Starting /dee2/code/volunteer_pipeline.sh SRR7171902 current disk space = 3089037586432 free memory = 1579372176 SRR7171902 SRAfilesize d57e552bbbc69abd39de979d0d87eba1 SRR7171902.sra SRR7171902.sra file validated SRR7171902 is paired end SRR7171902 is conventional basespace SRR7171902 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171902_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.73575 33.0 33.0 34.0 32.0 34.0 2 33.0935 34.0 33.0 34.0 33.0 34.0 3 32.2845 33.0 32.0 33.0 31.0 34.0 4 31.9665 33.0 31.0 33.0 30.0 34.0 5 32.656 33.0 33.0 33.0 32.0 34.0 6 36.5195 38.0 37.0 38.0 34.0 38.0 7 37.347 38.0 38.0 38.0 36.0 38.0 8 37.4865 38.0 38.0 38.0 37.0 38.0 9 37.5755 38.0 38.0 38.0 37.0 38.0 10-14 37.544349999999994 38.0 38.0 38.0 37.4 38.0 15-19 37.5835 38.0 38.0 38.0 38.0 38.0 20-24 37.5632 38.0 38.0 38.0 38.0 38.0 25-29 37.4825 38.0 38.0 38.0 37.2 38.0 30-34 37.4933 38.0 38.0 38.0 37.0 38.0 35-39 37.50279999999999 38.0 38.0 38.0 37.0 38.0 40-44 37.43235 38.0 38.0 38.0 37.0 38.0 45-49 37.37434999999999 38.0 38.0 38.0 37.0 38.0 50-54 37.3722 38.0 38.0 38.0 37.0 38.0 55-59 37.305400000000006 38.0 38.0 38.0 37.0 38.0 60-64 37.2461 38.0 38.0 38.0 36.6 38.0 65-69 37.17235 38.0 38.0 38.0 36.0 38.0 70-74 37.1625 38.0 38.0 38.0 36.0 38.0 75-79 37.07795 38.0 38.0 38.0 36.0 38.0 80-84 36.99025 38.0 38.0 38.0 36.0 38.0 85-89 36.971199999999996 38.0 38.0 38.0 36.0 38.0 90-94 36.887800000000006 38.0 38.0 38.0 35.2 38.0 95-99 36.789699999999996 38.0 38.0 38.0 35.0 38.0 100-104 36.708349999999996 38.0 38.0 38.0 34.6 38.0 105-109 36.5691 38.0 38.0 38.0 34.2 38.0 110-114 36.30245 38.0 37.4 38.0 34.0 38.0 115-119 36.195800000000006 38.0 37.0 38.0 33.4 38.0 120-124 35.9807 38.0 37.0 38.0 32.8 38.0 125-129 35.971500000000006 38.0 37.0 38.0 32.6 38.0 130-134 35.653000000000006 38.0 36.0 38.0 31.0 38.0 135-139 35.365899999999996 38.0 36.0 38.0 30.6 38.0 140-144 35.1374 38.0 35.8 38.0 29.8 38.0 145-149 34.542100000000005 38.0 35.0 38.0 27.6 38.0 150-151 31.47325 36.5 31.5 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 2.0 11 0.0 12 1.0 13 0.0 14 0.0 15 0.0 16 1.0 17 0.0 18 0.0 19 0.0 20 5.0 21 3.0 22 5.0 23 4.0 24 5.0 25 11.0 26 10.0 27 16.0 28 15.0 29 27.0 30 23.0 31 50.0 32 47.0 33 88.0 34 144.0 35 243.0 36 703.0 37 2596.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.475 14.75 11.525 36.25 2 20.0 20.549999999999997 36.475 22.975 3 20.875 26.325 25.6 27.200000000000003 4 24.125 34.65 20.275000000000002 20.95 5 21.55 35.975 24.825 17.65 6 16.875 36.95 26.900000000000002 19.275000000000002 7 13.5 22.225 45.275 19.0 8 18.7 21.575 30.525000000000002 29.2 9 18.05 21.95 32.125 27.875 10-14 20.015 29.909999999999997 26.545 23.53 15-19 19.93 28.265 28.199999999999996 23.605 20-24 20.145 28.470000000000002 28.175 23.21 25-29 20.1 29.220000000000002 27.48 23.200000000000003 30-34 19.205 29.095 27.72 23.98 35-39 20.580000000000002 28.720000000000002 27.36 23.34 40-44 20.13 28.249999999999996 27.54 24.08 45-49 20.04 28.389999999999997 27.900000000000002 23.669999999999998 50-54 20.31 28.405 27.48 23.805 55-59 19.939999999999998 28.575 27.755000000000003 23.73 60-64 19.615 28.155 28.34 23.89 65-69 20.13 27.810000000000002 27.71 24.349999999999998 70-74 20.16 28.249999999999996 27.860000000000003 23.73 75-79 19.93 28.275 28.115000000000002 23.68 80-84 20.16 28.125 27.894999999999996 23.82 85-89 20.405 28.16 27.71 23.724999999999998 90-94 20.515 28.384999999999998 27.265 23.835 95-99 20.235 27.685 27.66 24.42 100-104 20.535 27.915 27.474999999999998 24.075 105-109 20.495 28.27 28.04 23.195 110-114 20.285 28.395 27.215 24.104999999999997 115-119 20.52 27.49 28.01 23.98 120-124 20.674999999999997 28.365000000000002 27.41 23.549999999999997 125-129 20.775 27.994999999999997 27.860000000000003 23.369999999999997 130-134 20.674999999999997 28.365000000000002 27.43 23.53 135-139 20.965 28.115000000000002 27.415 23.505000000000003 140-144 20.865000000000002 27.794999999999998 27.560000000000002 23.78 145-149 20.805 27.985 27.435 23.775 150-151 21.05 27.8625 27.6375 23.45 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.5 23 1.0 24 1.0 25 4.0 26 7.0 27 7.0 28 8.0 29 14.0 30 17.0 31 22.5 32 35.0 33 44.5 34 54.0 35 68.5 36 84.0 37 103.5 38 129.0 39 162.0 40 207.0 41 229.5 42 245.5 43 268.5 44 277.0 45 267.5 46 261.0 47 258.5 48 230.5 49 201.5 50 172.0 51 137.0 52 111.5 53 93.0 54 70.0 55 48.5 56 32.0 57 28.0 58 25.0 59 17.0 60 14.0 61 9.0 62 7.5 63 5.0 64 5.0 65 4.5 66 2.0 67 2.5 68 1.5 69 0.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.2625 0.0 0.0 0.0 0.0 98-99 0.3 0.0 0.0 0.0 0.0 100-101 0.3125 0.0 0.0 0.0 0.0 102-103 0.35 0.0 0.0 0.0 0.0 104-105 0.375 0.0 0.0 0.0 0.0 106-107 0.4625 0.0 0.0 0.0 0.0 108-109 0.525 0.0 0.0 0.0 0.0 110-111 0.6375 0.0 0.0 0.0 0.0 112-113 0.7 0.0 0.0 0.0 0.0 114-115 0.7875 0.0 0.0 0.0 0.0 116-117 0.8374999999999999 0.0 0.0 0.0 0.0 118-119 0.9 0.0 0.0 0.0 0.0 120-121 0.9624999999999999 0.0 0.0 0.0 0.0 122-123 1.1 0.0 0.0 0.0 0.0 124-125 1.3375 0.0 0.0 0.0 0.0 126-127 1.475 0.0 0.0 0.0 0.0 128-129 1.675 0.0 0.0 0.0 0.0 130-131 1.9625 0.0 0.0 0.0 0.0 132-133 2.1875 0.0 0.0 0.0 0.0 134-135 2.3625 0.0 0.0 0.0 0.0 136-137 2.65 0.0 0.0 0.0 0.0 138-139 2.8875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7171902 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171902_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.93525 33.0 33.0 34.0 32.0 34.0 2 33.01 34.0 33.0 34.0 32.0 34.0 3 33.07575 34.0 33.0 34.0 32.0 34.0 4 33.02725 34.0 33.0 34.0 32.0 34.0 5 32.996 34.0 33.0 34.0 32.0 34.0 6 37.14625 38.0 38.0 38.0 37.0 38.0 7 37.319 38.0 38.0 38.0 37.0 38.0 8 37.19 38.0 38.0 38.0 37.0 38.0 9 37.20275 38.0 38.0 38.0 37.0 38.0 10-14 37.1534 38.0 38.0 38.0 37.0 38.0 15-19 37.168099999999995 38.0 38.0 38.0 37.0 38.0 20-24 37.19945 38.0 38.0 38.0 37.0 38.0 25-29 37.1509 38.0 38.0 38.0 37.0 38.0 30-34 37.055550000000004 38.0 38.0 38.0 36.8 38.0 35-39 36.6929 38.0 38.0 38.0 36.0 38.0 40-44 36.570750000000004 38.0 38.0 38.0 36.0 38.0 45-49 36.976150000000004 38.0 38.0 38.0 36.0 38.0 50-54 36.9803 38.0 38.0 38.0 36.0 38.0 55-59 36.93295 38.0 38.0 38.0 36.0 38.0 60-64 36.88844999999999 38.0 38.0 38.0 36.0 38.0 65-69 36.85535 38.0 38.0 38.0 35.8 38.0 70-74 36.78315 38.0 38.0 38.0 35.0 38.0 75-79 36.733850000000004 38.0 38.0 38.0 35.2 38.0 80-84 36.7554 38.0 38.0 38.0 35.4 38.0 85-89 36.6156 38.0 38.0 38.0 34.6 38.0 90-94 36.53395 38.0 38.0 38.0 34.2 38.0 95-99 36.443450000000006 38.0 38.0 38.0 34.0 38.0 100-104 36.171299999999995 38.0 37.8 38.0 33.6 38.0 105-109 36.0938 38.0 37.8 38.0 33.0 38.0 110-114 36.0428 38.0 37.4 38.0 33.2 38.0 115-119 35.939499999999995 38.0 37.0 38.0 32.8 38.0 120-124 35.4827 38.0 36.6 38.0 30.2 38.0 125-129 35.3511 38.0 36.0 38.0 30.0 38.0 130-134 35.2179 38.0 36.0 38.0 29.6 38.0 135-139 34.924 38.0 35.4 38.0 28.6 38.0 140-144 34.584950000000006 38.0 35.0 38.0 27.2 38.0 145-149 34.061499999999995 38.0 34.6 38.0 25.0 38.0 150-151 30.57 36.5 29.0 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 1.0 4 0.0 5 1.0 6 3.0 7 0.0 8 1.0 9 1.0 10 0.0 11 4.0 12 1.0 13 0.0 14 0.0 15 3.0 16 3.0 17 3.0 18 0.0 19 9.0 20 6.0 21 3.0 22 3.0 23 8.0 24 13.0 25 11.0 26 19.0 27 17.0 28 29.0 29 39.0 30 44.0 31 61.0 32 63.0 33 92.0 34 159.0 35 283.0 36 586.0 37 2527.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.800000000000004 15.975 17.175 27.05 2 23.05 24.975 34.825 17.150000000000002 3 22.825 27.025 28.325 21.825 4 25.775 34.8 21.05 18.375 5 24.45 37.125 20.75 17.675 6 19.975 38.15 23.45 18.425 7 19.225 17.849999999999998 41.25 21.675 8 21.05 22.075 29.175 27.700000000000003 9 22.2 25.25 27.525 25.025 10-14 23.56 28.970000000000002 26.064999999999998 21.404999999999998 15-19 23.225 28.105000000000004 27.560000000000002 21.11 20-24 23.405 28.449999999999996 27.339999999999996 20.805 25-29 23.955000000000002 28.595 26.619999999999997 20.830000000000002 30-34 23.59573082126572 28.726762539459838 27.12331512752418 20.554191511750265 35-39 23.021655535316736 27.62092693786683 28.26856911556365 21.088848411252783 40-44 24.174265450861196 27.573454913880447 27.183383991894633 21.068895643363728 45-49 23.41 28.165000000000003 27.55 20.875 50-54 23.35 28.315 27.900000000000002 20.435 55-59 23.52 27.38 27.97 21.13 60-64 22.655 28.18 27.755000000000003 21.41 65-69 23.5 27.779999999999998 27.825 20.895 70-74 24.23 28.42 26.810000000000002 20.54 75-79 23.75 27.99 27.51 20.75 80-84 23.465 27.405 28.115000000000002 21.015 85-89 24.005000000000003 28.02 27.38 20.595 90-94 23.369999999999997 27.994999999999997 27.495000000000005 21.14 95-99 23.9 28.345 26.995 20.76 100-104 23.875 27.800000000000004 27.800000000000004 20.525 105-109 23.13 28.22 27.779999999999998 20.87 110-114 23.24 28.015 28.1 20.645 115-119 23.805 28.044999999999998 28.09 20.06 120-124 23.494999999999997 27.900000000000002 27.82 20.785 125-129 24.34 28.22 27.37 20.07 130-134 23.849999999999998 28.1 27.779999999999998 20.27 135-139 24.245 27.650000000000002 28.095 20.01 140-144 24.505 27.450000000000003 27.865000000000002 20.18 145-149 24.34 27.61 27.52 20.53 150-151 24.45 27.3625 28.075 20.1125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 2.0 26 3.5 27 3.0 28 3.5 29 5.5 30 8.0 31 13.5 32 15.0 33 19.0 34 37.5 35 56.0 36 80.0 37 102.0 38 128.0 39 167.5 40 196.0 41 222.5 42 254.5 43 277.0 44 291.0 45 304.5 46 297.0 47 267.0 48 233.0 49 202.0 50 164.5 51 141.5 52 118.5 53 91.5 54 73.0 55 46.5 56 34.5 57 34.0 58 27.5 59 17.5 60 10.0 61 8.0 62 10.5 63 9.5 64 9.5 65 6.0 66 3.0 67 3.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.215 35-39 1.18 40-44 1.3 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.2625 0.0 0.0 0.0 0.0 98-99 0.3 0.0 0.0 0.0 0.0 100-101 0.3125 0.0 0.0 0.0 0.0 102-103 0.35 0.0 0.0 0.0 0.0 104-105 0.375 0.0 0.0 0.0 0.0 106-107 0.4625 0.0 0.0 0.0 0.0 108-109 0.525 0.0 0.0 0.0 0.0 110-111 0.6375 0.0 0.0 0.0 0.0 112-113 0.7 0.0 0.0 0.0 0.0 114-115 0.7875 0.0 0.0 0.0 0.0 116-117 0.8374999999999999 0.0 0.0 0.0 0.0 118-119 0.9 0.0 0.0 0.0 0.0 120-121 0.9624999999999999 0.0 0.0 0.0 0.0 122-123 1.1 0.0 0.0 0.0 0.0 124-125 1.3375 0.0 0.0 0.0 0.0 126-127 1.475 0.0 0.0 0.0 0.0 128-129 1.675 0.0 0.0 0.0 0.0 130-131 1.9625 0.0 0.0 0.0 0.0 132-133 2.175 0.0 0.0 0.0 0.0 134-135 2.3499999999999996 0.0 0.0 0.0 0.0 136-137 2.6375 0.0 0.0 0.0 0.0 138-139 2.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 694125 spots for SRR7171902.sra Written 694125 spots for SRR7171902.sra Read 694125 spots for SRR7171902.sra Written 694125 spots for SRR7171902.sra Read 694125 spots for SRR7171902.sra Written 694125 spots for SRR7171902.sra Read 694125 spots for SRR7171902.sra Written 694125 spots for SRR7171902.sra Read 694125 spots for SRR7171902.sra Written 694125 spots for SRR7171902.sra Read 694125 spots for SRR7171902.sra Written 694125 spots for SRR7171902.sra Read 694125 spots for SRR7171902.sra Written 694125 spots for SRR7171902.sra Read 694125 spots for SRR7171902.sra Written 694125 spots for SRR7171902.sra Read 694125 spots for SRR7171902.sra Written 694125 spots for SRR7171902.sra Read 694125 spots for SRR7171902.sra Written 694125 spots for SRR7171902.sra Read 694125 spots for SRR7171902.sra Written 694125 spots for SRR7171902.sra Read 694125 spots for SRR7171902.sra Written 694125 spots for SRR7171902.sra Read 694125 spots for SRR7171902.sra Written 694125 spots for SRR7171902.sra Read 694125 spots for SRR7171902.sra Written 694125 spots for SRR7171902.sra Read 694125 spots for SRR7171902.sra Written 694125 spots for SRR7171902.sra Read 694127 spots for SRR7171902.sra Written 694127 spots for SRR7171902.sra Read 694125 spots for SRR7171902.sra Written 694125 spots for SRR7171902.sra Read 694125 spots for SRR7171902.sra Written 694125 spots for SRR7171902.sra Read 694125 spots for SRR7171902.sra Written 694125 spots for SRR7171902.sra Read 694125 spots for SRR7171902.sra Written 694125 spots for SRR7171902.sra SRR ids: ['SRR7171902.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dll_ibk0 SRR7171902.sra spots: 13882502 blocks: [[1, 694125], [694126, 1388250], [1388251, 2082375], [2082376, 2776500], [2776501, 3470625], [3470626, 4164750], [4164751, 4858875], [4858876, 5553000], [5553001, 6247125], [6247126, 6941250], [6941251, 7635375], [7635376, 8329500], [8329501, 9023625], [9023626, 9717750], [9717751, 10411875], [10411876, 11106000], [11106001, 11800125], [11800126, 12494250], [12494251, 13188375], [13188376, 13882502]] SRR7171902 file size 4682624 SRR7171902 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171902 SRR7171902_1.fastq SRR7171902_2.fastq Input file: SRR7171902_1.fastq Paired file: SRR7171902_2.fastq trimmed: SRR7171902-trimmed-pair1.fastq, SRR7171902-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 01:08:10 2025 >> started Fri Feb 14 01:08:25 2025 >> done (15.036s) 13882502 read pairs processed; of these: 16063 ( 0.12%) short read pairs filtered out after trimming by size control 13310 ( 0.10%) empty read pairs filtered out after trimming by size control 13853129 (99.79%) read pairs available; of these: 5686961 (41.05%) trimmed read pairs available after processing 8166168 (58.95%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 2 0.00% 20 1 0.00% 21 1 0.00% 22 5 0.00% 23 4 0.00% 24 3 0.00% 25 3 0.00% 26 5 0.00% 27 5 0.00% 28 2 0.00% 29 2 0.00% 30 6 0.00% 31 4 0.00% 32 3 0.00% 33 2 0.00% 34 3 0.00% 35 2 0.00% 36 3 0.00% 37 4 0.00% 38 3 0.00% 39 3 0.00% 40 11 0.00% 41 4 0.00% 42 8 0.00% 43 11 0.00% 44 9 0.00% 45 12 0.00% 46 20 0.00% 47 12 0.00% 48 12 0.00% 49 11 0.00% 50 22 0.00% 51 25 0.00% 52 28 0.00% 53 45 0.00% 54 38 0.00% 55 32 0.00% 56 39 0.00% 57 46 0.00% 58 62 0.00% 59 48 0.00% 60 51 0.00% 61 71 0.00% 62 83 0.00% 63 64 0.00% 64 86 0.00% 65 123 0.00% 66 126 0.00% 67 141 0.00% 68 136 0.00% 69 203 0.00% 70 168 0.00% 71 249 0.00% 72 301 0.00% 73 333 0.00% 74 337 0.00% 75 424 0.00% 76 544 0.00% 77 564 0.00% 78 580 0.00% 79 620 0.00% 80 750 0.01% 81 826 0.01% 82 905 0.01% 83 1112 0.01% 84 1800 0.01% 85 2333 0.02% 86 2530 0.02% 87 2692 0.02% 88 2960 0.02% 89 2970 0.02% 90 3052 0.02% 91 3235 0.02% 92 3485 0.03% 93 3684 0.03% 94 3853 0.03% 95 4222 0.03% 96 4372 0.03% 97 4691 0.03% 98 4939 0.04% 99 5165 0.04% 100 5590 0.04% 101 5932 0.04% 102 6302 0.05% 103 6811 0.05% 104 7192 0.05% 105 7559 0.05% 106 8047 0.06% 107 8502 0.06% 108 8961 0.06% 109 9427 0.07% 110 10034 0.07% 111 10731 0.08% 112 11366 0.08% 113 12075 0.09% 114 12673 0.09% 115 13663 0.10% 116 13752 0.10% 117 14649 0.11% 118 15269 0.11% 119 15895 0.11% 120 16517 0.12% 121 17281 0.12% 122 18115 0.13% 123 19315 0.14% 124 20228 0.15% 125 21313 0.15% 126 22426 0.16% 127 23830 0.17% 128 24372 0.18% 129 25774 0.19% 130 26961 0.19% 131 28799 0.21% 132 30540 0.22% 133 32096 0.23% 134 34034 0.25% 135 36289 0.26% 136 39100 0.28% 137 42126 0.30% 138 45117 0.33% 139 49188 0.36% 140 53734 0.39% 141 59310 0.43% 142 66425 0.48% 143 75105 0.54% 144 87800 0.63% 145 107365 0.78% 146 136866 0.99% 147 190886 1.38% 148 302129 2.18% 149 617573 4.46% 150 3146573 22.71% 151 8166168 58.95% 13853129 reads passed initial QC criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=3.23 fanout-score-rank=26 prefix-density=0.44 prefix-fanout=2.2 sequence=CATCTCAGACCTCTCATAGAACATCTTAACTGGTGCAACACCTGCAATGATTGTCTCAGTTGTGGTGTTCTCTGAGAAACCTAAGTCAGGGTACATGCCACATTTGCA criterion=fanout-score sequence-density=0.04 sequence-density-rank=33 fanout-score=14.58 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=3.9 sequence=TTGGCCTTCACGTTGTCAATGGTGTCTGAGCTCTC criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=2.54 fanout-score-rank=22 prefix-density=0.50 prefix-fanout=2.4 sequence=ATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.13 sequence-density-rank=16 fanout-score=19.68 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=7.6 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7171902 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 01:09:11 Started mapping on | Feb 14 01:09:11 Finished on | Feb 14 01:11:15 Mapping speed, Million of reads per hour | 402.19 Number of input reads | 13853129 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 12842872 Uniquely mapped reads % | 92.71% Average mapped length | 296.56 Number of splices: Total | 12744996 Number of splices: Annotated (sjdb) | 12488941 Number of splices: GT/AG | 12543348 Number of splices: GC/AG | 159264 Number of splices: AT/AC | 9484 Number of splices: Non-canonical | 32900 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.48 Insertion rate per base | 0.02% Insertion average length | 2.59 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 351120 % of reads mapped to multiple loci | 2.53% Number of reads mapped to too many loci | 50754 % of reads mapped to too many loci | 0.37% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.30% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 673296 673296 673296 N_multimapping 351120 351120 351120 N_noFeature 304507 12724062 356644 N_ambiguous 136047 994 68725 UnstrandedReadsAssigned:12402318 PositiveStrandReadsAssigned:117816 NegativeStrandReadsAssigned:12417503 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7171902 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171902-trimmed-pair1.fastq SRR7171902-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,853,129 reads, 12,331,600 reads pseudoaligned [quant] estimated average fragment length: 253.116 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,273 rounds 52401 SRR7171902.ke.tsv 34699 SRR7171902.se.tsv 87100 total ==> SRR7171902.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1765.88 1616 69.8745 Potri.005G024800.1.v4.1 1035 782.884 925 90.2161 Potri.004G059700.1.v4.1 961 708.911 13 1.4002 Potri.007G009000.2.v4.1 1416 1163.88 0 0 Potri.003G141000.2.v4.1 2943 2690.88 731 20.7425 Potri.016G087400.1.v4.1 270 69.785 900 984.737 Potri.015G069301.1.v4.1 564 315.55 0 0 Potri.010G195200.1.v4.1 1773 1520.88 648.939 32.5797 Potri.012G127500.1.v4.1 977 724.911 3527 371.501 ==> SRR7171902.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 45 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 306 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 126 SRR7171902 completed mapping pipeline successfully