Starting /dee2/code/volunteer_pipeline.sh SRR7171903 current disk space = 3088936304640 free memory = 1578817144 SRR7171903 SRAfilesize 17b16f953560c396cf69ea29cdfb207d SRR7171903.sra SRR7171903.sra file validated SRR7171903 is paired end SRR7171903 is conventional basespace SRR7171903 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171903_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.9695 31.0 18.0 33.0 18.0 33.0 2 31.16025 33.0 30.0 33.0 28.0 33.0 3 32.236 33.0 33.0 33.0 31.0 33.0 4 32.6805 33.0 33.0 33.0 31.0 34.0 5 32.75675 33.0 33.0 33.0 32.0 34.0 6 36.815 38.0 37.0 38.0 35.0 38.0 7 37.305 38.0 38.0 38.0 36.0 38.0 8 37.3885 38.0 38.0 38.0 37.0 38.0 9 37.484 38.0 38.0 38.0 37.0 38.0 10-14 37.53635 38.0 38.0 38.0 37.0 38.0 15-19 37.52255 38.0 38.0 38.0 37.6 38.0 20-24 37.46435 38.0 38.0 38.0 37.0 38.0 25-29 37.4266 38.0 38.0 38.0 37.0 38.0 30-34 37.39685 38.0 38.0 38.0 37.0 38.0 35-39 37.319300000000005 38.0 38.0 38.0 37.0 38.0 40-44 37.32935 38.0 38.0 38.0 37.0 38.0 45-49 37.30285 38.0 38.0 38.0 37.0 38.0 50-54 37.2082 38.0 38.0 38.0 36.6 38.0 55-59 37.16325 38.0 38.0 38.0 36.0 38.0 60-64 37.071000000000005 38.0 38.0 38.0 36.0 38.0 65-69 37.0467 38.0 38.0 38.0 36.0 38.0 70-74 36.95524999999999 38.0 38.0 38.0 36.0 38.0 75-79 36.9236 38.0 38.0 38.0 35.4 38.0 80-84 36.7821 38.0 38.0 38.0 35.2 38.0 85-89 36.7736 38.0 38.0 38.0 34.8 38.0 90-94 36.6717 38.0 38.0 38.0 34.4 38.0 95-99 36.5297 38.0 38.0 38.0 34.2 38.0 100-104 36.383799999999994 38.0 37.8 38.0 34.0 38.0 105-109 36.2333 38.0 37.2 38.0 33.6 38.0 110-114 36.020399999999995 38.0 37.0 38.0 33.0 38.0 115-119 35.96925 38.0 37.0 38.0 33.0 38.0 120-124 35.7804 38.0 37.0 38.0 31.4 38.0 125-129 35.55005 38.0 36.4 38.0 30.6 38.0 130-134 35.11035 38.0 36.0 38.0 28.4 38.0 135-139 34.8639 38.0 35.0 38.0 28.0 38.0 140-144 34.4169 38.0 35.0 38.0 26.0 38.0 145-149 33.82965 38.0 35.0 38.0 22.6 38.0 150-151 30.578874999999996 36.5 29.5 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 1.0 14 2.0 15 1.0 16 2.0 17 2.0 18 4.0 19 2.0 20 3.0 21 5.0 22 12.0 23 8.0 24 5.0 25 11.0 26 16.0 27 19.0 28 20.0 29 29.0 30 34.0 31 47.0 32 62.0 33 126.0 34 160.0 35 293.0 36 775.0 37 2359.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.925000000000004 15.4 13.075000000000001 34.599999999999994 2 19.609804902451224 20.885442721360683 37.543771885942974 21.96098049024512 3 18.525 26.575 27.55 27.35 4 21.15 34.35 23.225 21.275 5 20.575 35.975 25.35 18.099999999999998 6 18.224999999999998 34.849999999999994 26.900000000000002 20.025000000000002 7 13.575000000000001 22.075 44.875 19.475 8 17.474999999999998 22.625 31.724999999999998 28.175 9 18.65 22.6 32.2 26.55 10-14 19.755 29.310000000000002 27.075 23.86 15-19 19.575 28.194999999999997 28.18 24.05 20-24 19.665 28.175 28.115000000000002 24.044999999999998 25-29 19.1 29.255 27.98 23.665 30-34 19.725 28.975 27.61 23.69 35-39 20.595 27.994999999999997 27.91 23.5 40-44 20.225 28.389999999999997 28.125 23.26 45-49 20.119999999999997 28.37 27.884999999999998 23.625 50-54 19.64 28.015 28.265 24.08 55-59 19.900000000000002 28.665000000000003 27.88 23.555 60-64 19.905 28.79 27.85 23.455000000000002 65-69 19.91 28.835 27.51 23.745 70-74 20.02 28.470000000000002 27.694999999999997 23.815 75-79 19.98 28.005000000000003 28.49 23.525 80-84 20.419999999999998 28.7 27.255000000000003 23.625 85-89 20.395 28.1 28.04 23.465 90-94 20.365 28.615000000000002 27.0 24.02 95-99 19.845 28.389999999999997 27.63 24.135 100-104 20.47 28.53 27.54 23.46 105-109 20.525 28.32 27.595 23.56 110-114 20.02 28.665000000000003 27.74 23.575 115-119 20.54 28.625 27.245 23.59 120-124 20.395 28.444999999999997 26.97 24.19 125-129 20.369999999999997 27.925 28.055000000000003 23.65 130-134 20.565 28.525 27.500000000000004 23.41 135-139 20.68 28.444999999999997 27.555000000000003 23.32 140-144 20.535 27.529999999999998 28.225 23.71 145-149 21.14 28.16 27.400000000000002 23.3 150-151 21.2875 28.6875 26.150000000000002 23.875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 0.5 17 0.5 18 0.5 19 0.0 20 0.5 21 1.0 22 1.5 23 1.5 24 4.0 25 5.5 26 5.5 27 5.0 28 7.0 29 14.0 30 21.0 31 26.5 32 34.0 33 52.0 34 57.5 35 68.0 36 93.0 37 118.5 38 130.5 39 162.5 40 195.0 41 218.0 42 239.5 43 254.5 44 286.0 45 289.0 46 294.0 47 278.5 48 233.0 49 196.5 50 158.5 51 128.0 52 109.5 53 82.0 54 51.5 55 36.5 56 29.0 57 25.0 58 22.0 59 19.0 60 14.0 61 8.5 62 5.0 63 3.5 64 3.5 65 2.5 66 1.5 67 1.5 68 1.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.1875 0.0 0.0 0.0 0.0 98-99 0.21250000000000002 0.0 0.0 0.0 0.0 100-101 0.2625 0.0 0.0 0.0 0.0 102-103 0.3375 0.0 0.0 0.0 0.0 104-105 0.375 0.0 0.0 0.0 0.0 106-107 0.375 0.0 0.0 0.0 0.0 108-109 0.475 0.0 0.0 0.0 0.0 110-111 0.6 0.0 0.0 0.0 0.0 112-113 0.75 0.0 0.0 0.0 0.0 114-115 0.825 0.0 0.0 0.0 0.0 116-117 0.9125 0.0 0.0 0.0 0.0 118-119 1.0375 0.0 0.0 0.0 0.0 120-121 1.1375 0.0 0.0 0.0 0.0 122-123 1.2875 0.0 0.0 0.0 0.0 124-125 1.4 0.0 0.0 0.0 0.0 126-127 1.7 0.0 0.0 0.0 0.0 128-129 1.7875 0.0 0.0 0.0 0.0 130-131 1.8875000000000002 0.0 0.0 0.0 0.0 132-133 1.975 0.0 0.0 0.0 0.0 134-135 2.1624999999999996 0.0 0.0 0.0 0.0 136-137 2.4875 0.0 0.0 0.0 0.0 138-139 2.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGTCTC 10 0.006830828 145.0 2 CCAGCAT 10 0.006830828 145.0 8 TAACCAT 10 0.006830828 145.0 145 >>END_MODULE SRR7171903 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171903_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.92725 33.0 33.0 34.0 32.0 34.0 2 33.06975 34.0 33.0 34.0 32.0 34.0 3 33.108 34.0 33.0 34.0 32.0 34.0 4 32.989 34.0 33.0 34.0 32.0 34.0 5 33.08 34.0 33.0 34.0 33.0 34.0 6 37.281 38.0 38.0 38.0 37.0 38.0 7 37.38 38.0 38.0 38.0 37.0 38.0 8 37.2015 38.0 38.0 38.0 37.0 38.0 9 37.22275 38.0 38.0 38.0 37.0 38.0 10-14 37.24435 38.0 38.0 38.0 37.0 38.0 15-19 37.28085 38.0 38.0 38.0 37.0 38.0 20-24 37.25 38.0 38.0 38.0 37.0 38.0 25-29 37.2476 38.0 38.0 38.0 37.0 38.0 30-34 37.12665 38.0 38.0 38.0 37.0 38.0 35-39 36.903800000000004 38.0 38.0 38.0 36.4 38.0 40-44 36.80115 38.0 38.0 38.0 36.0 38.0 45-49 37.1004 38.0 38.0 38.0 36.6 38.0 50-54 37.09590000000001 38.0 38.0 38.0 36.4 38.0 55-59 37.072 38.0 38.0 38.0 36.0 38.0 60-64 36.9915 38.0 38.0 38.0 36.0 38.0 65-69 36.97175 38.0 38.0 38.0 36.0 38.0 70-74 36.886900000000004 38.0 38.0 38.0 35.8 38.0 75-79 36.8861 38.0 38.0 38.0 36.0 38.0 80-84 36.7763 38.0 38.0 38.0 35.4 38.0 85-89 36.6242 38.0 38.0 38.0 35.0 38.0 90-94 36.519099999999995 38.0 38.0 38.0 34.2 38.0 95-99 36.31849999999999 38.0 38.0 38.0 33.8 38.0 100-104 36.30245 38.0 38.0 38.0 34.0 38.0 105-109 36.153749999999995 38.0 38.0 38.0 33.6 38.0 110-114 36.00335 38.0 37.8 38.0 33.4 38.0 115-119 35.6904 38.0 37.0 38.0 31.6 38.0 120-124 35.66879999999999 38.0 37.0 38.0 32.0 38.0 125-129 35.333549999999995 38.0 36.0 38.0 30.6 38.0 130-134 35.14399999999999 38.0 36.0 38.0 29.4 38.0 135-139 34.8614 38.0 35.6 38.0 28.2 38.0 140-144 34.4012 38.0 35.2 38.0 26.4 38.0 145-149 33.732899999999994 38.0 35.0 38.0 22.2 38.0 150-151 30.602625 36.5 29.5 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 1.0 4 0.0 5 0.0 6 0.0 7 1.0 8 0.0 9 1.0 10 1.0 11 0.0 12 2.0 13 0.0 14 3.0 15 6.0 16 0.0 17 6.0 18 2.0 19 5.0 20 6.0 21 8.0 22 14.0 23 6.0 24 14.0 25 12.0 26 17.0 27 17.0 28 30.0 29 37.0 30 48.0 31 41.0 32 53.0 33 88.0 34 143.0 35 271.0 36 623.0 37 2538.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.575 17.325 15.225 26.875 2 22.425 24.425 35.8 17.349999999999998 3 20.8 27.800000000000004 29.675 21.725 4 25.1 35.05 21.575 18.275 5 23.525 37.475 21.625 17.375 6 17.925 37.2 24.55 20.325 7 18.325 17.424999999999997 41.325 22.925 8 21.0 22.400000000000002 28.249999999999996 28.349999999999998 9 22.075 24.675 27.700000000000003 25.55 10-14 22.89 28.084999999999997 26.66 22.365 15-19 22.68 28.365000000000002 27.605 21.349999999999998 20-24 22.755 28.050000000000004 28.09 21.105 25-29 23.09 28.615000000000002 27.339999999999996 20.955 30-34 23.226905919502784 27.55751591398927 27.87830183950679 21.337276327001153 35-39 22.90145525958004 28.646961075582862 27.851352031824362 20.60023163301274 40-44 23.36575777430573 28.179023234715995 27.382692404616705 21.072526586361576 45-49 23.34 27.715 28.084999999999997 20.86 50-54 23.13 28.194999999999997 27.98 20.695 55-59 23.28 28.439999999999998 27.76 20.52 60-64 23.57 28.275 27.805000000000003 20.349999999999998 65-69 23.425 28.21 27.905 20.46 70-74 23.335 28.38 27.42 20.865000000000002 75-79 22.955000000000002 28.384999999999998 27.66 21.0 80-84 23.5 28.515 27.529999999999998 20.455000000000002 85-89 23.419999999999998 28.065 27.894999999999996 20.62 90-94 22.965 28.355000000000004 27.74 20.94 95-99 23.53 27.345000000000002 28.175 20.95 100-104 23.674999999999997 28.115000000000002 27.705000000000002 20.505000000000003 105-109 24.05 27.57 28.07 20.31 110-114 23.9 27.800000000000004 27.189999999999998 21.11 115-119 24.055 27.650000000000002 27.875 20.419999999999998 120-124 24.205 28.02 27.425 20.349999999999998 125-129 23.705000000000002 28.255000000000003 27.584999999999997 20.455000000000002 130-134 24.365000000000002 28.035 27.639999999999997 19.96 135-139 24.165 27.935 27.16 20.74 140-144 24.515 27.694999999999997 27.63 20.16 145-149 24.65 27.54 27.66 20.150000000000002 150-151 24.887500000000003 27.425 28.3125 19.375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 1.5 24 3.5 25 3.0 26 2.5 27 3.0 28 5.5 29 10.0 30 14.5 31 16.5 32 18.5 33 28.5 34 43.5 35 54.5 36 74.5 37 100.0 38 124.5 39 150.0 40 203.5 41 262.5 42 273.0 43 282.0 44 290.5 45 290.5 46 288.5 47 263.0 48 230.5 49 198.0 50 160.0 51 131.5 52 116.5 53 99.5 54 76.0 55 51.5 56 34.5 57 25.0 58 19.5 59 17.0 60 10.5 61 3.5 62 3.0 63 6.0 64 4.5 65 1.0 66 1.0 67 1.0 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.245 35-39 0.705 40-44 0.795 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69902182091799 99.375 2 0.27589666415851516 0.5499999999999999 3 0.025081514923501375 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.1875 0.0 0.0 0.0 0.0 98-99 0.21250000000000002 0.0 0.0 0.0 0.0 100-101 0.2625 0.0 0.0 0.0 0.0 102-103 0.3375 0.0 0.0 0.0 0.0 104-105 0.375 0.0 0.0 0.0 0.0 106-107 0.375 0.0 0.0 0.0 0.0 108-109 0.475 0.0 0.0 0.0 0.0 110-111 0.6 0.0 0.0 0.0 0.0 112-113 0.7749999999999999 0.0 0.0 0.0 0.0 114-115 0.85 0.0 0.0 0.0 0.0 116-117 0.9625 0.0 0.0 0.0 0.0 118-119 1.0750000000000002 0.0 0.0 0.0 0.0 120-121 1.1625 0.0 0.0 0.0 0.0 122-123 1.3125 0.0 0.0 0.0 0.0 124-125 1.4249999999999998 0.0 0.0 0.0 0.0 126-127 1.7 0.0 0.0 0.0 0.0 128-129 1.7875 0.0 0.0 0.0 0.0 130-131 1.8875000000000002 0.0 0.0 0.0 0.0 132-133 1.975 0.0 0.0 0.0 0.0 134-135 2.1624999999999996 0.0 0.0 0.0 0.0 136-137 2.4625 0.0 0.0 0.0 0.0 138-139 2.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGAAGAA 10 0.0068608476 144.78749 7 GGAGGAC 10 0.0068608476 144.78749 1 >>END_MODULE Read 1040694 spots for SRR7171903.sra Written 1040694 spots for SRR7171903.sra Read 1040694 spots for SRR7171903.sra Written 1040694 spots for SRR7171903.sra Read 1040694 spots for SRR7171903.sra Written 1040694 spots for SRR7171903.sra Read 1040694 spots for SRR7171903.sra Written 1040694 spots for SRR7171903.sra Read 1040694 spots for SRR7171903.sra Written 1040694 spots for SRR7171903.sra Read 1040694 spots for SRR7171903.sra Written 1040694 spots for SRR7171903.sra Read 1040694 spots for SRR7171903.sra Written 1040694 spots for SRR7171903.sra Read 1040703 spots for SRR7171903.sra Written 1040703 spots for SRR7171903.sra Read 1040694 spots for SRR7171903.sra Written 1040694 spots for SRR7171903.sra Read 1040694 spots for SRR7171903.sra Written 1040694 spots for SRR7171903.sra Read 1040694 spots for SRR7171903.sra Written 1040694 spots for SRR7171903.sra Read 1040694 spots for SRR7171903.sra Written 1040694 spots for SRR7171903.sra Read 1040694 spots for SRR7171903.sra Written 1040694 spots for SRR7171903.sra Read 1040694 spots for SRR7171903.sra Written 1040694 spots for SRR7171903.sra Read 1040694 spots for SRR7171903.sra Written 1040694 spots for SRR7171903.sra Read 1040694 spots for SRR7171903.sra Written 1040694 spots for SRR7171903.sra Read 1040694 spots for SRR7171903.sra Written 1040694 spots for SRR7171903.sra Read 1040694 spots for SRR7171903.sra Written 1040694 spots for SRR7171903.sra Read 1040694 spots for SRR7171903.sra Written 1040694 spots for SRR7171903.sra Read 1040694 spots for SRR7171903.sra Written 1040694 spots for SRR7171903.sra SRR ids: ['SRR7171903.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1jh77o93 SRR7171903.sra spots: 20813889 blocks: [[1, 1040694], [1040695, 2081388], [2081389, 3122082], [3122083, 4162776], [4162777, 5203470], [5203471, 6244164], [6244165, 7284858], [7284859, 8325552], [8325553, 9366246], [9366247, 10406940], [10406941, 11447634], [11447635, 12488328], [12488329, 13529022], [13529023, 14569716], [14569717, 15610410], [15610411, 16651104], [16651105, 17691798], [17691799, 18732492], [18732493, 19773186], [19773187, 20813889]] SRR7171903 file size 7031443 SRR7171903 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171903 SRR7171903_1.fastq SRR7171903_2.fastq Input file: SRR7171903_1.fastq Paired file: SRR7171903_2.fastq trimmed: SRR7171903-trimmed-pair1.fastq, SRR7171903-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 01:35:27 2025 >> started Fri Feb 14 01:35:51 2025 >> done (23.949s) 20813889 read pairs processed; of these: 21257 ( 0.10%) short read pairs filtered out after trimming by size control 18543 ( 0.09%) empty read pairs filtered out after trimming by size control 20774089 (99.81%) read pairs available; of these: 9127087 (43.93%) trimmed read pairs available after processing 11647002 (56.07%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 3 0.00% 20 2 0.00% 21 12 0.00% 22 5 0.00% 23 5 0.00% 24 6 0.00% 25 5 0.00% 26 12 0.00% 27 5 0.00% 28 3 0.00% 29 6 0.00% 30 8 0.00% 31 4 0.00% 32 4 0.00% 33 6 0.00% 34 12 0.00% 35 6 0.00% 36 9 0.00% 37 10 0.00% 38 14 0.00% 39 12 0.00% 40 6 0.00% 41 17 0.00% 42 8 0.00% 43 14 0.00% 44 12 0.00% 45 14 0.00% 46 14 0.00% 47 18 0.00% 48 26 0.00% 49 19 0.00% 50 30 0.00% 51 23 0.00% 52 40 0.00% 53 47 0.00% 54 43 0.00% 55 62 0.00% 56 42 0.00% 57 68 0.00% 58 77 0.00% 59 88 0.00% 60 103 0.00% 61 107 0.00% 62 111 0.00% 63 125 0.00% 64 139 0.00% 65 159 0.00% 66 185 0.00% 67 219 0.00% 68 242 0.00% 69 289 0.00% 70 342 0.00% 71 412 0.00% 72 454 0.00% 73 481 0.00% 74 496 0.00% 75 651 0.00% 76 858 0.00% 77 838 0.00% 78 860 0.00% 79 967 0.00% 80 1151 0.01% 81 1241 0.01% 82 1369 0.01% 83 1662 0.01% 84 2680 0.01% 85 3440 0.02% 86 3511 0.02% 87 3892 0.02% 88 3968 0.02% 89 4183 0.02% 90 4480 0.02% 91 4775 0.02% 92 4959 0.02% 93 5260 0.03% 94 5766 0.03% 95 6030 0.03% 96 6453 0.03% 97 6741 0.03% 98 7096 0.03% 99 7618 0.04% 100 8142 0.04% 101 8645 0.04% 102 9224 0.04% 103 9674 0.05% 104 10427 0.05% 105 11112 0.05% 106 11580 0.06% 107 12088 0.06% 108 12878 0.06% 109 13415 0.06% 110 13858 0.07% 111 14940 0.07% 112 15987 0.08% 113 16635 0.08% 114 17796 0.09% 115 18801 0.09% 116 19832 0.10% 117 20598 0.10% 118 23286 0.11% 119 20296 0.10% 120 23464 0.11% 121 24704 0.12% 122 25763 0.12% 123 27452 0.13% 124 29269 0.14% 125 30399 0.15% 126 32158 0.15% 127 33994 0.16% 128 35687 0.17% 129 37990 0.18% 130 39683 0.19% 131 42492 0.20% 132 45078 0.22% 133 49160 0.24% 134 52150 0.25% 135 52412 0.25% 136 56723 0.27% 137 62491 0.30% 138 68200 0.33% 139 73951 0.36% 140 82729 0.40% 141 91963 0.44% 142 106025 0.51% 143 122300 0.59% 144 146457 0.70% 145 178237 0.86% 146 232996 1.12% 147 331543 1.60% 148 523572 2.52% 149 1086030 5.23% 150 4997666 24.06% 151 11647002 56.07% 20774089 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=31 prefix-density=0.15 prefix-fanout=1.9 sequence=CAGGTGCAGTTTGATCC criterion=fanout-score sequence-density=0.08 sequence-density-rank=18 fanout-score=388.43 fanout-score-rank=1 prefix-density=0.93 prefix-fanout=35.3 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=4.74 fanout-score-rank=25 prefix-density=0.24 prefix-fanout=3.5 sequence=TGCAAGTGCGGCAGTG criterion=fanout-score sequence-density=0.09 sequence-density-rank=13 fanout-score=382.88 fanout-score-rank=1 prefix-density=1.03 prefix-fanout=32.6 sequence=AAGAAGAAGAAA SRR7171903 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 01:36:39 Started mapping on | Feb 14 01:36:40 Finished on | Feb 14 01:38:53 Mapping speed, Million of reads per hour | 562.31 Number of input reads | 20774089 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 19474823 Uniquely mapped reads % | 93.75% Average mapped length | 296.46 Number of splices: Total | 20074879 Number of splices: Annotated (sjdb) | 19718473 Number of splices: GT/AG | 19746204 Number of splices: GC/AG | 259939 Number of splices: AT/AC | 15145 Number of splices: Non-canonical | 53591 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.59 Insertion rate per base | 0.02% Insertion average length | 2.65 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 554013 % of reads mapped to multiple loci | 2.67% Number of reads mapped to too many loci | 54213 % of reads mapped to too many loci | 0.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.24% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 765123 765123 765123 N_multimapping 554013 554013 554013 N_noFeature 453355 19289947 538445 N_ambiguous 206897 1197 106364 UnstrandedReadsAssigned:18814571 PositiveStrandReadsAssigned:183679 NegativeStrandReadsAssigned:18830014 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7171903 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171903-trimmed-pair1.fastq SRR7171903-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,774,089 reads, 18,644,312 reads pseudoaligned [quant] estimated average fragment length: 268.841 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,274 rounds 52401 SRR7171903.ke.tsv 34699 SRR7171903.se.tsv 87100 total ==> SRR7171903.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1750.16 949 27.8197 Potri.005G024800.1.v4.1 1035 767.159 370 24.7446 Potri.004G059700.1.v4.1 961 693.22 73 5.40276 Potri.007G009000.2.v4.1 1416 1148.16 0 0 Potri.003G141000.2.v4.1 2943 2675.16 575 11.0276 Potri.016G087400.1.v4.1 270 68.0808 1256.95 947.233 Potri.015G069301.1.v4.1 564 303.201 0 0 Potri.010G195200.1.v4.1 1773 1505.16 158 5.38566 Potri.012G127500.1.v4.1 977 709.176 10023 725.117 ==> SRR7171903.se.tsv <== Potri.001G166300.v4.1 3 Potri.001G448400.v4.1 218 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 473 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 131 SRR7171903 completed mapping pipeline successfully