Starting /dee2/code/volunteer_pipeline.sh SRR7171906 current disk space = 3089141972992 free memory = 1450002232 SRR7171906 SRAfilesize 13ecff3363dbec3060a034b1e2f796d7 SRR7171906.sra SRR7171906.sra file validated SRR7171906 is paired end SRR7171906 is conventional basespace SRR7171906 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171906_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.526 30.0 18.0 33.0 18.0 33.0 2 31.6855 33.0 31.0 33.0 29.0 34.0 3 31.55875 33.0 31.0 33.0 29.0 33.0 4 32.33675 33.0 32.0 33.0 31.0 33.0 5 32.88025 33.0 33.0 34.0 33.0 34.0 6 36.7835 38.0 37.0 38.0 34.0 38.0 7 37.4825 38.0 38.0 38.0 37.0 38.0 8 37.57325 38.0 38.0 38.0 37.0 38.0 9 37.67775 38.0 38.0 38.0 38.0 38.0 10-14 37.6389 38.0 38.0 38.0 38.0 38.0 15-19 37.645799999999994 38.0 38.0 38.0 38.0 38.0 20-24 37.62355 38.0 38.0 38.0 38.0 38.0 25-29 37.60055 38.0 38.0 38.0 38.0 38.0 30-34 37.54225 38.0 38.0 38.0 37.8 38.0 35-39 37.5259 38.0 38.0 38.0 38.0 38.0 40-44 37.53655 38.0 38.0 38.0 37.4 38.0 45-49 37.453500000000005 38.0 38.0 38.0 37.0 38.0 50-54 37.41495 38.0 38.0 38.0 37.0 38.0 55-59 37.34355 38.0 38.0 38.0 37.0 38.0 60-64 37.27665 38.0 38.0 38.0 36.6 38.0 65-69 37.26035 38.0 38.0 38.0 36.2 38.0 70-74 37.20975 38.0 38.0 38.0 36.0 38.0 75-79 37.1183 38.0 38.0 38.0 36.0 38.0 80-84 37.1134 38.0 38.0 38.0 36.0 38.0 85-89 36.987 38.0 38.0 38.0 36.0 38.0 90-94 36.87885 38.0 38.0 38.0 35.0 38.0 95-99 36.79515 38.0 38.0 38.0 35.0 38.0 100-104 36.6631 38.0 38.0 38.0 34.8 38.0 105-109 36.479150000000004 38.0 38.0 38.0 34.0 38.0 110-114 36.3315 38.0 37.6 38.0 34.0 38.0 115-119 36.3483 38.0 37.4 38.0 34.0 38.0 120-124 36.098349999999996 38.0 37.0 38.0 33.2 38.0 125-129 35.78495 38.0 36.4 38.0 31.8 38.0 130-134 35.63955 38.0 36.0 38.0 31.0 38.0 135-139 35.2281 38.0 35.8 38.0 29.6 38.0 140-144 34.90325 38.0 35.0 38.0 28.0 38.0 145-149 34.411649999999995 38.0 35.0 38.0 26.8 38.0 150-151 31.176625 36.5 31.5 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 2.0 15 0.0 16 2.0 17 0.0 18 3.0 19 1.0 20 3.0 21 3.0 22 2.0 23 5.0 24 2.0 25 7.0 26 12.0 27 12.0 28 11.0 29 23.0 30 34.0 31 47.0 32 51.0 33 80.0 34 151.0 35 285.0 36 775.0 37 2487.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.75 14.05 12.075 37.125 2 20.280070017504375 19.079769942485623 38.159539884971245 22.48062015503876 3 20.125 25.025 26.700000000000003 28.15 4 24.224999999999998 31.2 22.575 22.0 5 19.6 37.225 24.075 19.1 6 18.224999999999998 36.175000000000004 26.125 19.475 7 13.975000000000001 21.925 44.324999999999996 19.775000000000002 8 16.925 22.775000000000002 30.375000000000004 29.925 9 16.325 23.125 32.6 27.950000000000003 10-14 19.84 28.804999999999996 26.995 24.36 15-19 20.47 27.189999999999998 27.985 24.355 20-24 19.74 27.91 28.470000000000002 23.880000000000003 25-29 19.98 28.525 27.474999999999998 24.02 30-34 19.925 28.084999999999997 28.02 23.97 35-39 19.655 28.4 28.035 23.91 40-44 20.175 28.055000000000003 28.335 23.435 45-49 19.97 27.97 27.62 24.44 50-54 20.075000000000003 28.115000000000002 28.53 23.28 55-59 19.785 28.23 28.175 23.810000000000002 60-64 20.395 27.665 27.855 24.085 65-69 19.875 28.335 27.27 24.52 70-74 20.095 28.28 27.76 23.865 75-79 20.465 27.884999999999998 27.650000000000002 24.0 80-84 19.88 27.785 28.310000000000002 24.025 85-89 20.455000000000002 27.665 27.839999999999996 24.04 90-94 20.080000000000002 27.884999999999998 27.905 24.13 95-99 20.3 27.560000000000002 28.035 24.104999999999997 100-104 20.294999999999998 28.035 27.965 23.705000000000002 105-109 20.195 27.21 28.215 24.38 110-114 19.85 27.68 28.215 24.255 115-119 20.4 27.215 27.894999999999996 24.490000000000002 120-124 20.24 27.865000000000002 27.96 23.935000000000002 125-129 20.200000000000003 27.834999999999997 28.155 23.810000000000002 130-134 20.244999999999997 28.194999999999997 27.715 23.845 135-139 20.845 27.735 27.810000000000002 23.61 140-144 20.365 28.515 27.38 23.74 145-149 20.47 27.63 28.02 23.880000000000003 150-151 20.599999999999998 27.500000000000004 27.500000000000004 24.4 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 1.5 24 2.0 25 3.0 26 3.5 27 4.0 28 5.5 29 10.0 30 14.5 31 18.0 32 27.0 33 33.0 34 39.0 35 57.5 36 76.0 37 105.0 38 136.0 39 162.0 40 195.5 41 229.0 42 252.5 43 271.0 44 282.5 45 279.5 46 284.5 47 270.0 48 244.5 49 207.0 50 169.5 51 146.0 52 122.0 53 92.0 54 65.0 55 52.0 56 32.0 57 23.0 58 21.0 59 15.5 60 12.5 61 11.5 62 6.0 63 4.0 64 3.0 65 1.5 66 3.0 67 1.5 68 1.0 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.16249999999999998 0.0 0.0 0.0 0.0 104-105 0.21250000000000002 0.0 0.0 0.0 0.0 106-107 0.225 0.0 0.0 0.0 0.0 108-109 0.225 0.0 0.0 0.0 0.0 110-111 0.2375 0.0 0.0 0.0 0.0 112-113 0.3125 0.0 0.0 0.0 0.0 114-115 0.3875 0.0 0.0 0.0 0.0 116-117 0.4625 0.0 0.0 0.0 0.0 118-119 0.6 0.0 0.0 0.0 0.0 120-121 0.7124999999999999 0.0 0.0 0.0 0.0 122-123 0.8375 0.0 0.0 0.0 0.0 124-125 0.9875 0.0 0.0 0.0 0.0 126-127 1.1 0.0 0.0 0.0 0.0 128-129 1.2 0.0 0.0 0.0 0.0 130-131 1.3375 0.0 0.0 0.0 0.0 132-133 1.475 0.0 0.0 0.0 0.0 134-135 1.7 0.0 0.0 0.0 0.0 136-137 1.9 0.0 0.0 0.0 0.0 138-139 2.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATTCCA 10 0.006830828 145.0 6 >>END_MODULE SRR7171906 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171906_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.1535 33.0 33.0 34.0 33.0 34.0 2 33.2815 34.0 33.0 34.0 33.0 34.0 3 33.26325 34.0 33.0 34.0 33.0 34.0 4 33.287 34.0 33.0 34.0 33.0 34.0 5 33.337 34.0 33.0 34.0 33.0 34.0 6 37.5625 38.0 38.0 38.0 38.0 38.0 7 37.587 38.0 38.0 38.0 38.0 38.0 8 37.579 38.0 38.0 38.0 38.0 38.0 9 37.5825 38.0 38.0 38.0 38.0 38.0 10-14 37.500099999999996 38.0 38.0 38.0 38.0 38.0 15-19 37.44175 38.0 38.0 38.0 38.0 38.0 20-24 37.45885 38.0 38.0 38.0 38.0 38.0 25-29 37.43245 38.0 38.0 38.0 38.0 38.0 30-34 37.372400000000006 38.0 38.0 38.0 37.4 38.0 35-39 37.184799999999996 38.0 38.0 38.0 37.2 38.0 40-44 36.9168 38.0 38.0 38.0 37.0 38.0 45-49 37.30025 38.0 38.0 38.0 37.0 38.0 50-54 37.3114 38.0 38.0 38.0 37.0 38.0 55-59 37.272149999999996 38.0 38.0 38.0 37.0 38.0 60-64 37.253499999999995 38.0 38.0 38.0 37.0 38.0 65-69 37.1733 38.0 38.0 38.0 36.8 38.0 70-74 37.10675 38.0 38.0 38.0 36.4 38.0 75-79 37.07425 38.0 38.0 38.0 36.2 38.0 80-84 37.041399999999996 38.0 38.0 38.0 36.0 38.0 85-89 36.9298 38.0 38.0 38.0 36.0 38.0 90-94 36.84685 38.0 38.0 38.0 35.8 38.0 95-99 36.742200000000004 38.0 38.0 38.0 35.4 38.0 100-104 36.64665 38.0 38.0 38.0 35.0 38.0 105-109 36.45185 38.0 38.0 38.0 34.0 38.0 110-114 36.38895 38.0 38.0 38.0 34.0 38.0 115-119 36.356550000000006 38.0 38.0 38.0 34.0 38.0 120-124 36.250800000000005 38.0 38.0 38.0 34.0 38.0 125-129 35.977 38.0 37.6 38.0 33.0 38.0 130-134 35.67995 38.0 36.6 38.0 32.4 38.0 135-139 35.506299999999996 38.0 36.2 38.0 31.8 38.0 140-144 35.121449999999996 38.0 36.0 38.0 30.6 38.0 145-149 34.78 38.0 35.8 38.0 29.2 38.0 150-151 31.39775 35.5 31.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 4.0 4 0.0 5 0.0 6 2.0 7 0.0 8 0.0 9 1.0 10 2.0 11 2.0 12 1.0 13 0.0 14 2.0 15 1.0 16 2.0 17 2.0 18 3.0 19 1.0 20 5.0 21 3.0 22 5.0 23 5.0 24 11.0 25 8.0 26 20.0 27 4.0 28 13.0 29 18.0 30 31.0 31 31.0 32 59.0 33 62.0 34 115.0 35 228.0 36 539.0 37 2817.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.925 17.724999999999998 16.1 28.249999999999996 2 24.025 24.8 34.5 16.675 3 20.575 28.449999999999996 30.3 20.674999999999997 4 23.5 35.25 22.05 19.2 5 22.875 37.875 22.075 17.175 6 19.05 37.425000000000004 24.975 18.55 7 19.2 17.0 40.625 23.175 8 21.625 24.474999999999998 26.25 27.650000000000002 9 21.075 25.6 28.449999999999996 24.875 10-14 22.98 28.939999999999998 25.965 22.115000000000002 15-19 23.64 27.515 27.389999999999997 21.455 20-24 22.830000000000002 28.810000000000002 27.49 20.87 25-29 23.51 29.01 26.534999999999997 20.945 30-34 23.288150852798477 28.214875206322215 27.674686140149053 20.822287800730255 35-39 23.170425435732582 28.31382791702245 27.35446280576624 21.161283841478728 40-44 23.688201395207763 28.46021635830553 26.94874127995147 20.902840966535233 45-49 23.66 28.465 27.3 20.575 50-54 23.14 28.38 27.534999999999997 20.945 55-59 23.23 27.805000000000003 27.555000000000003 21.41 60-64 23.82 27.284999999999997 28.07 20.825 65-69 23.355 28.13 27.525 20.990000000000002 70-74 23.405 28.194999999999997 27.584999999999997 20.815 75-79 23.61 27.68 27.975 20.735 80-84 23.79 27.99 27.67 20.549999999999997 85-89 24.085 27.975 27.24 20.7 90-94 23.445 28.470000000000002 27.794999999999998 20.29 95-99 23.86 28.505000000000003 27.05 20.585 100-104 23.525 28.634999999999998 27.284999999999997 20.555 105-109 23.075000000000003 27.935 28.050000000000004 20.94 110-114 23.96 27.83 27.834999999999997 20.375 115-119 24.104999999999997 28.075 26.995 20.825 120-124 23.565 28.465 27.544999999999998 20.424999999999997 125-129 23.674999999999997 28.305000000000003 27.529999999999998 20.49 130-134 24.055 28.000000000000004 27.395000000000003 20.549999999999997 135-139 23.935000000000002 27.875 27.63 20.560000000000002 140-144 24.015 28.315 26.57 21.099999999999998 145-149 24.37 28.23 27.165 20.235 150-151 24.4875 28.0875 26.775 20.65 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 2.5 24 2.0 25 1.0 26 5.0 27 6.5 28 4.0 29 7.0 30 13.0 31 17.0 32 20.5 33 26.0 34 38.5 35 54.5 36 70.5 37 98.0 38 112.5 39 149.0 40 203.5 41 220.0 42 256.0 43 302.0 44 295.0 45 278.0 46 281.0 47 268.0 48 238.0 49 213.5 50 187.0 51 155.0 52 124.0 53 85.5 54 67.0 55 56.5 56 34.5 57 25.5 58 19.5 59 13.5 60 10.5 61 6.0 62 7.0 63 6.0 64 4.0 65 5.5 66 4.0 67 2.0 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.034999999999999996 35-39 0.455 40-44 1.09 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.16249999999999998 0.0 0.0 0.0 0.0 104-105 0.21250000000000002 0.0 0.0 0.0 0.0 106-107 0.225 0.0 0.0 0.0 0.0 108-109 0.225 0.0 0.0 0.0 0.0 110-111 0.2375 0.0 0.0 0.0 0.0 112-113 0.30000000000000004 0.0 0.0 0.0 0.0 114-115 0.3625 0.0 0.0 0.0 0.0 116-117 0.45 0.0 0.0 0.0 0.0 118-119 0.6 0.0 0.0 0.0 0.0 120-121 0.7124999999999999 0.0 0.0 0.0 0.0 122-123 0.8375 0.0 0.0 0.0 0.0 124-125 0.9875 0.0 0.0 0.0 0.0 126-127 1.1124999999999998 0.0 0.0 0.0 0.0 128-129 1.225 0.0 0.0 0.0 0.0 130-131 1.3624999999999998 0.0 0.0 0.0 0.0 132-133 1.475 0.0 0.0 0.0 0.0 134-135 1.725 0.0 0.0 0.0 0.0 136-137 1.925 0.0 0.0 0.0 0.0 138-139 2.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCAGAGT 10 0.0068484643 144.875 1 >>END_MODULE Read 732382 spots for SRR7171906.sra Written 732382 spots for SRR7171906.sra Read 732382 spots for SRR7171906.sra Written 732382 spots for SRR7171906.sra Read 732382 spots for SRR7171906.sra Written 732382 spots for SRR7171906.sra Read 732382 spots for SRR7171906.sra Written 732382 spots for SRR7171906.sra Read 732382 spots for SRR7171906.sra Written 732382 spots for SRR7171906.sra Read 732382 spots for SRR7171906.sra Written 732382 spots for SRR7171906.sra Read 732382 spots for SRR7171906.sra Written 732382 spots for SRR7171906.sra Read 732382 spots for SRR7171906.sra Written 732382 spots for SRR7171906.sra Read 732382 spots for SRR7171906.sra Written 732382 spots for SRR7171906.sra Read 732382 spots for SRR7171906.sra Written 732382 spots for SRR7171906.sra Read 732382 spots for SRR7171906.sra Written 732382 spots for SRR7171906.sra Read 732382 spots for SRR7171906.sra Written 732382 spots for SRR7171906.sra Read 732382 spots for SRR7171906.sra Written 732382 spots for SRR7171906.sra Read 732382 spots for SRR7171906.sra Written 732382 spots for SRR7171906.sra Read 732382 spots for SRR7171906.sra Written 732382 spots for SRR7171906.sra Read 732382 spots for SRR7171906.sra Written 732382 spots for SRR7171906.sra Read 732382 spots for SRR7171906.sra Written 732382 spots for SRR7171906.sra Read 732382 spots for SRR7171906.sra Written 732382 spots for SRR7171906.sra Read 732382 spots for SRR7171906.sra Written 732382 spots for SRR7171906.sra Read 732382 spots for SRR7171906.sra Written 732382 spots for SRR7171906.sra SRR ids: ['SRR7171906.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0wdwh5lx SRR7171906.sra spots: 14647640 blocks: [[1, 732382], [732383, 1464764], [1464765, 2197146], [2197147, 2929528], [2929529, 3661910], [3661911, 4394292], [4394293, 5126674], [5126675, 5859056], [5859057, 6591438], [6591439, 7323820], [7323821, 8056202], [8056203, 8788584], [8788585, 9520966], [9520967, 10253348], [10253349, 10985730], [10985731, 11718112], [11718113, 12450494], [12450495, 13182876], [13182877, 13915258], [13915259, 14647640]] SRR7171906 file size 4941904 SRR7171906 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171906 SRR7171906_1.fastq SRR7171906_2.fastq Input file: SRR7171906_1.fastq Paired file: SRR7171906_2.fastq trimmed: SRR7171906-trimmed-pair1.fastq, SRR7171906-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 00:16:17 2025 >> started Fri Feb 14 00:16:40 2025 >> done (23.145s) 14647640 read pairs processed; of these: 7938 ( 0.05%) short read pairs filtered out after trimming by size control 5289 ( 0.04%) empty read pairs filtered out after trimming by size control 14634413 (99.91%) read pairs available; of these: 5943122 (40.61%) trimmed read pairs available after processing 8691291 (59.39%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 4 0.00% 20 3 0.00% 21 3 0.00% 22 3 0.00% 23 3 0.00% 24 4 0.00% 25 9 0.00% 26 4 0.00% 27 6 0.00% 28 8 0.00% 29 5 0.00% 30 5 0.00% 31 10 0.00% 32 4 0.00% 33 4 0.00% 34 6 0.00% 35 8 0.00% 36 3 0.00% 37 6 0.00% 38 4 0.00% 39 11 0.00% 40 3 0.00% 41 9 0.00% 42 7 0.00% 43 9 0.00% 44 8 0.00% 45 6 0.00% 46 6 0.00% 47 7 0.00% 48 13 0.00% 49 14 0.00% 50 21 0.00% 51 19 0.00% 52 17 0.00% 53 19 0.00% 54 19 0.00% 55 19 0.00% 56 26 0.00% 57 34 0.00% 58 47 0.00% 59 34 0.00% 60 48 0.00% 61 51 0.00% 62 61 0.00% 63 53 0.00% 64 64 0.00% 65 58 0.00% 66 69 0.00% 67 86 0.00% 68 100 0.00% 69 115 0.00% 70 119 0.00% 71 157 0.00% 72 176 0.00% 73 192 0.00% 74 228 0.00% 75 255 0.00% 76 353 0.00% 77 343 0.00% 78 340 0.00% 79 413 0.00% 80 460 0.00% 81 530 0.00% 82 583 0.00% 83 732 0.01% 84 1153 0.01% 85 1402 0.01% 86 1545 0.01% 87 1713 0.01% 88 1863 0.01% 89 1959 0.01% 90 2083 0.01% 91 2320 0.02% 92 2322 0.02% 93 2555 0.02% 94 2664 0.02% 95 3048 0.02% 96 3154 0.02% 97 3422 0.02% 98 3503 0.02% 99 3742 0.03% 100 3995 0.03% 101 4354 0.03% 102 4777 0.03% 103 5107 0.03% 104 5301 0.04% 105 5603 0.04% 106 6065 0.04% 107 6203 0.04% 108 6567 0.04% 109 7060 0.05% 110 7392 0.05% 111 7816 0.05% 112 8466 0.06% 113 8961 0.06% 114 9559 0.07% 115 10243 0.07% 116 10690 0.07% 117 11250 0.08% 118 11917 0.08% 119 12121 0.08% 120 12920 0.09% 121 13561 0.09% 122 14233 0.10% 123 14954 0.10% 124 15991 0.11% 125 16871 0.12% 126 17747 0.12% 127 18860 0.13% 128 19756 0.13% 129 20920 0.14% 130 22072 0.15% 131 23320 0.16% 132 25306 0.17% 133 27096 0.19% 134 28887 0.20% 135 31026 0.21% 136 33505 0.23% 137 36243 0.25% 138 39530 0.27% 139 43310 0.30% 140 47499 0.32% 141 53515 0.37% 142 61218 0.42% 143 71214 0.49% 144 86270 0.59% 145 107065 0.73% 146 139649 0.95% 147 197799 1.35% 148 322388 2.20% 149 680118 4.65% 150 3502344 23.93% 151 8691291 59.39% 14634413 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=4.75 fanout-score-rank=16 prefix-density=0.32 prefix-fanout=3.8 sequence=CCACATTTGCAGCCA criterion=fanout-score sequence-density=0.11 sequence-density-rank=16 fanout-score=43.27 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=12.2 sequence=ACACCAGCAATGATTGT criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=2.19 fanout-score-rank=27 prefix-density=0.42 prefix-fanout=2.1 sequence=GGCAGTGGCTGCAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=301.07 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=13.0 sequence=TTTCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGC SRR7171906 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 00:17:27 Started mapping on | Feb 14 00:17:28 Finished on | Feb 14 00:19:18 Mapping speed, Million of reads per hour | 478.94 Number of input reads | 14634413 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 13735654 Uniquely mapped reads % | 93.86% Average mapped length | 297.56 Number of splices: Total | 14521176 Number of splices: Annotated (sjdb) | 14266068 Number of splices: GT/AG | 14290554 Number of splices: GC/AG | 186671 Number of splices: AT/AC | 10462 Number of splices: Non-canonical | 33489 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.61 Insertion rate per base | 0.02% Insertion average length | 2.62 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 339753 % of reads mapped to multiple loci | 2.32% Number of reads mapped to too many loci | 43838 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.45% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 567930 567930 567930 N_multimapping 339753 339753 339753 N_noFeature 304687 13596520 374819 N_ambiguous 143463 933 73874 UnstrandedReadsAssigned:13287504 PositiveStrandReadsAssigned:138201 NegativeStrandReadsAssigned:13286961 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7171906 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171906-trimmed-pair1.fastq SRR7171906-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,634,413 reads, 13,143,612 reads pseudoaligned [quant] estimated average fragment length: 276.342 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,174 rounds 52401 SRR7171906.ke.tsv 34699 SRR7171906.se.tsv 87100 total ==> SRR7171906.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1742.66 807 32.6489 Potri.005G024800.1.v4.1 1035 759.658 188 17.448 Potri.004G059700.1.v4.1 961 685.688 15 1.54231 Potri.007G009000.2.v4.1 1416 1140.66 0 0 Potri.003G141000.2.v4.1 2943 2667.66 419.25 11.0803 Potri.016G087400.1.v4.1 270 63.9551 1046 1153.09 Potri.015G069301.1.v4.1 564 295.904 0 0 Potri.010G195200.1.v4.1 1773 1497.66 173 8.14405 Potri.012G127500.1.v4.1 977 701.664 6081 611.016 ==> SRR7171906.se.tsv <== Potri.001G166300.v4.1 2 Potri.001G448400.v4.1 24 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 350 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 193 SRR7171906 completed mapping pipeline successfully