5 60 8.0 61 6.0 62 4.5 63 2.5 64 3.5 65 4.0 66 1.5 67 1.0 68 1.5 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.11499999999999999 35-39 0.335 40-44 0.49500000000000005 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67385850476668 99.325 2 0.3010536879076769 0.6 3 0.025087807325639738 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.21250000000000002 0.0 0.0 0.0 0.0 98-99 0.2375 0.0 0.0 0.0 0.0 100-101 0.3 0.0 0.0 0.0 0.0 102-103 0.35 0.0 0.0 0.0 0.0 104-105 0.35 0.0 0.0 0.0 0.0 106-107 0.4 0.0 0.0 0.0 0.0 108-109 0.4625 0.0 0.0 0.0 0.0 110-111 0.5 0.0 0.0 0.0 0.0 112-113 0.6375 0.0 0.0 0.0 0.0 114-115 0.8 0.0 0.0 0.0 0.0 116-117 0.9125 0.0 0.0 0.0 0.0 118-119 1.0 0.0 0.0 0.0 0.0 120-121 1.0750000000000002 0.0 0.0 0.0 0.0 122-123 1.225 0.0 0.0 0.0 0.0 124-125 1.3 0.0 0.0 0.0 0.0 126-127 1.4375 0.0 0.0 0.0 0.0 128-129 1.5375 0.0 0.0 0.0 0.0 130-131 1.7375 0.0 0.0 0.0 0.0 132-133 1.9375 0.0 0.0 0.0 0.0 134-135 2.2125 0.0 0.0 0.0 0.0 136-137 2.4125 0.0 0.0 0.0 0.0 138-139 2.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCCAAAT 10 0.006882143 144.6375 7 >>END_MODULE Read 757643 spots for SRR7171900.sra Written 757643 spots for SRR7171900.sra Read 757643 spots for SRR7171900.sra Written 757643 spots for SRR7171900.sra Read 757643 spots for SRR7171900.sra Written 757643 spots for SRR7171900.sra Read 757643 spots for SRR7171900.sra Written 757643 spots for SRR7171900.sra Read 757643 spots for SRR7171900.sra Written 757643 spots for SRR7171900.sra Read 757643 spots for SRR7171900.sra Written 757643 spots for SRR7171900.sra Read 757643 spots for SRR7171900.sra Written 757643 spots for SRR7171900.sra Read 757643 spots for SRR7171900.sra Written 757643 spots for SRR7171900.sra Read 757643 spots for SRR7171900.sra Written 757643 spots for SRR7171900.sra Read 757654 spots for SRR7171900.sra Written 757654 spots for SRR7171900.sra Read 757643 spots for SRR7171900.sra Written 757643 spots for SRR7171900.sra Read 757643 spots for SRR7171900.sra Written 757643 spots for SRR7171900.sra Read 757643 spots for SRR7171900.sra Written 757643 spots for SRR7171900.sra Read 757643 spots for SRR7171900.sra Written 757643 spots for SRR7171900.sra Read 757643 spots for SRR7171900.sra Written 757643 spots for SRR7171900.sra Read 757643 spots for SRR7171900.sra Written 757643 spots for SRR7171900.sra Read 757643 spots for SRR7171900.sra Written 757643 spots for SRR7171900.sra Read 757643 spots for SRR7171900.sra Written 757643 spots for SRR7171900.sra Read 757643 spots for SRR7171900.sra Written 757643 spots for SRR7171900.sra Read 757643 spots for SRR7171900.sra Written 757643 spots for SRR7171900.sra SRR ids: ['SRR7171900.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kg3n2p54 SRR7171900.sra spots: 15152871 blocks: [[1, 757643], [757644, 1515286], [1515287, 2272929], [2272930, 3030572], [3030573, 3788215], [3788216, 4545858], [4545859, 5303501], [5303502, 6061144], [6061145, 6818787], [6818788, 7576430], [7576431, 8334073], [8334074, 9091716], [9091717, 9849359], [9849360, 10607002], [10607003, 11364645], [11364646, 12122288], [12122289, 12879931], [12879932, 13637574], [13637575, 14395217], [14395218, 15152871]] SRR7171900 file size 5113110 SRR7171900 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171900 SRR7171900_1.fastq SRR7171900_2.fastq Input file: SRR7171900_1.fastq Paired file: SRR7171900_2.fastq trimmed: SRR7171900-trimmed-pair1.fastq, SRR7171900-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 23:48:37 2025 >> started Thu Feb 13 23:48:52 2025 >> done (15.765s) 15152871 read pairs processed; of these: 10261 ( 0.07%) short read pairs filtered out after trimming by size control 7537 ( 0.05%) empty read pairs filtered out after trimming by size control 15135073 (99.88%) read pairs available; of these: 6399651 (42.28%) trimmed read pairs available after processing 8735422 (57.72%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 3 0.00% 20 2 0.00% 21 5 0.00% 22 3 0.00% 23 1 0.00% 24 1 0.00% 25 2 0.00% 26 4 0.00% 27 6 0.00% 28 3 0.00% 29 3 0.00% 30 4 0.00% 31 3 0.00% 32 3 0.00% 33 6 0.00% 34 3 0.00% 35 5 0.00% 36 5 0.00% 37 4 0.00% 38 5 0.00% 39 9 0.00% 40 7 0.00% 41 9 0.00% 42 13 0.00% 43 14 0.00% 44 16 0.00% 45 20 0.00% 46 14 0.00% 47 11 0.00% 48 33 0.00% 49 32 0.00% 50 26 0.00% 51 29 0.00% 52 39 0.00% 53 26 0.00% 54 33 0.00% 55 34 0.00% 56 49 0.00% 57 58 0.00% 58 59 0.00% 59 47 0.00% 60 66 0.00% 61 73 0.00% 62 103 0.00% 63 109 0.00% 64 119 0.00% 65 137 0.00% 66 127 0.00% 67 173 0.00% 68 175 0.00% 69 215 0.00% 70 225 0.00% 71 257 0.00% 72 286 0.00% 73 331 0.00% 74 397 0.00% 75 443 0.00% 76 511 0.00% 77 567 0.00% 78 622 0.00% 79 684 0.00% 80 767 0.01% 81 885 0.01% 82 1055 0.01% 83 1202 0.01% 84 1723 0.01% 85 2104 0.01% 86 2328 0.02% 87 2591 0.02% 88 2785 0.02% 89 2968 0.02% 90 3066 0.02% 91 3230 0.02% 92 3438 0.02% 93 3693 0.02% 94 3837 0.03% 95 4301 0.03% 96 4538 0.03% 97 4969 0.03% 98 5019 0.03% 99 5308 0.04% 100 5809 0.04% 101 5919 0.04% 102 6581 0.04% 103 6841 0.05% 104 7479 0.05% 105 8042 0.05% 106 8370 0.06% 107 8915 0.06% 108 8999 0.06% 109 9874 0.07% 110 10178 0.07% 111 10781 0.07% 112 11571 0.08% 113 12025 0.08% 114 12758 0.08% 115 13437 0.09% 116 14017 0.09% 117 14862 0.10% 118 15070 0.10% 119 16024 0.11% 120 16803 0.11% 121 17453 0.12% 122 18112 0.12% 123 19343 0.13% 124 20388 0.13% 125 21340 0.14% 126 22411 0.15% 127 23487 0.16% 128 24543 0.16% 129 25963 0.17% 130 27258 0.18% 131 28851 0.19% 132 30880 0.20% 133 32918 0.22% 134 35260 0.23% 135 37614 0.25% 136 40437 0.27% 137 43474 0.29% 138 47036 0.31% 139 51227 0.34% 140 55969 0.37% 141 62707 0.41% 142 70930 0.47% 143 81830 0.54% 144 97246 0.64% 145 118287 0.78% 146 154215 1.02% 147 217562 1.44% 148 348148 2.30% 149 735877 4.86% 150 3598452 23.78% 151 8735422 57.72% 15135073 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=4.28 fanout-score-rank=18 prefix-density=0.32 prefix-fanout=3.2 sequence=AAGGATCTCTCTCCTTTAACG criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=79.49 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=9.3 sequence=GAAAATCAAAGTACTTCACACCATGAAAAATCACACACTAAGCAAACCATGCATGATGGAATAAAAATGCTTTTAGGCGCACTGGAAATCTTTGGGGACCTTCTTTCCACAGACATTGAGAAGCAAGCTTAGAGATACAGGGATATTAAGGTTGATGCCCAAGATGTTAGCTTTGATGGCAGTGCAAAGGCAAACAGCAGCCTCGAGATCAAGAAGGCCTTGAATGA criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=4.58 fanout-score-rank=18 prefix-density=0.51 prefix-fanout=3.4 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=38.79 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=6.3 sequence=GAAGGATCTGTTTAATTTGAGACAGAAAACATGAAATCCTCCTACACTTTCTTCATTCTTTTCTCACTCTTTTCGTTTGCTAACGTGATCGGTGCTAGAAAAGACACTGGAGAGTATTGGAGAGCTGTCATGAAAGATCAGCCCATGCCAGAAGCAATACATGGCCTTATTCGCGAAACCACATTGTCATCAGTCTCCAATGAGAAAGCCGATTGCCACACAACCGAGTCCAATGAAAAGAATAATTTTGTCAAGGATTTTG SRR7171900 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 23:49:35 Started mapping on | Feb 13 23:49:35 Finished on | Feb 13 23:51:06 Mapping speed, Million of reads per hour | 598.75 Number of input reads | 15135073 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 14318112 Uniquely mapped reads % | 94.60% Average mapped length | 296.76 Number of splices: Total | 14938744 Number of splices: Annotated (sjdb) | 14691326 Number of splices: GT/AG | 14703182 Number of splices: GC/AG | 190581 Number of splices: AT/AC | 11030 Number of splices: Non-canonical | 33951 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.64 Insertion rate per base | 0.02% Insertion average length | 2.62 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 414367 % of reads mapped to multiple loci | 2.74% Number of reads mapped to too many loci | 40429 % of reads mapped to too many loci | 0.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.31% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 414413 414413 414413 N_multimapping 414367 414367 414367 N_noFeature 297996 14192381 356717 N_ambiguous 146320 891 78725 UnstrandedReadsAssigned:13873796 PositiveStrandReadsAssigned:124840 NegativeStrandReadsAssigned:13882670 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7171900 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171900-trimmed-pair1.fastq SRR7171900-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,135,073 reads, 13,742,962 reads pseudoaligned [quant] estimated average fragment length: 265.807 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,172 rounds 52401 SRR7171900.ke.tsv 34699 SRR7171900.se.tsv 87100 total ==> SRR7171900.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1753.19 954 38.0813 Potri.005G024800.1.v4.1 1035 770.193 345 31.3482 Potri.004G059700.1.v4.1 961 696.205 20 2.01042 Potri.007G009000.2.v4.1 1416 1151.19 0 0 Potri.003G141000.2.v4.1 2943 2678.19 462 12.0724 Potri.016G087400.1.v4.1 270 66.9477 1086 1135.24 Potri.015G069301.1.v4.1 564 304.646 0 0 Potri.010G195200.1.v4.1 1773 1508.19 247 11.4613 Potri.012G127500.1.v4.1 977 712.199 2327 228.659 ==> SRR7171900.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 43 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 324 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 232 SRR7171900 completed mapping pipeline successfully