Starting /dee2/code/volunteer_pipeline.sh SRR7171905 current disk space = 3089177169920 free memory = 1433809340 SRR7171905 SRAfilesize 36c95fc8199dba7b95fe953a6f72c338 SRR7171905.sra SRR7171905.sra file validated SRR7171905 is paired end SRR7171905 is conventional basespace SRR7171905 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171905_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.85475 32.0 18.0 32.0 18.0 33.0 2 23.05725 18.0 18.0 28.0 18.0 32.0 3 27.69025 29.0 27.0 31.0 18.0 31.0 4 27.02075 29.0 25.0 31.0 15.0 33.0 5 31.40175 32.0 32.0 33.0 28.0 33.0 6 36.19625 37.0 36.0 38.0 33.0 38.0 7 36.95375 38.0 37.0 38.0 35.0 38.0 8 37.482 38.0 38.0 38.0 37.0 38.0 9 37.56175 38.0 38.0 38.0 37.0 38.0 10-14 37.63584999999999 38.0 38.0 38.0 38.0 38.0 15-19 37.6225 38.0 38.0 38.0 38.0 38.0 20-24 37.602850000000004 38.0 38.0 38.0 38.0 38.0 25-29 37.5778 38.0 38.0 38.0 38.0 38.0 30-34 37.545449999999995 38.0 38.0 38.0 38.0 38.0 35-39 37.51115 38.0 38.0 38.0 38.0 38.0 40-44 37.5287 38.0 38.0 38.0 37.8 38.0 45-49 37.45955 38.0 38.0 38.0 37.2 38.0 50-54 37.43 38.0 38.0 38.0 37.0 38.0 55-59 37.322199999999995 38.0 38.0 38.0 37.0 38.0 60-64 37.32165 38.0 38.0 38.0 37.0 38.0 65-69 37.241350000000004 38.0 38.0 38.0 36.4 38.0 70-74 37.2671 38.0 38.0 38.0 36.8 38.0 75-79 37.19035 38.0 38.0 38.0 36.2 38.0 80-84 37.10680000000001 38.0 38.0 38.0 36.0 38.0 85-89 37.06385 38.0 38.0 38.0 35.8 38.0 90-94 37.0394 38.0 38.0 38.0 36.0 38.0 95-99 36.93465 38.0 38.0 38.0 35.6 38.0 100-104 36.809450000000005 38.0 38.0 38.0 35.0 38.0 105-109 36.624649999999995 38.0 38.0 38.0 34.2 38.0 110-114 36.50135 38.0 38.0 38.0 34.0 38.0 115-119 36.30625 38.0 37.2 38.0 34.0 38.0 120-124 36.2413 38.0 37.0 38.0 34.0 38.0 125-129 36.15285000000001 38.0 37.0 38.0 33.4 38.0 130-134 35.8386 38.0 36.2 38.0 31.8 38.0 135-139 35.642 38.0 36.0 38.0 31.8 38.0 140-144 35.228449999999995 38.0 35.8 38.0 30.2 38.0 145-149 34.87215 38.0 35.4 38.0 29.2 38.0 150-151 31.79575 36.5 31.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 2.0 7 1.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 1.0 17 1.0 18 0.0 19 2.0 20 3.0 21 4.0 22 3.0 23 4.0 24 6.0 25 6.0 26 7.0 27 15.0 28 12.0 29 20.0 30 22.0 31 36.0 32 57.0 33 70.0 34 125.0 35 300.0 36 897.0 37 2403.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.25 12.025 10.5 32.225 2 24.0180135101326 19.16437327995997 33.90042531898924 22.91718789091819 3 20.775 25.874999999999996 27.275 26.075 4 22.975 32.625 23.425 20.974999999999998 5 22.275 34.8 24.349999999999998 18.575 6 16.7 37.45 26.424999999999997 19.425 7 14.899999999999999 21.375 43.7 20.025000000000002 8 19.25 22.925 29.725 28.1 9 17.95 22.575 32.425 27.05 10-14 20.044999999999998 29.849999999999998 26.384999999999998 23.72 15-19 20.445 28.405 28.095 23.055 20-24 20.810000000000002 28.22 27.57 23.400000000000002 25-29 19.955000000000002 29.125 27.834999999999997 23.085 30-34 20.095 28.535 27.655 23.715 35-39 20.16 28.4 28.194999999999997 23.244999999999997 40-44 19.96 27.93 28.17 23.94 45-49 20.674999999999997 27.66 28.060000000000002 23.605 50-54 20.46 28.24 27.54 23.76 55-59 19.99 28.744999999999997 27.675 23.59 60-64 20.349999999999998 28.015 27.639999999999997 23.995 65-69 20.13 28.33 27.615000000000002 23.925 70-74 20.46 28.050000000000004 27.900000000000002 23.59 75-79 21.255 27.92 28.125 22.7 80-84 20.580000000000002 27.675 27.785 23.96 85-89 20.849999999999998 27.91 27.985 23.255 90-94 20.79 27.605 27.845 23.76 95-99 21.135 27.97 27.99 22.905 100-104 20.7 27.88 27.544999999999998 23.875 105-109 20.424999999999997 27.76 28.144999999999996 23.669999999999998 110-114 21.035 28.13 27.735 23.1 115-119 21.125 27.495000000000005 28.189999999999998 23.189999999999998 120-124 20.73 27.675 27.985 23.61 125-129 21.195 27.474999999999998 27.625 23.705000000000002 130-134 21.08 27.650000000000002 27.994999999999997 23.275000000000002 135-139 21.115000000000002 28.050000000000004 27.534999999999997 23.3 140-144 21.26 27.750000000000004 27.38 23.61 145-149 20.635 27.889999999999997 27.310000000000002 24.165 150-151 21.975 27.8625 27.450000000000003 22.7125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.5 9 0.5 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 2.0 25 3.0 26 4.0 27 7.5 28 7.5 29 10.5 30 16.0 31 19.0 32 30.5 33 35.5 34 45.0 35 63.0 36 80.0 37 104.0 38 132.0 39 156.0 40 187.5 41 219.5 42 244.5 43 266.5 44 282.5 45 283.5 46 265.5 47 253.0 48 232.0 49 206.5 50 189.5 51 159.0 52 128.5 53 103.5 54 71.5 55 54.0 56 40.5 57 21.5 58 15.0 59 13.5 60 9.5 61 6.0 62 5.5 63 5.0 64 4.0 65 4.0 66 2.5 67 1.5 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62349397590361 99.225 2 0.3514056224899598 0.7000000000000001 3 0.0251004016064257 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.0875 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.275 0.0 0.0 0.0 0.0 106-107 0.3375 0.0 0.0 0.0 0.0 108-109 0.425 0.0 0.0 0.0 0.0 110-111 0.48750000000000004 0.0 0.0 0.0 0.0 112-113 0.5625 0.0 0.0 0.0 0.0 114-115 0.7 0.0 0.0 0.0 0.0 116-117 0.75 0.0 0.0 0.0 0.0 118-119 0.875 0.0 0.0 0.0 0.0 120-121 0.975 0.0 0.0 0.0 0.0 122-123 1.1625 0.0 0.0 0.0 0.0 124-125 1.275 0.0 0.0 0.0 0.0 126-127 1.5625 0.0 0.0 0.0 0.0 128-129 1.7625000000000002 0.0 0.0 0.0 0.0 130-131 2.0 0.0 0.0 0.0 0.0 132-133 2.25 0.0 0.0 0.0 0.0 134-135 2.5625 0.0 0.0 0.0 0.0 136-137 2.7875 0.0 0.0 0.0 0.0 138-139 3.0875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGGAATA 10 0.006830828 145.0 2 CTTGGGG 10 0.006830828 145.0 1 >>END_MODULE SRR7171905 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171905_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0965 33.0 33.0 34.0 32.0 34.0 2 33.14825 34.0 33.0 34.0 33.0 34.0 3 33.16825 34.0 33.0 34.0 33.0 34.0 4 33.1815 34.0 33.0 34.0 33.0 34.0 5 33.24675 34.0 33.0 34.0 33.0 34.0 6 37.384 38.0 38.0 38.0 37.0 38.0 7 37.359 38.0 38.0 38.0 37.0 38.0 8 37.42875 38.0 38.0 38.0 37.0 38.0 9 37.332 38.0 38.0 38.0 37.0 38.0 10-14 37.405950000000004 38.0 38.0 38.0 37.2 38.0 15-19 37.37134999999999 38.0 38.0 38.0 37.4 38.0 20-24 37.373949999999994 38.0 38.0 38.0 37.6 38.0 25-29 37.361000000000004 38.0 38.0 38.0 37.2 38.0 30-34 37.305150000000005 38.0 38.0 38.0 37.0 38.0 35-39 37.2428 38.0 38.0 38.0 37.0 38.0 40-44 37.085899999999995 38.0 38.0 38.0 36.8 38.0 45-49 37.23745 38.0 38.0 38.0 37.0 38.0 50-54 37.2294 38.0 38.0 38.0 37.0 38.0 55-59 37.17315 38.0 38.0 38.0 37.0 38.0 60-64 37.118100000000005 38.0 38.0 38.0 36.6 38.0 65-69 37.04445 38.0 38.0 38.0 36.0 38.0 70-74 37.01655 38.0 38.0 38.0 36.0 38.0 75-79 36.91055 38.0 38.0 38.0 36.0 38.0 80-84 36.891799999999996 38.0 38.0 38.0 36.0 38.0 85-89 36.802499999999995 38.0 38.0 38.0 35.4 38.0 90-94 36.6673 38.0 38.0 38.0 35.0 38.0 95-99 36.55275 38.0 38.0 38.0 34.6 38.0 100-104 36.4159 38.0 38.0 38.0 34.0 38.0 105-109 36.2939 38.0 38.0 38.0 34.0 38.0 110-114 36.21085 38.0 37.6 38.0 33.8 38.0 115-119 36.0367 38.0 37.2 38.0 33.4 38.0 120-124 35.94584999999999 38.0 37.2 38.0 32.8 38.0 125-129 35.66615 38.0 36.8 38.0 31.8 38.0 130-134 35.3183 38.0 36.0 38.0 31.0 38.0 135-139 35.035900000000005 38.0 36.0 38.0 28.8 38.0 140-144 34.73625 38.0 35.0 38.0 28.2 38.0 145-149 34.1316 38.0 35.0 38.0 24.8 38.0 150-151 30.564375000000002 36.5 29.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 2.0 4 3.0 5 2.0 6 0.0 7 0.0 8 0.0 9 2.0 10 0.0 11 0.0 12 3.0 13 3.0 14 3.0 15 2.0 16 2.0 17 1.0 18 4.0 19 5.0 20 6.0 21 1.0 22 3.0 23 5.0 24 12.0 25 11.0 26 13.0 27 13.0 28 15.0 29 20.0 30 31.0 31 45.0 32 49.0 33 78.0 34 141.0 35 259.0 36 688.0 37 2575.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.4 16.6 13.350000000000001 28.65 2 23.549999999999997 25.35 34.25 16.85 3 21.15 28.075 30.099999999999998 20.674999999999997 4 25.224999999999998 34.375 20.275000000000002 20.125 5 23.35 37.7 22.125 16.825000000000003 6 19.0 37.1 24.099999999999998 19.8 7 17.825 18.2 41.4 22.575 8 20.95 22.825 27.075 29.15 9 22.025 25.6 28.549999999999997 23.825 10-14 22.665 29.475 25.900000000000002 21.959999999999997 15-19 22.71 28.335 27.500000000000004 21.455 20-24 22.79 28.345 27.855 21.01 25-29 22.775000000000002 28.62 27.705000000000002 20.9 30-34 23.115 27.68 27.88 21.325 35-39 23.13078269567392 27.976994248562143 27.341835458864715 21.550387596899228 40-44 22.272339998997644 28.27644965669323 27.614895003257654 21.83631534105147 45-49 23.11 27.85 27.49 21.55 50-54 23.06 27.985 27.650000000000002 21.305 55-59 23.105 27.485 28.025 21.385 60-64 23.385 27.105 27.965 21.545 65-69 23.015 28.175 27.48 21.33 70-74 23.13 28.065 27.87 20.935000000000002 75-79 24.18 27.73 27.24 20.849999999999998 80-84 23.82 28.63 26.685 20.865000000000002 85-89 23.805 27.675 27.555000000000003 20.965 90-94 23.919999999999998 27.655 28.050000000000004 20.375 95-99 23.794999999999998 27.700000000000003 28.105000000000004 20.4 100-104 24.055 27.950000000000003 26.965 21.029999999999998 105-109 23.27 27.889999999999997 27.77 21.07 110-114 23.185 27.675 27.93 21.21 115-119 24.13 27.58 27.54 20.75 120-124 23.985 27.689999999999998 27.905 20.419999999999998 125-129 23.65 28.4 27.005000000000003 20.945 130-134 23.945 27.810000000000002 27.595 20.65 135-139 24.21 28.57 26.784999999999997 20.435 140-144 23.335 27.389999999999997 28.075 21.2 145-149 23.925 27.860000000000003 27.66 20.555 150-151 24.587500000000002 27.500000000000004 27.9125 20.0 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.5 24 1.0 25 1.0 26 2.0 27 2.5 28 4.5 29 5.5 30 6.5 31 9.0 32 14.5 33 26.0 34 35.5 35 49.0 36 71.5 37 88.0 38 115.5 39 148.5 40 188.5 41 241.5 42 271.0 43 287.5 44 301.0 45 308.0 46 303.0 47 267.0 48 234.0 49 214.5 50 178.5 51 158.0 52 126.5 53 85.5 54 62.5 55 43.0 56 38.0 57 30.5 58 24.0 59 17.5 60 12.0 61 9.0 62 3.0 63 1.5 64 2.5 65 2.0 66 0.5 67 1.5 68 1.5 69 0.0 70 0.5 71 0.5 72 0.5 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.025 40-44 0.23500000000000001 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52249308871576 99.0 2 0.42724302588590096 0.8500000000000001 3 0.050263885398341285 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.0875 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.3 0.0 0.0 0.0 0.0 106-107 0.36250000000000004 0.0 0.0 0.0 0.0 108-109 0.45 0.0 0.0 0.0 0.0 110-111 0.5125 0.0 0.0 0.0 0.0 112-113 0.5874999999999999 0.0 0.0 0.0 0.0 114-115 0.725 0.0 0.0 0.0 0.0 116-117 0.775 0.0 0.0 0.0 0.0 118-119 0.9 0.0 0.0 0.0 0.0 120-121 0.975 0.0 0.0 0.0 0.0 122-123 1.1625 0.0 0.0 0.0 0.0 124-125 1.275 0.0 0.0 0.0 0.0 126-127 1.5625 0.0 0.0 0.0 0.0 128-129 1.7374999999999998 0.0 0.0 0.0 0.0 130-131 1.975 0.0 0.0 0.0 0.0 132-133 2.225 0.0 0.0 0.0 0.0 134-135 2.5625 0.0 0.0 0.0 0.0 136-137 2.7875 0.0 0.0 0.0 0.0 138-139 3.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 735030 spots for SRR7171905.sra Written 735030 spots for SRR7171905.sra Read 735030 spots for SRR7171905.sra Written 735030 spots for SRR7171905.sra Read 735030 spots for SRR7171905.sra Written 735030 spots for SRR7171905.sra Read 735030 spots for SRR7171905.sra Written 735030 spots for SRR7171905.sra Read 735030 spots for SRR7171905.sra Written 735030 spots for SRR7171905.sra Read 735030 spots for SRR7171905.sra Written 735030 spots for SRR7171905.sra Read 735030 spots for SRR7171905.sra Written 735030 spots for SRR7171905.sra Read 735030 spots for SRR7171905.sra Written 735030 spots for SRR7171905.sra Read 735030 spots for SRR7171905.sra Written 735030 spots for SRR7171905.sra Read 735030 spots for SRR7171905.sra Written 735030 spots for SRR7171905.sra Read 735030 spots for SRR7171905.sra Written 735030 spots for SRR7171905.sra Read 735030 spots for SRR7171905.sra Written 735030 spots for SRR7171905.sra Read 735031 spots for SRR7171905.sra Written 735031 spots for SRR7171905.sra Read 735030 spots for SRR7171905.sra Written 735030 spots for SRR7171905.sra Read 735030 spots for SRR7171905.sra Written 735030 spots for SRR7171905.sra Read 735030 spots for SRR7171905.sra Written 735030 spots for SRR7171905.sra Read 735030 spots for SRR7171905.sra Written 735030 spots for SRR7171905.sra Read 735030 spots for SRR7171905.sra Written 735030 spots for SRR7171905.sra Read 735030 spots for SRR7171905.sra Written 735030 spots for SRR7171905.sra Read 735030 spots for SRR7171905.sra Written 735030 spots for SRR7171905.sra SRR ids: ['SRR7171905.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6fghbqax SRR7171905.sra spots: 14700601 blocks: [[1, 735030], [735031, 1470060], [1470061, 2205090], [2205091, 2940120], [2940121, 3675150], [3675151, 4410180], [4410181, 5145210], [5145211, 5880240], [5880241, 6615270], [6615271, 7350300], [7350301, 8085330], [8085331, 8820360], [8820361, 9555390], [9555391, 10290420], [10290421, 11025450], [11025451, 11760480], [11760481, 12495510], [12495511, 13230540], [13230541, 13965570], [13965571, 14700601]] SRR7171905 file size 4959850 SRR7171905 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171905 SRR7171905_1.fastq SRR7171905_2.fastq Input file: SRR7171905_1.fastq Paired file: SRR7171905_2.fastq trimmed: SRR7171905-trimmed-pair1.fastq, SRR7171905-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 00:07:40 2025 >> started Fri Feb 14 00:07:55 2025 >> done (15.060s) 14700601 read pairs processed; of these: 11113 ( 0.08%) short read pairs filtered out after trimming by size control 8513 ( 0.06%) empty read pairs filtered out after trimming by size control 14680975 (99.87%) read pairs available; of these: 5779389 (39.37%) trimmed read pairs available after processing 8901586 (60.63%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 2 0.00% 21 2 0.00% 22 2 0.00% 23 5 0.00% 24 5 0.00% 25 5 0.00% 26 0 0.00% 27 1 0.00% 28 4 0.00% 29 5 0.00% 30 5 0.00% 31 0 0.00% 32 5 0.00% 33 5 0.00% 34 2 0.00% 35 7 0.00% 36 7 0.00% 37 4 0.00% 38 6 0.00% 39 7 0.00% 40 7 0.00% 41 4 0.00% 42 3 0.00% 43 7 0.00% 44 4 0.00% 45 6 0.00% 46 6 0.00% 47 5 0.00% 48 17 0.00% 49 14 0.00% 50 14 0.00% 51 19 0.00% 52 21 0.00% 53 19 0.00% 54 26 0.00% 55 33 0.00% 56 43 0.00% 57 37 0.00% 58 44 0.00% 59 50 0.00% 60 46 0.00% 61 67 0.00% 62 71 0.00% 63 71 0.00% 64 81 0.00% 65 80 0.00% 66 112 0.00% 67 114 0.00% 68 138 0.00% 69 148 0.00% 70 175 0.00% 71 205 0.00% 72 254 0.00% 73 268 0.00% 74 311 0.00% 75 348 0.00% 76 429 0.00% 77 496 0.00% 78 525 0.00% 79 558 0.00% 80 644 0.00% 81 770 0.01% 82 871 0.01% 83 1089 0.01% 84 1620 0.01% 85 2032 0.01% 86 2187 0.01% 87 2361 0.02% 88 2588 0.02% 89 2761 0.02% 90 2872 0.02% 91 3093 0.02% 92 3329 0.02% 93 3556 0.02% 94 3705 0.03% 95 3971 0.03% 96 4189 0.03% 97 4538 0.03% 98 4811 0.03% 99 5023 0.03% 100 5378 0.04% 101 5868 0.04% 102 6252 0.04% 103 6619 0.05% 104 7203 0.05% 105 7737 0.05% 106 8227 0.06% 107 8442 0.06% 108 9010 0.06% 109 9528 0.06% 110 9982 0.07% 111 10860 0.07% 112 11164 0.08% 113 12105 0.08% 114 12809 0.09% 115 13568 0.09% 116 14314 0.10% 117 14836 0.10% 118 15155 0.10% 119 16175 0.11% 120 17008 0.12% 121 17579 0.12% 122 18690 0.13% 123 19539 0.13% 124 20558 0.14% 125 21632 0.15% 126 22719 0.15% 127 23710 0.16% 128 24896 0.17% 129 26004 0.18% 130 27313 0.19% 131 28547 0.19% 132 30942 0.21% 133 32920 0.22% 134 34770 0.24% 135 36784 0.25% 136 40121 0.27% 137 42351 0.29% 138 45929 0.31% 139 49233 0.34% 140 53476 0.36% 141 59961 0.41% 142 66901 0.46% 143 75594 0.51% 144 87921 0.60% 145 108159 0.74% 146 136864 0.93% 147 190337 1.30% 148 301876 2.06% 149 622873 4.24% 150 3227983 21.99% 151 8901586 60.63% 14680975 reads passed initial QC criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=2.15 fanout-score-rank=32 prefix-density=0.34 prefix-fanout=2.1 sequence=CAGGTGCAGTTTGATCC criterion=fanout-score sequence-density=0.09 sequence-density-rank=25 fanout-score=46.85 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=14.8 sequence=ACCACCACCATG criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=4.65 fanout-score-rank=16 prefix-density=0.62 prefix-fanout=3.4 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=48.83 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=6.1 sequence=GAAGGATCTGTTTAATTTGAGACAGAAAACATGAAATCCTCCTACACTTTCTTCATTCTTTTCTCACTCTTTTCGTTTGCTAACGTGATCGGTGCTAGAAAAGACACTGGAGAGTATTGGAGAGCTGTCATGAAAGATCAGCCCATGCCAGAAGCAATACA SRR7171905 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 00:08:38 Started mapping on | Feb 14 00:08:38 Finished on | Feb 14 00:10:15 Mapping speed, Million of reads per hour | 544.86 Number of input reads | 14680975 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 13708966 Uniquely mapped reads % | 93.38% Average mapped length | 296.82 Number of splices: Total | 14476848 Number of splices: Annotated (sjdb) | 14243377 Number of splices: GT/AG | 14255337 Number of splices: GC/AG | 180838 Number of splices: AT/AC | 10874 Number of splices: Non-canonical | 29799 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.69 Insertion rate per base | 0.02% Insertion average length | 2.56 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 375877 % of reads mapped to multiple loci | 2.56% Number of reads mapped to too many loci | 57417 % of reads mapped to too many loci | 0.39% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.60% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 607462 607462 607462 N_multimapping 375877 375877 375877 N_noFeature 289878 13580124 350381 N_ambiguous 139298 1016 70169 UnstrandedReadsAssigned:13279790 PositiveStrandReadsAssigned:127826 NegativeStrandReadsAssigned:13288416 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7171905 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171905-trimmed-pair1.fastq SRR7171905-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,680,975 reads, 13,171,032 reads pseudoaligned [quant] estimated average fragment length: 257.299 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,106 rounds 52401 SRR7171905.ke.tsv 34699 SRR7171905.se.tsv 87100 total ==> SRR7171905.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1761.7 1023 40.2035 Potri.005G024800.1.v4.1 1035 778.701 221 19.6491 Potri.004G059700.1.v4.1 961 704.711 14 1.37543 Potri.007G009000.2.v4.1 1416 1159.7 0 0 Potri.003G141000.2.v4.1 2943 2686.7 601.188 15.4921 Potri.016G087400.1.v4.1 270 69.5832 1085 1079.56 Potri.015G069301.1.v4.1 564 312.572 0 0 Potri.010G195200.1.v4.1 1773 1516.7 225.853 10.3097 Potri.012G127500.1.v4.1 977 720.711 1898 182.329 ==> SRR7171905.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 36 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 400 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 204 SRR7171905 completed mapping pipeline successfully