Starting /dee2/code/volunteer_pipeline.sh SRR7171904 current disk space = 2818764234752 free memory = 1463794536 SRR7171904 SRAfilesize c198d0271179fa63a0080a279817a7ea SRR7171904.sra SRR7171904.sra file validated SRR7171904 is paired end SRR7171904 is conventional basespace SRR7171904 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171904_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.06625 32.0 25.0 33.0 18.0 33.0 2 30.261 31.0 29.0 33.0 25.0 33.0 3 30.97125 32.0 32.0 33.0 27.0 33.0 4 30.43275 32.0 31.0 33.0 25.0 33.0 5 32.23825 33.0 32.0 33.0 32.0 33.0 6 36.31375 38.0 36.0 38.0 33.0 38.0 7 37.311 38.0 38.0 38.0 36.0 38.0 8 37.41375 38.0 38.0 38.0 37.0 38.0 9 37.53275 38.0 38.0 38.0 37.0 38.0 10-14 37.611149999999995 38.0 38.0 38.0 38.0 38.0 15-19 37.60475 38.0 38.0 38.0 38.0 38.0 20-24 37.581 38.0 38.0 38.0 38.0 38.0 25-29 37.574749999999995 38.0 38.0 38.0 38.0 38.0 30-34 37.549 38.0 38.0 38.0 38.0 38.0 35-39 37.54109999999999 38.0 38.0 38.0 37.8 38.0 40-44 37.51905000000001 38.0 38.0 38.0 37.6 38.0 45-49 37.459050000000005 38.0 38.0 38.0 37.0 38.0 50-54 37.378099999999996 38.0 38.0 38.0 37.0 38.0 55-59 37.3683 38.0 38.0 38.0 37.0 38.0 60-64 37.278949999999995 38.0 38.0 38.0 37.0 38.0 65-69 37.221050000000005 38.0 38.0 38.0 36.4 38.0 70-74 37.2322 38.0 38.0 38.0 36.0 38.0 75-79 37.191250000000004 38.0 38.0 38.0 36.0 38.0 80-84 37.11659999999999 38.0 38.0 38.0 36.0 38.0 85-89 37.003 38.0 38.0 38.0 36.0 38.0 90-94 36.96515 38.0 38.0 38.0 36.0 38.0 95-99 36.8552 38.0 38.0 38.0 35.2 38.0 100-104 36.74165000000001 38.0 38.0 38.0 34.8 38.0 105-109 36.64205 38.0 38.0 38.0 34.6 38.0 110-114 36.561899999999994 38.0 38.0 38.0 34.2 38.0 115-119 36.4188 38.0 37.6 38.0 34.0 38.0 120-124 36.2922 38.0 37.0 38.0 33.6 38.0 125-129 36.070100000000004 38.0 36.8 38.0 33.4 38.0 130-134 35.77685 38.0 36.0 38.0 32.0 38.0 135-139 35.576049999999995 38.0 36.0 38.0 31.0 38.0 140-144 35.3874 38.0 36.0 38.0 31.0 38.0 145-149 34.81205 38.0 35.0 38.0 28.6 38.0 150-151 31.665 36.5 31.5 38.0 14.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 2.0 11 1.0 12 1.0 13 0.0 14 0.0 15 2.0 16 0.0 17 1.0 18 2.0 19 0.0 20 1.0 21 3.0 22 0.0 23 1.0 24 10.0 25 10.0 26 10.0 27 5.0 28 14.0 29 26.0 30 29.0 31 32.0 32 46.0 33 85.0 34 129.0 35 277.0 36 752.0 37 2561.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.625 12.675 13.025 34.675 2 21.030257564391096 18.804701175293822 39.38484621155289 20.78019504876219 3 18.7 24.375 26.0 30.925000000000004 4 23.474999999999998 32.725 22.45 21.349999999999998 5 21.7 34.849999999999994 24.175 19.275000000000002 6 18.15 37.0 23.400000000000002 21.45 7 15.0 22.825 43.6 18.575 8 20.200000000000003 22.275 29.799999999999997 27.725 9 18.4 22.525000000000002 33.45 25.624999999999996 10-14 20.155 28.845 27.250000000000004 23.75 15-19 20.74 28.544999999999998 27.52 23.195 20-24 20.485 28.444999999999997 27.685 23.385 25-29 20.560000000000002 28.345 27.63 23.465 30-34 20.11 28.189999999999998 28.04 23.66 35-39 20.47 28.33 27.27 23.93 40-44 20.43 28.65 27.975 22.945 45-49 20.674999999999997 28.37 27.315 23.64 50-54 20.380000000000003 28.185 27.705000000000002 23.73 55-59 20.580000000000002 28.26 27.92 23.24 60-64 20.560000000000002 27.715 28.225 23.5 65-69 20.9 27.785 27.975 23.34 70-74 20.424999999999997 28.110000000000003 28.15 23.315 75-79 20.555 27.779999999999998 27.700000000000003 23.965 80-84 20.26 28.055000000000003 27.185 24.5 85-89 20.625 27.700000000000003 27.99 23.685000000000002 90-94 20.97 27.72 27.67 23.64 95-99 21.25 27.655 27.779999999999998 23.315 100-104 20.605 27.805000000000003 28.285 23.305 105-109 20.830000000000002 27.905 28.050000000000004 23.215 110-114 21.465 27.650000000000002 27.625 23.26 115-119 21.925 28.185 27.36 22.53 120-124 21.525 28.005000000000003 27.58 22.89 125-129 20.880000000000003 27.355 28.225 23.54 130-134 20.965 27.815 27.900000000000002 23.32 135-139 20.68 27.500000000000004 27.83 23.990000000000002 140-144 20.93 27.065 28.185 23.82 145-149 21.08 28.035 27.785 23.1 150-151 21.1375 26.650000000000002 27.700000000000003 24.5125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 1.0 25 3.0 26 5.5 27 3.5 28 4.5 29 9.0 30 13.5 31 16.0 32 20.0 33 30.5 34 41.5 35 61.5 36 87.5 37 107.5 38 128.5 39 158.5 40 185.0 41 218.0 42 254.5 43 278.5 44 284.0 45 281.0 46 264.5 47 261.5 48 251.0 49 207.0 50 176.5 51 161.0 52 132.5 53 92.5 54 66.5 55 50.5 56 41.5 57 30.5 58 20.0 59 11.0 60 11.0 61 10.5 62 5.0 63 5.0 64 4.0 65 1.0 66 0.5 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0625 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.1375 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.2125 0.0 0.0 0.0 0.0 108-109 0.3375 0.0 0.0 0.0 0.0 110-111 0.4 0.0 0.0 0.0 0.0 112-113 0.475 0.0 0.0 0.0 0.0 114-115 0.6000000000000001 0.0 0.0 0.0 0.0 116-117 0.7124999999999999 0.0 0.0 0.0 0.0 118-119 0.825 0.0 0.0 0.0 0.0 120-121 0.9874999999999999 0.0 0.0 0.0 0.0 122-123 1.2000000000000002 0.0 0.0 0.0 0.0 124-125 1.3250000000000002 0.0 0.0 0.0 0.0 126-127 1.4875 0.0 0.0 0.0 0.0 128-129 1.6749999999999998 0.0 0.0 0.0 0.0 130-131 1.8375 0.0 0.0 0.0 0.0 132-133 1.9875 0.0 0.0 0.0 0.0 134-135 2.2125000000000004 0.0 0.0 0.0 0.0 136-137 2.3875 0.0 0.0 0.0 0.0 138-139 2.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATAAAA 10 0.006830828 145.0 5 CTTGGGC 10 0.006830828 145.0 1 ATAAAAT 10 0.006830828 145.0 6 >>END_MODULE SRR7171904 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171904_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.1065 33.0 33.0 34.0 33.0 34.0 2 33.153 34.0 33.0 34.0 33.0 34.0 3 33.21825 34.0 33.0 34.0 33.0 34.0 4 33.18325 34.0 33.0 34.0 33.0 34.0 5 33.1245 34.0 33.0 34.0 33.0 34.0 6 37.312 38.0 38.0 38.0 37.0 38.0 7 37.368 38.0 38.0 38.0 38.0 38.0 8 37.386 38.0 38.0 38.0 37.0 38.0 9 37.4215 38.0 38.0 38.0 37.0 38.0 10-14 37.295500000000004 38.0 38.0 38.0 37.0 38.0 15-19 37.24115 38.0 38.0 38.0 37.0 38.0 20-24 37.2285 38.0 38.0 38.0 37.0 38.0 25-29 37.24555 38.0 38.0 38.0 37.0 38.0 30-34 37.2153 38.0 38.0 38.0 37.0 38.0 35-39 36.99585 38.0 38.0 38.0 36.4 38.0 40-44 36.9434 38.0 38.0 38.0 36.6 38.0 45-49 37.103950000000005 38.0 38.0 38.0 36.6 38.0 50-54 37.063050000000004 38.0 38.0 38.0 36.4 38.0 55-59 37.05525000000001 38.0 38.0 38.0 36.2 38.0 60-64 36.9951 38.0 38.0 38.0 36.0 38.0 65-69 36.9872 38.0 38.0 38.0 36.0 38.0 70-74 36.817899999999995 38.0 38.0 38.0 36.0 38.0 75-79 36.8331 38.0 38.0 38.0 35.4 38.0 80-84 36.7867 38.0 38.0 38.0 35.6 38.0 85-89 36.701 38.0 38.0 38.0 35.0 38.0 90-94 36.61095 38.0 38.0 38.0 34.8 38.0 95-99 36.48795 38.0 38.0 38.0 34.4 38.0 100-104 36.3108 38.0 38.0 38.0 33.8 38.0 105-109 36.166900000000005 38.0 37.8 38.0 34.0 38.0 110-114 36.0734 38.0 37.4 38.0 33.6 38.0 115-119 35.8891 38.0 37.0 38.0 33.0 38.0 120-124 35.792100000000005 38.0 37.0 38.0 31.8 38.0 125-129 35.516450000000006 38.0 36.2 38.0 31.0 38.0 130-134 35.23254999999999 38.0 36.0 38.0 30.0 38.0 135-139 34.9689 38.0 35.8 38.0 28.2 38.0 140-144 34.63585 38.0 35.0 38.0 27.6 38.0 145-149 34.089800000000004 38.0 34.6 38.0 25.2 38.0 150-151 30.574625 36.5 29.0 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 3.0 4 1.0 5 0.0 6 2.0 7 1.0 8 2.0 9 3.0 10 0.0 11 1.0 12 1.0 13 2.0 14 0.0 15 2.0 16 1.0 17 1.0 18 7.0 19 5.0 20 5.0 21 4.0 22 5.0 23 5.0 24 10.0 25 14.0 26 12.0 27 20.0 28 20.0 29 26.0 30 32.0 31 46.0 32 62.0 33 109.0 34 134.0 35 253.0 36 640.0 37 2566.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.075 15.925 16.375 30.625000000000004 2 24.125 24.675 34.275 16.925 3 21.65 27.224999999999998 29.925 21.2 4 23.974999999999998 35.199999999999996 21.525 19.3 5 23.724999999999998 37.125 21.45 17.7 6 19.25 37.075 24.275 19.400000000000002 7 18.875 17.675 41.8 21.65 8 21.425 21.825 27.650000000000002 29.099999999999998 9 21.224999999999998 25.575 28.625 24.575 10-14 23.05 29.049999999999997 26.08 21.82 15-19 22.845 28.365000000000002 27.965 20.825 20-24 22.74 28.634999999999998 27.405 21.22 25-29 23.23 28.810000000000002 26.939999999999998 21.02 30-34 23.204364582811955 27.814204915160918 27.79418389308774 21.187246608939386 35-39 23.312606559021162 28.136596128773444 27.369371176411594 21.181426135793803 40-44 22.958312405826216 28.41788046207936 27.7850326469111 20.838774485183325 45-49 22.575 28.065 27.865000000000002 21.495 50-54 22.62 28.215 28.139999999999997 21.025 55-59 23.405 27.575 28.03 20.990000000000002 60-64 23.015 28.305000000000003 27.49 21.19 65-69 23.62 27.834999999999997 27.76 20.785 70-74 23.294999999999998 28.395 27.525 20.785 75-79 23.44 27.785 27.384999999999998 21.39 80-84 23.49 28.425 27.24 20.845 85-89 23.86 28.549999999999997 27.275 20.315 90-94 23.674999999999997 28.410000000000004 27.034999999999997 20.880000000000003 95-99 23.325000000000003 28.335 27.505000000000003 20.835 100-104 24.240000000000002 28.165000000000003 26.865 20.73 105-109 23.544999999999998 28.09 27.26 21.105 110-114 23.68 28.395 27.35 20.575 115-119 23.674999999999997 27.750000000000004 27.805000000000003 20.77 120-124 23.71 27.295 27.905 21.09 125-129 23.68 28.42 27.52 20.380000000000003 130-134 24.055 28.305000000000003 26.85 20.79 135-139 24.165 28.02 27.255000000000003 20.560000000000002 140-144 23.974999999999998 28.625 27.215 20.185 145-149 24.57 27.92 27.589999999999996 19.919999999999998 150-151 24.25 28.487499999999997 27.0625 20.200000000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.0 24 0.0 25 0.5 26 0.5 27 1.0 28 1.0 29 5.5 30 12.5 31 15.0 32 18.0 33 25.0 34 39.5 35 60.0 36 74.0 37 90.5 38 134.5 39 173.0 40 202.0 41 240.5 42 250.5 43 260.0 44 288.0 45 312.5 46 305.0 47 268.0 48 238.0 49 205.5 50 168.0 51 142.0 52 120.5 53 91.5 54 71.5 55 57.0 56 39.0 57 29.5 58 22.0 59 12.0 60 9.0 61 5.0 62 1.5 63 1.5 64 0.5 65 0.5 66 1.0 67 1.5 68 1.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.105 35-39 0.29 40-44 0.44999999999999996 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67361285463218 99.25 2 0.2761737383881496 0.5499999999999999 3 0.0 0.0 4 0.05021340697966357 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0625 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.1375 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.2125 0.0 0.0 0.0 0.0 108-109 0.32499999999999996 0.0 0.0 0.0 0.0 110-111 0.4 0.0 0.0 0.0 0.0 112-113 0.475 0.0 0.0 0.0 0.0 114-115 0.6000000000000001 0.0 0.0 0.0 0.0 116-117 0.7124999999999999 0.0 0.0 0.0 0.0 118-119 0.825 0.0 0.0 0.0 0.0 120-121 0.9874999999999999 0.0 0.0 0.0 0.0 122-123 1.2000000000000002 0.0 0.0 0.0 0.0 124-125 1.3250000000000002 0.0 0.0 0.0 0.0 126-127 1.4875 0.0 0.0 0.0 0.0 128-129 1.6749999999999998 0.0 0.0 0.0 0.0 130-131 1.8375 0.0 0.0 0.0 0.0 132-133 1.9749999999999999 0.0 0.0 0.0 0.0 134-135 2.1875 0.0 0.0 0.0 0.0 136-137 2.3625 0.0 0.0 0.0 0.0 138-139 2.7125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 714656 spots for SRR7171904.sra Written 714656 spots for SRR7171904.sra Read 714656 spots for SRR7171904.sra Written 714656 spots for SRR7171904.sra Read 714656 spots for SRR7171904.sra Written 714656 spots for SRR7171904.sra Read 714656 spots for SRR7171904.sra Written 714656 spots for SRR7171904.sra Read 714656 spots for SRR7171904.sra Written 714656 spots for SRR7171904.sra Read 714656 spots for SRR7171904.sra Written 714656 spots for SRR7171904.sra Read 714656 spots for SRR7171904.sra Written 714656 spots for SRR7171904.sra Read 714656 spots for SRR7171904.sra Written 714656 spots for SRR7171904.sra Read 714656 spots for SRR7171904.sra Written 714656 spots for SRR7171904.sra Read 714656 spots for SRR7171904.sra Written 714656 spots for SRR7171904.sra Read 714656 spots for SRR7171904.sra Written 714656 spots for SRR7171904.sra Read 714656 spots for SRR7171904.sra Written 714656 spots for SRR7171904.sra Read 714656 spots for SRR7171904.sra Written 714656 spots for SRR7171904.sra Read 714656 spots for SRR7171904.sra Written 714656 spots for SRR7171904.sra Read 714657 spots for SRR7171904.sra Written 714657 spots for SRR7171904.sra Read 714656 spots for SRR7171904.sra Written 714656 spots for SRR7171904.sra Read 714656 spots for SRR7171904.sra Written 714656 spots for SRR7171904.sra Read 714656 spots for SRR7171904.sra Written 714656 spots for SRR7171904.sra Read 714656 spots for SRR7171904.sra Written 714656 spots for SRR7171904.sra Read 714656 spots for SRR7171904.sra Written 714656 spots for SRR7171904.sra SRR ids: ['SRR7171904.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8b4u5c_3 SRR7171904.sra spots: 14293121 blocks: [[1, 714656], [714657, 1429312], [1429313, 2143968], [2143969, 2858624], [2858625, 3573280], [3573281, 4287936], [4287937, 5002592], [5002593, 5717248], [5717249, 6431904], [6431905, 7146560], [7146561, 7861216], [7861217, 8575872], [8575873, 9290528], [9290529, 10005184], [10005185, 10719840], [10719841, 11434496], [11434497, 12149152], [12149153, 12863808], [12863809, 13578464], [13578465, 14293121]] SRR7171904 file size 4821769 SRR7171904 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171904 SRR7171904_1.fastq SRR7171904_2.fastq Input file: SRR7171904_1.fastq Paired file: SRR7171904_2.fastq trimmed: SRR7171904-trimmed-pair1.fastq, SRR7171904-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Apr 10 15:58:52 2025 >> started Thu Apr 10 15:59:09 2025 >> done (16.619s) 14293121 read pairs processed; of these: 13002 ( 0.09%) short read pairs filtered out after trimming by size control 12097 ( 0.08%) empty read pairs filtered out after trimming by size control 14268022 (99.82%) read pairs available; of these: 5918187 (41.48%) trimmed read pairs available after processing 8349835 (58.52%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 0 0.00% 20 2 0.00% 21 7 0.00% 22 4 0.00% 23 1 0.00% 24 3 0.00% 25 1 0.00% 26 1 0.00% 27 0 0.00% 28 4 0.00% 29 1 0.00% 30 2 0.00% 31 2 0.00% 32 2 0.00% 33 4 0.00% 34 1 0.00% 35 1 0.00% 36 1 0.00% 37 5 0.00% 38 4 0.00% 39 6 0.00% 40 5 0.00% 41 3 0.00% 42 3 0.00% 43 9 0.00% 44 5 0.00% 45 11 0.00% 46 13 0.00% 47 10 0.00% 48 12 0.00% 49 12 0.00% 50 15 0.00% 51 10 0.00% 52 12 0.00% 53 22 0.00% 54 16 0.00% 55 20 0.00% 56 30 0.00% 57 31 0.00% 58 37 0.00% 59 28 0.00% 60 48 0.00% 61 58 0.00% 62 55 0.00% 63 57 0.00% 64 76 0.00% 65 87 0.00% 66 103 0.00% 67 102 0.00% 68 104 0.00% 69 125 0.00% 70 129 0.00% 71 177 0.00% 72 182 0.00% 73 224 0.00% 74 235 0.00% 75 313 0.00% 76 374 0.00% 77 379 0.00% 78 364 0.00% 79 427 0.00% 80 485 0.00% 81 562 0.00% 82 700 0.00% 83 730 0.01% 84 1363 0.01% 85 1800 0.01% 86 1946 0.01% 87 2076 0.01% 88 2199 0.02% 89 2230 0.02% 90 2333 0.02% 91 2507 0.02% 92 2689 0.02% 93 2994 0.02% 94 3136 0.02% 95 3333 0.02% 96 3480 0.02% 97 3756 0.03% 98 3854 0.03% 99 4230 0.03% 100 4615 0.03% 101 4878 0.03% 102 5195 0.04% 103 5571 0.04% 104 6109 0.04% 105 6543 0.05% 106 6993 0.05% 107 7357 0.05% 108 7788 0.05% 109 8305 0.06% 110 8682 0.06% 111 9324 0.07% 112 9829 0.07% 113 10327 0.07% 114 11078 0.08% 115 12010 0.08% 116 12084 0.08% 117 13101 0.09% 118 13614 0.10% 119 14210 0.10% 120 14608 0.10% 121 15637 0.11% 122 16480 0.12% 123 17643 0.12% 124 18229 0.13% 125 19528 0.14% 126 20547 0.14% 127 21762 0.15% 128 22998 0.16% 129 23977 0.17% 130 25575 0.18% 131 27281 0.19% 132 28791 0.20% 133 31213 0.22% 134 33230 0.23% 135 35865 0.25% 136 38067 0.27% 137 40841 0.29% 138 44081 0.31% 139 48250 0.34% 140 52802 0.37% 141 58760 0.41% 142 66384 0.47% 143 75933 0.53% 144 89579 0.63% 145 109518 0.77% 146 142065 1.00% 147 198411 1.39% 148 318220 2.23% 149 671168 4.70% 150 3362750 23.57% 151 8349835 58.52% 14268022 reads passed initial QC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=2.74 fanout-score-rank=23 prefix-density=0.39 prefix-fanout=1.9 sequence=CACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=61.66 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=5.0 sequence=AACATTCTCACACACTTCTTATAGCAATATTACATGATATCATAATGACTGAAAAACATCTTACATTGCTTAATCAAACACACGCTAGCTCGCTTATAAGCGCCCCTAGTTAAGGGAAACCTTTATTTAATAAAGTCACAAACAAAAGCGGGCTTAGCTAAAATCAATTCTGCTCCATCGTAATTAAGAGACCATGAGCACATCAACAAGCAACTTTGTCTCGCTAATTAGTAGTTATAATTAGCAGTAGTACTTGGCCTTGGTTCAAAATCATCCGAAGACGATTTTTTTCCTTTAAGCCCGACACCATCATCATAAACTGATATGTTAGGTCCTGGTTCGAAGTCCTCCTGAAAAGATTTTTCTCCTTTAAGAGTAGCGTCGTCGTGGTAAACGGACACATTAGGCCTCGGCTCAACATCTTCAGCGAAGGATCTCTCTCCTTTAACGTCACCATCATTGTAAAGGAACAACTGAGAGTTTGGGTGGAAATGTTTCGAAAAGGACTTAT criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=2.62 fanout-score-rank=27 prefix-density=0.41 prefix-fanout=2.5 sequence=ATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=386.97 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=14.7 sequence=TTTCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCCTTCGATGATGAGAACAAGATCATAACTCTTAATGGTTTGGAAGGAGATGTCATGAAAATTTACAAGGTCTATAGGCCCGTCTGGCAGCTTACACCAAAAGGCTCGGGCTGCTTGGCAAAACTGACCATTGAATACGAAAAACTCCATCCTGAAGTCCCGGTTCCAGAGATTTATGTTGATCTTATGGTT SRR7171904 testing PE reads STAR mapping to Ensembl genome Started job on | Apr 10 15:59:52 Started mapping on | Apr 10 15:59:53 Finished on | Apr 10 16:01:20 Mapping speed, Million of reads per hour | 590.40 Number of input reads | 14268022 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 13531335 Uniquely mapped reads % | 94.84% Average mapped length | 297.05 Number of splices: Total | 13643330 Number of splices: Annotated (sjdb) | 13395119 Number of splices: GT/AG | 13431988 Number of splices: GC/AG | 169552 Number of splices: AT/AC | 10183 Number of splices: Non-canonical | 31607 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.56 Insertion rate per base | 0.02% Insertion average length | 2.65 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 372438 % of reads mapped to multiple loci | 2.61% Number of reads mapped to too many loci | 50618 % of reads mapped to too many loci | 0.35% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.11% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 376489 376489 376489 N_multimapping 372438 372438 372438 N_noFeature 266944 13419239 317111 N_ambiguous 132905 1044 70218 UnstrandedReadsAssigned:13131486 PositiveStrandReadsAssigned:111052 NegativeStrandReadsAssigned:13144006 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7171904 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171904-trimmed-pair1.fastq SRR7171904-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,268,022 reads, 13,012,976 reads pseudoaligned [quant] estimated average fragment length: 260.126 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,051 rounds 52401 SRR7171904.ke.tsv 34699 SRR7171904.se.tsv 87100 total ==> SRR7171904.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1758.87 995 41.7197 Potri.005G024800.1.v4.1 1035 775.874 365 34.694 Potri.004G059700.1.v4.1 961 701.887 23 2.41665 Potri.007G009000.2.v4.1 1416 1156.87 0 0 Potri.003G141000.2.v4.1 2943 2683.87 586 16.1023 Potri.016G087400.1.v4.1 270 67.3612 858 939.355 Potri.015G069301.1.v4.1 564 308.788 0 0 Potri.010G195200.1.v4.1 1773 1513.87 245 11.9352 Potri.012G127500.1.v4.1 977 717.881 3768 387.089 ==> SRR7171904.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 89 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 226 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 185 SRR7171904 completed mapping pipeline successfully