Starting /dee2/code/volunteer_pipeline.sh SRR7171901 current disk space = 3089327939584 free memory = 1400203136 SRR7171901 SRAfilesize 2bd5da4acf1ecdd2556045e9bc032096 SRR7171901.sra SRR7171901.sra file validated SRR7171901 is paired end SRR7171901 is conventional basespace SRR7171901 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171901_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.07125 34.0 33.0 34.0 32.0 34.0 2 33.3155 34.0 33.0 34.0 33.0 34.0 3 32.77225 33.0 33.0 34.0 31.0 34.0 4 32.92525 33.0 33.0 34.0 31.0 34.0 5 33.23225 34.0 33.0 34.0 33.0 34.0 6 36.76725 38.0 37.0 38.0 34.0 38.0 7 37.43875 38.0 38.0 38.0 37.0 38.0 8 37.473 38.0 38.0 38.0 37.0 38.0 9 37.5255 38.0 38.0 38.0 37.0 38.0 10-14 37.60905 38.0 38.0 38.0 38.0 38.0 15-19 37.5954 38.0 38.0 38.0 38.0 38.0 20-24 37.58395 38.0 38.0 38.0 38.0 38.0 25-29 37.5526 38.0 38.0 38.0 38.0 38.0 30-34 37.493950000000005 38.0 38.0 38.0 37.6 38.0 35-39 37.4369 38.0 38.0 38.0 37.0 38.0 40-44 37.44575 38.0 38.0 38.0 37.0 38.0 45-49 37.43035 38.0 38.0 38.0 37.0 38.0 50-54 37.407999999999994 38.0 38.0 38.0 37.0 38.0 55-59 37.34625 38.0 38.0 38.0 37.0 38.0 60-64 37.26775 38.0 38.0 38.0 37.0 38.0 65-69 37.25365000000001 38.0 38.0 38.0 36.6 38.0 70-74 37.19840000000001 38.0 38.0 38.0 36.2 38.0 75-79 37.07595 38.0 38.0 38.0 36.0 38.0 80-84 37.04275 38.0 38.0 38.0 36.0 38.0 85-89 36.98905 38.0 38.0 38.0 36.0 38.0 90-94 36.8714 38.0 38.0 38.0 35.0 38.0 95-99 36.77345 38.0 38.0 38.0 34.8 38.0 100-104 36.705549999999995 38.0 38.0 38.0 34.6 38.0 105-109 36.637299999999996 38.0 38.0 38.0 34.4 38.0 110-114 36.395950000000006 38.0 38.0 38.0 34.0 38.0 115-119 36.21835 38.0 37.6 38.0 33.6 38.0 120-124 36.146 38.0 37.0 38.0 33.4 38.0 125-129 36.0709 38.0 37.2 38.0 33.0 38.0 130-134 35.70715 38.0 36.4 38.0 31.6 38.0 135-139 35.437400000000004 38.0 36.0 38.0 31.0 38.0 140-144 35.197500000000005 38.0 35.6 38.0 30.0 38.0 145-149 34.7718 38.0 35.2 38.0 28.4 38.0 150-151 31.59125 36.5 31.5 38.0 14.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 0.0 12 1.0 13 0.0 14 0.0 15 1.0 16 0.0 17 2.0 18 2.0 19 2.0 20 3.0 21 2.0 22 2.0 23 6.0 24 7.0 25 10.0 26 10.0 27 13.0 28 14.0 29 25.0 30 31.0 31 37.0 32 62.0 33 77.0 34 115.0 35 243.0 36 635.0 37 2699.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.375 15.15 11.575000000000001 35.9 2 21.349999999999998 20.349999999999998 34.35 23.95 3 18.325 27.025 26.875 27.775 4 21.65 33.575 22.525000000000002 22.25 5 21.975 35.625 23.325000000000003 19.075 6 17.849999999999998 36.8 25.1 20.25 7 14.075 23.075000000000003 44.474999999999994 18.375 8 18.175 23.3 29.65 28.875 9 17.325 24.275 31.624999999999996 26.775 10-14 19.555 29.345 27.474999999999998 23.625 15-19 19.74 28.175 27.935 24.15 20-24 19.365 28.515 28.060000000000002 24.060000000000002 25-29 20.424999999999997 29.03 27.6 22.945 30-34 19.93 28.585 27.534999999999997 23.95 35-39 19.785 28.42 27.775 24.02 40-44 20.064999999999998 28.360000000000003 27.675 23.9 45-49 19.91 28.349999999999998 27.045 24.695 50-54 20.369999999999997 27.98 28.215 23.435 55-59 20.415 28.115000000000002 27.505000000000003 23.965 60-64 19.81 28.22 27.785 24.185000000000002 65-69 20.169999999999998 27.889999999999997 27.82 24.12 70-74 20.21 27.73 28.075 23.985 75-79 19.900000000000002 28.044999999999998 28.095 23.96 80-84 20.064999999999998 27.779999999999998 27.62 24.535 85-89 19.945 27.815 28.244999999999997 23.995 90-94 20.68 27.755000000000003 27.485 24.08 95-99 19.895 28.485 27.894999999999996 23.724999999999998 100-104 20.31 27.92 27.83 23.94 105-109 20.49 28.225 27.655 23.630000000000003 110-114 20.955 28.060000000000002 27.38 23.605 115-119 21.060000000000002 27.905 27.515 23.52 120-124 20.635 27.860000000000003 27.48 24.025 125-129 20.655 27.315 27.400000000000002 24.63 130-134 20.435 27.42 27.785 24.36 135-139 20.724999999999998 27.889999999999997 27.439999999999998 23.945 140-144 20.91 27.495000000000005 27.439999999999998 24.154999999999998 145-149 20.86 27.529999999999998 27.384999999999998 24.224999999999998 150-151 21.462500000000002 28.249999999999996 27.0 23.2875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.5 11 0.5 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 1.5 22 4.0 23 3.5 24 1.5 25 2.0 26 2.0 27 4.0 28 12.0 29 17.5 30 18.5 31 25.5 32 35.5 33 43.5 34 52.0 35 65.0 36 80.0 37 98.5 38 125.0 39 153.0 40 176.5 41 219.0 42 248.0 43 244.5 44 263.5 45 271.5 46 279.5 47 287.0 48 248.5 49 211.5 50 171.5 51 139.5 52 120.5 53 90.5 54 72.0 55 58.0 56 43.5 57 28.0 58 16.0 59 13.5 60 11.5 61 6.5 62 4.5 63 5.0 64 4.0 65 5.0 66 5.0 67 1.5 68 0.5 69 0.5 70 1.0 71 1.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.94997498749375 99.9 2 0.05002501250625312 0.1 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.32499999999999996 0.0 0.0 0.0 0.0 100-101 0.3625 0.0 0.0 0.0 0.0 102-103 0.4125 0.0 0.0 0.0 0.0 104-105 0.4875 0.0 0.0 0.0 0.0 106-107 0.525 0.0 0.0 0.0 0.0 108-109 0.6 0.0 0.0 0.0 0.0 110-111 0.675 0.0 0.0 0.0 0.0 112-113 0.7375 0.0 0.0 0.0 0.0 114-115 0.825 0.0 0.0 0.0 0.0 116-117 0.9874999999999999 0.0 0.0 0.0 0.0 118-119 1.1125 0.0 0.0 0.0 0.0 120-121 1.2999999999999998 0.0 0.0 0.0 0.0 122-123 1.3625 0.0 0.0 0.0 0.0 124-125 1.475 0.0 0.0 0.0 0.0 126-127 1.625 0.0 0.0 0.0 0.0 128-129 1.8375 0.0 0.0 0.0 0.0 130-131 2.0875 0.0 0.0 0.0 0.0 132-133 2.2750000000000004 0.0 0.0 0.0 0.0 134-135 2.4375 0.0 0.0 0.0 0.0 136-137 2.6125 0.0 0.0 0.0 0.0 138-139 2.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCTCTCC 10 0.006830828 145.0 5 >>END_MODULE SRR7171901 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171901_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8955 33.0 33.0 34.0 32.0 34.0 2 33.01825 34.0 33.0 34.0 32.0 34.0 3 33.0495 34.0 33.0 34.0 32.0 34.0 4 33.0085 34.0 33.0 34.0 33.0 34.0 5 32.99075 34.0 33.0 34.0 33.0 34.0 6 37.03 38.0 38.0 38.0 37.0 38.0 7 37.1375 38.0 38.0 38.0 37.0 38.0 8 37.13575 38.0 38.0 38.0 37.0 38.0 9 37.03125 38.0 38.0 38.0 37.0 38.0 10-14 37.0307 38.0 38.0 38.0 36.6 38.0 15-19 37.04795 38.0 38.0 38.0 37.0 38.0 20-24 37.095299999999995 38.0 38.0 38.0 37.0 38.0 25-29 37.06725 38.0 38.0 38.0 37.0 38.0 30-34 36.97769999999999 38.0 38.0 38.0 36.4 38.0 35-39 36.595299999999995 38.0 38.0 38.0 36.0 38.0 40-44 36.512649999999994 38.0 38.0 38.0 35.8 38.0 45-49 36.9022 38.0 38.0 38.0 36.0 38.0 50-54 36.89059999999999 38.0 38.0 38.0 36.0 38.0 55-59 36.8454 38.0 38.0 38.0 36.0 38.0 60-64 36.77755 38.0 38.0 38.0 36.0 38.0 65-69 36.748000000000005 38.0 38.0 38.0 35.8 38.0 70-74 36.656600000000005 38.0 38.0 38.0 35.4 38.0 75-79 36.63415 38.0 38.0 38.0 35.0 38.0 80-84 36.6287 38.0 38.0 38.0 35.2 38.0 85-89 36.46935 38.0 38.0 38.0 34.6 38.0 90-94 36.32860000000001 38.0 38.0 38.0 34.0 38.0 95-99 36.2522 38.0 38.0 38.0 34.0 38.0 100-104 36.0707 38.0 38.0 38.0 33.6 38.0 105-109 35.90965 38.0 37.4 38.0 32.8 38.0 110-114 35.86985000000001 38.0 37.2 38.0 33.0 38.0 115-119 35.7817 38.0 37.2 38.0 32.6 38.0 120-124 35.4585 38.0 36.8 38.0 31.0 38.0 125-129 35.2431 38.0 36.2 38.0 30.0 38.0 130-134 35.00425 38.0 36.0 38.0 28.4 38.0 135-139 34.770300000000006 38.0 35.6 38.0 28.4 38.0 140-144 34.60365 38.0 35.4 38.0 27.8 38.0 145-149 34.0852 38.0 34.8 38.0 24.8 38.0 150-151 30.597125 36.5 29.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 3.0 4 2.0 5 3.0 6 5.0 7 2.0 8 2.0 9 3.0 10 2.0 11 2.0 12 0.0 13 4.0 14 4.0 15 2.0 16 4.0 17 6.0 18 2.0 19 7.0 20 10.0 21 5.0 22 9.0 23 9.0 24 11.0 25 11.0 26 12.0 27 24.0 28 24.0 29 27.0 30 29.0 31 44.0 32 55.0 33 96.0 34 142.0 35 263.0 36 641.0 37 2527.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.85 16.625 17.4 26.125 2 26.924999999999997 22.575 31.775 18.725 3 21.5 28.525 30.15 19.825 4 24.075 33.925 22.075 19.925 5 23.799999999999997 36.575 22.675 16.950000000000003 6 21.025 35.825 23.3 19.85 7 19.125 18.5 40.025 22.35 8 21.975 22.05 27.224999999999998 28.749999999999996 9 22.15 25.025 28.775000000000002 24.05 10-14 23.11 28.58 26.279999999999998 22.03 15-19 23.225 27.36 27.79 21.625 20-24 22.98 28.23 27.35 21.44 25-29 22.985 28.110000000000003 27.575 21.33 30-34 22.876472062139815 28.343773490353296 27.68228514156853 21.09746930593836 35-39 23.729926270073733 28.32037167962832 26.623573376426624 21.326128673871324 40-44 23.33501768569985 27.761495704901467 27.80192016169783 21.101566447700858 45-49 23.35 28.689999999999998 26.875 21.085 50-54 23.544999999999998 27.889999999999997 27.205000000000002 21.36 55-59 23.95 27.839999999999996 27.12 21.09 60-64 23.5 28.32 27.200000000000003 20.979999999999997 65-69 23.375 27.994999999999997 27.325 21.305 70-74 23.595 27.950000000000003 27.534999999999997 20.919999999999998 75-79 23.74 27.145000000000003 27.74 21.375 80-84 23.78 28.9 26.61 20.71 85-89 24.154999999999998 28.050000000000004 27.189999999999998 20.605 90-94 23.11 28.13 27.839999999999996 20.919999999999998 95-99 24.305 27.375 27.73 20.59 100-104 24.32 28.655 26.6 20.424999999999997 105-109 23.825 28.060000000000002 27.544999999999998 20.57 110-114 24.255 27.82 27.49 20.435 115-119 24.075 28.17 27.525 20.23 120-124 24.685000000000002 27.744999999999997 27.66 19.91 125-129 23.825 28.060000000000002 27.229999999999997 20.885 130-134 24.09 28.43 27.11 20.369999999999997 135-139 24.495 27.560000000000002 27.834999999999997 20.11 140-144 24.395 27.985 26.939999999999998 20.68 145-149 24.185000000000002 28.294999999999998 27.305 20.215 150-151 25.362499999999997 27.675 26.424999999999997 20.5375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 1.0 21 2.0 22 1.5 23 1.0 24 1.0 25 1.5 26 1.0 27 1.0 28 5.0 29 7.5 30 9.5 31 11.5 32 12.5 33 22.5 34 39.0 35 51.5 36 66.0 37 86.5 38 115.0 39 157.5 40 185.0 41 208.5 42 260.5 43 280.5 44 288.0 45 282.0 46 271.5 47 282.5 48 264.5 49 222.5 50 183.0 51 157.5 52 123.0 53 99.5 54 77.5 55 51.0 56 41.5 57 34.5 58 23.5 59 15.5 60 13.0 61 10.5 62 7.5 63 5.0 64 4.0 65 3.0 66 2.0 67 1.5 68 1.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.22499999999999998 35-39 0.9900000000000001 40-44 1.05 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69894631209232 99.35000000000001 2 0.2508780732563974 0.5 3 0.050175614651279475 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.025 0.0 72-73 0.0 0.0 0.0 0.025 0.0 74-75 0.0125 0.0 0.0 0.025 0.0 76-77 0.025 0.0 0.0 0.025 0.0 78-79 0.025 0.0 0.0 0.025 0.0 80-81 0.025 0.0 0.0 0.025 0.0 82-83 0.05 0.0 0.0 0.025 0.0 84-85 0.05 0.0 0.0 0.025 0.0 86-87 0.05 0.0 0.0 0.025 0.0 88-89 0.05 0.0 0.0 0.025 0.0 90-91 0.1125 0.0 0.0 0.025 0.0 92-93 0.15 0.0 0.0 0.025 0.0 94-95 0.2 0.0 0.0 0.025 0.0 96-97 0.275 0.0 0.0 0.025 0.0 98-99 0.32499999999999996 0.0 0.0 0.025 0.0 100-101 0.3625 0.0 0.0 0.025 0.0 102-103 0.4125 0.0 0.0 0.025 0.0 104-105 0.5125 0.0 0.0 0.025 0.0 106-107 0.55 0.0 0.0 0.025 0.0 108-109 0.625 0.0 0.0 0.025 0.0 110-111 0.7 0.0 0.0 0.025 0.0 112-113 0.7625 0.0 0.0 0.025 0.0 114-115 0.85 0.0 0.0 0.025 0.0 116-117 1.0125 0.0 0.0 0.025 0.0 118-119 1.1375 0.0 0.0 0.025 0.0 120-121 1.2999999999999998 0.0 0.0 0.025 0.0 122-123 1.375 0.0 0.0 0.025 0.0 124-125 1.5 0.0 0.0 0.025 0.0 126-127 1.6625 0.0 0.0 0.025 0.0 128-129 1.8875 0.0 0.0 0.025 0.0 130-131 2.125 0.0 0.0 0.025 0.0 132-133 2.325 0.0 0.0 0.025 0.0 134-135 2.475 0.0 0.0 0.025 0.0 136-137 2.6625 0.0 0.0 0.025 0.0 138-139 2.9749999999999996 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 772061 spots for SRR7171901.sra Written 772061 spots for SRR7171901.sra Read 772061 spots for SRR7171901.sra Written 772061 spots for SRR7171901.sra Read 772061 spots for SRR7171901.sra Written 772061 spots for SRR7171901.sra Read 772061 spots for SRR7171901.sra Written 772061 spots for SRR7171901.sra Read 772061 spots for SRR7171901.sra Written 772061 spots for SRR7171901.sra Read 772061 spots for SRR7171901.sra Read 772061 spots for SRR7171901.sra Written 772061 spots for SRR7171901.sra Read 772061 spots for SRR7171901.sra Written 772061 spots for SRR7171901.sra Written 772061 spots for SRR7171901.sra Read 772061 spots for SRR7171901.sra Written 772061 spots for SRR7171901.sra Read 772061 spots for SRR7171901.sra Read 772061 spots for SRR7171901.sra Written 772061 spots for SRR7171901.sra Written 772061 spots for SRR7171901.sra Read 772061 spots for SRR7171901.sra Written 772061 spots for SRR7171901.sra Read 772061 spots for SRR7171901.sra Written 772061 spots for SRR7171901.sra Read 772061 spots for SRR7171901.sra Written 772061 spots for SRR7171901.sra Read 772062 spots for SRR7171901.sra Written 772062 spots for SRR7171901.sra Read 772061 spots for SRR7171901.sra Written 772061 spots for SRR7171901.sra Read 772061 spots for SRR7171901.sra Written 772061 spots for SRR7171901.sra Read 772061 spots for SRR7171901.sra Written 772061 spots for SRR7171901.sra Read 772061 spots for SRR7171901.sra Written 772061 spots for SRR7171901.sra Read 772061 spots for SRR7171901.sra Written 772061 spots for SRR7171901.sra SRR ids: ['SRR7171901.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ipxd6b5v SRR7171901.sra spots: 15441221 blocks: [[1, 772061], [772062, 1544122], [1544123, 2316183], [2316184, 3088244], [3088245, 3860305], [3860306, 4632366], [4632367, 5404427], [5404428, 6176488], [6176489, 6948549], [6948550, 7720610], [7720611, 8492671], [8492672, 9264732], [9264733, 10036793], [10036794, 10808854], [10808855, 11580915], [11580916, 12352976], [12352977, 13125037], [13125038, 13897098], [13897099, 14669159], [14669160, 15441221]] SRR7171901 file size 5210822 SRR7171901 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171901 SRR7171901_1.fastq SRR7171901_2.fastq Input file: SRR7171901_1.fastq Paired file: SRR7171901_2.fastq trimmed: SRR7171901-trimmed-pair1.fastq, SRR7171901-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 23:47:54 2025 >> started Thu Feb 13 23:48:13 2025 >> done (18.754s) 15441221 read pairs processed; of these: 22028 ( 0.14%) short read pairs filtered out after trimming by size control 16570 ( 0.11%) empty read pairs filtered out after trimming by size control 15402623 (99.75%) read pairs available; of these: 6206228 (40.29%) trimmed read pairs available after processing 9196395 (59.71%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 4 0.00% 20 2 0.00% 21 2 0.00% 22 5 0.00% 23 5 0.00% 24 7 0.00% 25 2 0.00% 26 1 0.00% 27 7 0.00% 28 7 0.00% 29 6 0.00% 30 6 0.00% 31 9 0.00% 32 6 0.00% 33 5 0.00% 34 1 0.00% 35 4 0.00% 36 4 0.00% 37 5 0.00% 38 5 0.00% 39 4 0.00% 40 6 0.00% 41 10 0.00% 42 7 0.00% 43 6 0.00% 44 10 0.00% 45 17 0.00% 46 6 0.00% 47 12 0.00% 48 20 0.00% 49 18 0.00% 50 13 0.00% 51 19 0.00% 52 26 0.00% 53 23 0.00% 54 29 0.00% 55 38 0.00% 56 34 0.00% 57 44 0.00% 58 49 0.00% 59 71 0.00% 60 56 0.00% 61 72 0.00% 62 93 0.00% 63 92 0.00% 64 73 0.00% 65 119 0.00% 66 126 0.00% 67 128 0.00% 68 181 0.00% 69 199 0.00% 70 206 0.00% 71 218 0.00% 72 287 0.00% 73 299 0.00% 74 333 0.00% 75 401 0.00% 76 531 0.00% 77 477 0.00% 78 549 0.00% 79 637 0.00% 80 699 0.00% 81 802 0.01% 82 924 0.01% 83 1141 0.01% 84 2026 0.01% 85 2762 0.02% 86 2818 0.02% 87 3221 0.02% 88 3150 0.02% 89 3404 0.02% 90 3413 0.02% 91 3540 0.02% 92 3837 0.02% 93 3993 0.03% 94 4223 0.03% 95 4447 0.03% 96 4659 0.03% 97 5007 0.03% 98 5168 0.03% 99 5498 0.04% 100 5763 0.04% 101 6245 0.04% 102 6748 0.04% 103 7200 0.05% 104 7717 0.05% 105 8240 0.05% 106 8557 0.06% 107 9067 0.06% 108 9594 0.06% 109 10166 0.07% 110 10838 0.07% 111 11324 0.07% 112 11996 0.08% 113 12644 0.08% 114 13274 0.09% 115 14485 0.09% 116 15003 0.10% 117 15883 0.10% 118 16372 0.11% 119 17202 0.11% 120 18449 0.12% 121 18846 0.12% 122 19697 0.13% 123 21150 0.14% 124 22065 0.14% 125 23341 0.15% 126 24465 0.16% 127 25496 0.17% 128 26521 0.17% 129 28190 0.18% 130 29849 0.19% 131 31183 0.20% 132 33626 0.22% 133 36134 0.23% 134 38295 0.25% 135 40306 0.26% 136 43522 0.28% 137 45977 0.30% 138 49785 0.32% 139 54239 0.35% 140 58910 0.38% 141 65036 0.42% 142 73084 0.47% 143 82342 0.53% 144 96933 0.63% 145 116349 0.76% 146 147955 0.96% 147 204918 1.33% 148 322772 2.10% 149 659905 4.28% 150 3458202 22.45% 151 9196395 59.71% 15402623 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.31 fanout-score-rank=27 prefix-density=0.27 prefix-fanout=2.2 sequence=CAGGTGCAGTTTGATCCACA criterion=fanout-score sequence-density=0.10 sequence-density-rank=19 fanout-score=78.22 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=18.9 sequence=CATCACCAACAG criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=2.68 fanout-score-rank=29 prefix-density=0.35 prefix-fanout=2.6 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=315.53 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=12.7 sequence=TTTCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCCTTCGATGATGAGAACAAGATCATAACTCTTAATGGTTTGGAAGGAGAT SRR7171901 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 23:49:05 Started mapping on | Feb 13 23:49:05 Finished on | Feb 13 23:50:59 Mapping speed, Million of reads per hour | 486.40 Number of input reads | 15402623 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 14294988 Uniquely mapped reads % | 92.81% Average mapped length | 296.60 Number of splices: Total | 14302877 Number of splices: Annotated (sjdb) | 14038903 Number of splices: GT/AG | 14074437 Number of splices: GC/AG | 176503 Number of splices: AT/AC | 11515 Number of splices: Non-canonical | 40422 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.46 Insertion rate per base | 0.02% Insertion average length | 2.58 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 447021 % of reads mapped to multiple loci | 2.90% Number of reads mapped to too many loci | 52025 % of reads mapped to too many loci | 0.34% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.87% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 680419 680419 680419 N_multimapping 447021 447021 447021 N_noFeature 311621 14145442 391283 N_ambiguous 146212 963 75843 UnstrandedReadsAssigned:13837155 PositiveStrandReadsAssigned:148583 NegativeStrandReadsAssigned:13827862 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7171901 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171901-trimmed-pair1.fastq SRR7171901-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,402,623 reads, 13,726,292 reads pseudoaligned [quant] estimated average fragment length: 255.56 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,079 rounds 52401 SRR7171901.ke.tsv 34699 SRR7171901.se.tsv 87100 total ==> SRR7171901.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1763.44 1511 55.3101 Potri.005G024800.1.v4.1 1035 780.44 315 26.0538 Potri.004G059700.1.v4.1 961 706.45 15 1.3706 Potri.007G009000.2.v4.1 1416 1161.44 0 0 Potri.003G141000.2.v4.1 2943 2688.44 329 7.89944 Potri.016G087400.1.v4.1 270 68.7537 1242 1166.07 Potri.015G069301.1.v4.1 564 313.138 0 0 Potri.010G195200.1.v4.1 1773 1518.44 362.864 15.4258 Potri.012G127500.1.v4.1 977 722.445 4828 431.383 ==> SRR7171901.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 20 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 374 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 413 SRR7171901 completed mapping pipeline successfully