Starting /dee2/code/volunteer_pipeline.sh SRR7171907 current disk space = 3088922705920 free memory = 1576633552 SRR7171907 SRAfilesize ffe3e1b34963a98c6cb460191f72d151 SRR7171907.sra SRR7171907.sra file validated SRR7171907 is paired end SRR7171907 is conventional basespace SRR7171907 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171907_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.37325 33.0 33.0 33.0 32.0 34.0 2 31.49725 33.0 31.0 33.0 28.0 34.0 3 32.605 33.0 33.0 34.0 31.0 34.0 4 31.001 33.0 31.0 33.0 28.0 34.0 5 31.97975 33.0 33.0 33.0 30.0 34.0 6 35.33825 37.0 35.0 38.0 29.0 38.0 7 36.697 38.0 37.0 38.0 34.0 38.0 8 37.272 38.0 38.0 38.0 36.0 38.0 9 37.41225 38.0 38.0 38.0 37.0 38.0 10-14 37.4118 38.0 38.0 38.0 37.0 38.0 15-19 37.43900000000001 38.0 38.0 38.0 37.0 38.0 20-24 37.456649999999996 38.0 38.0 38.0 37.2 38.0 25-29 37.4664 38.0 38.0 38.0 37.0 38.0 30-34 37.43685 38.0 38.0 38.0 37.0 38.0 35-39 37.375299999999996 38.0 38.0 38.0 37.0 38.0 40-44 37.325300000000006 38.0 38.0 38.0 37.0 38.0 45-49 37.333 38.0 38.0 38.0 37.0 38.0 50-54 37.2515 38.0 38.0 38.0 37.0 38.0 55-59 37.2259 38.0 38.0 38.0 37.0 38.0 60-64 37.1715 38.0 38.0 38.0 36.0 38.0 65-69 37.155150000000006 38.0 38.0 38.0 36.0 38.0 70-74 37.08409999999999 38.0 38.0 38.0 36.0 38.0 75-79 37.025 38.0 38.0 38.0 36.0 38.0 80-84 36.96175 38.0 38.0 38.0 35.8 38.0 85-89 36.90045 38.0 38.0 38.0 35.8 38.0 90-94 36.78385 38.0 38.0 38.0 35.2 38.0 95-99 36.7294 38.0 38.0 38.0 34.8 38.0 100-104 36.5361 38.0 38.0 38.0 34.2 38.0 105-109 36.47795 38.0 38.0 38.0 34.0 38.0 110-114 36.293600000000005 38.0 37.4 38.0 33.8 38.0 115-119 36.17100000000001 38.0 37.2 38.0 33.4 38.0 120-124 36.107350000000004 38.0 37.0 38.0 33.6 38.0 125-129 35.91905 38.0 36.8 38.0 32.6 38.0 130-134 35.661899999999996 38.0 36.0 38.0 31.0 38.0 135-139 35.35195 38.0 36.0 38.0 30.6 38.0 140-144 35.03085 38.0 35.8 38.0 28.8 38.0 145-149 34.6492 38.0 35.0 38.0 27.8 38.0 150-151 31.861375000000002 36.5 33.0 38.0 14.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 1.0 10 0.0 11 0.0 12 0.0 13 1.0 14 0.0 15 1.0 16 0.0 17 4.0 18 2.0 19 3.0 20 0.0 21 4.0 22 6.0 23 7.0 24 10.0 25 14.0 26 12.0 27 15.0 28 23.0 29 23.0 30 31.0 31 42.0 32 65.0 33 73.0 34 158.0 35 255.0 36 656.0 37 2593.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.449999999999996 16.625 10.65 31.275 2 21.2 18.425 36.0 24.375 3 19.6 26.875 25.35 28.175 4 22.8 34.325 21.575 21.3 5 20.075000000000003 36.65 24.15 19.125 6 18.075 36.449999999999996 24.0 21.475 7 14.674999999999999 22.7 43.9 18.725 8 18.25 22.675 29.175 29.9 9 18.224999999999998 21.375 34.375 26.025 10-14 20.14 29.505 26.875 23.48 15-19 20.265 28.73 27.715 23.29 20-24 19.27 28.49 28.09 24.15 25-29 19.93 28.615000000000002 27.875 23.580000000000002 30-34 19.78 29.435 27.87 22.915 35-39 20.095 28.435 28.044999999999998 23.425 40-44 20.215 28.7 27.29 23.794999999999998 45-49 19.439999999999998 29.125 27.875 23.56 50-54 20.29 28.610000000000003 27.55 23.549999999999997 55-59 20.075000000000003 28.810000000000002 27.839999999999996 23.275000000000002 60-64 20.044999999999998 28.48 28.125 23.35 65-69 20.145 28.044999999999998 28.13 23.68 70-74 20.544999999999998 27.965 27.405 24.085 75-79 20.119999999999997 28.955 27.16 23.765 80-84 20.285 28.09 28.71 22.915 85-89 20.3 28.544999999999998 27.584999999999997 23.57 90-94 19.64 28.634999999999998 28.015 23.71 95-99 19.875 27.900000000000002 28.315 23.91 100-104 20.275000000000002 28.560000000000002 28.194999999999997 22.97 105-109 20.255000000000003 28.050000000000004 28.065 23.630000000000003 110-114 20.06 28.660000000000004 27.950000000000003 23.330000000000002 115-119 20.919999999999998 28.575 27.6 22.905 120-124 20.585 28.27 27.634999999999998 23.51 125-129 20.54 27.99 27.46 24.01 130-134 20.825 27.72 27.534999999999997 23.919999999999998 135-139 21.25 28.17 27.295 23.285 140-144 21.255 28.275 27.555000000000003 22.915 145-149 21.099999999999998 28.15 27.515 23.235 150-151 20.5625 27.8125 27.200000000000003 24.425 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 1.0 20 0.5 21 1.0 22 1.0 23 0.0 24 1.0 25 4.0 26 6.0 27 8.0 28 10.5 29 12.0 30 19.5 31 26.5 32 31.0 33 48.0 34 61.5 35 65.0 36 80.5 37 104.5 38 136.5 39 165.0 40 203.5 41 243.5 42 253.0 43 262.0 44 277.5 45 289.5 46 273.0 47 244.5 48 241.0 49 207.5 50 144.0 51 122.0 52 114.0 53 86.5 54 64.5 55 50.0 56 37.5 57 28.5 58 22.5 59 14.0 60 9.0 61 8.5 62 5.5 63 4.0 64 3.0 65 2.0 66 1.0 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.89987484355444 99.775 2 0.0750938673341677 0.15 3 0.025031289111389236 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0125 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.21250000000000002 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.2625 0.0 0.0 0.0 0.0 100-101 0.3 0.0 0.0 0.0 0.0 102-103 0.325 0.0 0.0 0.0 0.0 104-105 0.375 0.0 0.0 0.0 0.0 106-107 0.48750000000000004 0.0 0.0 0.0 0.0 108-109 0.55 0.0 0.0 0.0 0.0 110-111 0.6125 0.0 0.0 0.0 0.0 112-113 0.7375 0.0 0.0 0.0 0.0 114-115 0.85 0.0 0.0 0.0 0.0 116-117 0.975 0.0 0.0 0.0 0.0 118-119 1.0750000000000002 0.0 0.0 0.0 0.0 120-121 1.1875 0.0 0.0 0.0 0.0 122-123 1.475 0.0 0.0 0.0 0.0 124-125 1.6875 0.0 0.0 0.0 0.0 126-127 1.8875 0.0 0.0 0.0 0.0 128-129 2.0250000000000004 0.0 0.0 0.0 0.0 130-131 2.25 0.0 0.0 0.0 0.0 132-133 2.45 0.0 0.0 0.0 0.0 134-135 2.675 0.0 0.0 0.0 0.0 136-137 2.8875 0.0 0.0 0.0 0.0 138-139 3.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7171907 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171907_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.72425 33.0 33.0 34.0 32.0 34.0 2 32.84275 33.0 33.0 34.0 32.0 34.0 3 32.86975 33.0 33.0 34.0 32.0 34.0 4 32.7645 33.0 33.0 34.0 32.0 34.0 5 32.81725 33.0 33.0 34.0 32.0 34.0 6 37.01375 38.0 38.0 38.0 36.0 38.0 7 37.0185 38.0 38.0 38.0 36.0 38.0 8 37.058 38.0 38.0 38.0 36.0 38.0 9 36.99975 38.0 38.0 38.0 36.0 38.0 10-14 36.89295 38.0 38.0 38.0 35.8 38.0 15-19 36.9053 38.0 38.0 38.0 36.0 38.0 20-24 36.8964 38.0 38.0 38.0 35.8 38.0 25-29 36.84134999999999 38.0 38.0 38.0 35.8 38.0 30-34 36.7374 38.0 38.0 38.0 35.4 38.0 35-39 36.439800000000005 38.0 38.0 38.0 34.2 38.0 40-44 36.15814999999999 38.0 38.0 38.0 33.8 38.0 45-49 36.60170000000001 38.0 38.0 38.0 34.4 38.0 50-54 36.6676 38.0 38.0 38.0 34.8 38.0 55-59 36.606849999999994 38.0 38.0 38.0 34.6 38.0 60-64 36.5794 38.0 38.0 38.0 34.6 38.0 65-69 36.511700000000005 38.0 38.0 38.0 34.0 38.0 70-74 36.4264 38.0 38.0 38.0 34.0 38.0 75-79 36.40845 38.0 38.0 38.0 34.0 38.0 80-84 36.291399999999996 38.0 38.0 38.0 33.8 38.0 85-89 36.137899999999995 38.0 37.8 38.0 33.2 38.0 90-94 36.034000000000006 38.0 37.0 38.0 33.0 38.0 95-99 35.84965 38.0 37.0 38.0 32.4 38.0 100-104 35.75625 38.0 37.0 38.0 31.4 38.0 105-109 35.503299999999996 38.0 37.0 38.0 30.2 38.0 110-114 35.36704999999999 38.0 36.4 38.0 29.6 38.0 115-119 35.2039 38.0 36.0 38.0 28.4 38.0 120-124 35.03505 38.0 35.8 38.0 28.2 38.0 125-129 34.6613 38.0 35.0 38.0 26.6 38.0 130-134 34.2881 38.0 35.0 38.0 24.4 38.0 135-139 33.96585 38.0 34.8 38.0 23.2 38.0 140-144 33.51495 38.0 34.0 38.0 21.0 38.0 145-149 32.821749999999994 38.0 34.0 38.0 15.4 38.0 150-151 28.96425 36.0 24.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 3.0 4 0.0 5 4.0 6 0.0 7 0.0 8 1.0 9 0.0 10 3.0 11 0.0 12 2.0 13 2.0 14 4.0 15 3.0 16 6.0 17 7.0 18 4.0 19 7.0 20 13.0 21 11.0 22 8.0 23 13.0 24 18.0 25 21.0 26 27.0 27 24.0 28 36.0 29 41.0 30 55.0 31 92.0 32 94.0 33 123.0 34 175.0 35 348.0 36 760.0 37 2091.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.15 17.349999999999998 16.275000000000002 24.224999999999998 2 24.15 25.15 33.2 17.5 3 22.85 26.724999999999998 30.049999999999997 20.375 4 24.25 35.85 21.75 18.15 5 25.074999999999996 35.25 21.625 18.05 6 19.5 37.125 23.674999999999997 19.7 7 19.275000000000002 17.375 41.15 22.2 8 21.825 23.525 26.150000000000002 28.499999999999996 9 21.825 25.575 28.9 23.7 10-14 23.150000000000002 28.38 26.61 21.86 15-19 23.02 28.115000000000002 27.855 21.01 20-24 22.965 28.694999999999997 27.700000000000003 20.64 25-29 23.345 28.585 27.229999999999997 20.84 30-34 23.372529397047785 28.55641731298474 27.730798098573928 20.340255191393545 35-39 23.068410462776658 28.52112676056338 27.74144869215292 20.669014084507044 40-44 23.67914979757085 28.041497975708502 27.14574898785425 21.133603238866396 45-49 23.28 28.405 27.894999999999996 20.419999999999998 50-54 23.555 27.915 27.800000000000004 20.73 55-59 23.43 28.07 27.705000000000002 20.794999999999998 60-64 23.494999999999997 28.22 27.544999999999998 20.74 65-69 23.415 27.85 28.335 20.4 70-74 23.355 27.985 27.400000000000002 21.26 75-79 23.02 28.115000000000002 27.839999999999996 21.025 80-84 23.445 27.925 27.76 20.87 85-89 22.89 28.389999999999997 28.105000000000004 20.615 90-94 23.515 28.555000000000003 27.76 20.169999999999998 95-99 24.035 28.505000000000003 27.3 20.16 100-104 23.77 28.134999999999998 27.839999999999996 20.255000000000003 105-109 23.915 27.26 28.299999999999997 20.525 110-114 23.96 27.83 27.99 20.22 115-119 24.13 28.21 27.389999999999997 20.27 120-124 23.474999999999998 28.16 27.83 20.535 125-129 23.615 28.29 27.58 20.515 130-134 24.46 28.494999999999997 27.250000000000004 19.794999999999998 135-139 23.885 28.384999999999998 27.51 20.22 140-144 24.015 28.294999999999998 28.185 19.505 145-149 24.345 28.055000000000003 27.88 19.72 150-151 23.9 27.175 27.8875 21.0375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 1.0 20 1.0 21 0.0 22 0.0 23 0.0 24 1.5 25 2.5 26 3.0 27 4.0 28 6.5 29 9.0 30 10.0 31 15.0 32 23.5 33 32.5 34 43.0 35 57.0 36 76.0 37 115.5 38 141.5 39 155.5 40 192.0 41 238.0 42 261.0 43 283.0 44 292.5 45 288.0 46 283.0 47 238.5 48 229.0 49 215.5 50 164.5 51 139.0 52 123.0 53 98.0 54 66.0 55 43.0 56 33.0 57 28.0 58 23.0 59 18.0 60 14.0 61 8.5 62 6.0 63 5.0 64 2.0 65 3.0 66 2.5 67 0.5 68 0.5 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.075 35-39 0.6 40-44 1.2 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.07500000000000001 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.21250000000000002 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.2625 0.0 0.0 0.0 0.0 100-101 0.3 0.0 0.0 0.0 0.0 102-103 0.3 0.0 0.0 0.0 0.0 104-105 0.35 0.0 0.0 0.0 0.0 106-107 0.4625 0.0 0.0 0.0 0.0 108-109 0.525 0.0 0.0 0.0 0.0 110-111 0.5874999999999999 0.0 0.0 0.0 0.0 112-113 0.7125 0.0 0.0 0.0 0.0 114-115 0.825 0.0 0.0 0.0 0.0 116-117 0.95 0.0 0.0 0.0 0.0 118-119 1.0499999999999998 0.0 0.0 0.0 0.0 120-121 1.15 0.0 0.0 0.0 0.0 122-123 1.4249999999999998 0.0 0.0 0.0 0.0 124-125 1.6625 0.0 0.0 0.0 0.0 126-127 1.875 0.0 0.0 0.0 0.0 128-129 2.05 0.0 0.0 0.0 0.0 130-131 2.2625 0.0 0.0 0.0 0.0 132-133 2.4625 0.0 0.0 0.0 0.0 134-135 2.7 0.0 0.0 0.0 0.0 136-137 2.925 0.0 0.0 0.0 0.0 138-139 3.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGTCCCA 10 0.006830828 145.0 4 TAGCCAC 10 0.006830828 145.0 8 GTCCCAA 10 0.006830828 145.0 5 >>END_MODULE Read 715901 spots for SRR7171907.sra Written 715901 spots for SRR7171907.sra Read 715901 spots for SRR7171907.sra Written 715901 spots for SRR7171907.sra Read 715901 spots for SRR7171907.sra Written 715901 spots for SRR7171907.sra Read 715901 spots for SRR7171907.sra Written 715901 spots for SRR7171907.sra Read 715901 spots for SRR7171907.sra Written 715901 spots for SRR7171907.sra Read 715901 spots for SRR7171907.sra Written 715901 spots for SRR7171907.sra Read 715901 spots for SRR7171907.sra Written 715901 spots for SRR7171907.sra Read 715901 spots for SRR7171907.sra Written 715901 spots for SRR7171907.sra Read 715901 spots for SRR7171907.sra Written 715901 spots for SRR7171907.sra Read 715901 spots for SRR7171907.sra Written 715901 spots for SRR7171907.sra Read 715901 spots for SRR7171907.sra Written 715901 spots for SRR7171907.sra Read 715901 spots for SRR7171907.sra Written 715901 spots for SRR7171907.sra Read 715901 spots for SRR7171907.sra Written 715901 spots for SRR7171907.sra Read 715901 spots for SRR7171907.sra Written 715901 spots for SRR7171907.sra Read 715901 spots for SRR7171907.sra Written 715901 spots for SRR7171907.sra Read 715901 spots for SRR7171907.sra Written 715901 spots for SRR7171907.sra Read 715901 spots for SRR7171907.sra Written 715901 spots for SRR7171907.sra Read 715901 spots for SRR7171907.sra Written 715901 spots for SRR7171907.sra Read 715901 spots for SRR7171907.sra Written 715901 spots for SRR7171907.sra Read 715914 spots for SRR7171907.sra Written 715914 spots for SRR7171907.sra SRR ids: ['SRR7171907.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_v4wykowt SRR7171907.sra spots: 14318033 blocks: [[1, 715901], [715902, 1431802], [1431803, 2147703], [2147704, 2863604], [2863605, 3579505], [3579506, 4295406], [4295407, 5011307], [5011308, 5727208], [5727209, 6443109], [6443110, 7159010], [7159011, 7874911], [7874912, 8590812], [8590813, 9306713], [9306714, 10022614], [10022615, 10738515], [10738516, 11454416], [11454417, 12170317], [12170318, 12886218], [12886219, 13602119], [13602120, 14318033]] SRR7171907 file size 4830211 SRR7171907 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171907 SRR7171907_1.fastq SRR7171907_2.fastq Input file: SRR7171907_1.fastq Paired file: SRR7171907_2.fastq trimmed: SRR7171907-trimmed-pair1.fastq, SRR7171907-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 01:48:16 2025 >> started Fri Feb 14 01:48:33 2025 >> done (17.196s) 14318033 read pairs processed; of these: 21049 ( 0.15%) short read pairs filtered out after trimming by size control 14065 ( 0.10%) empty read pairs filtered out after trimming by size control 14282919 (99.75%) read pairs available; of these: 5660239 (39.63%) trimmed read pairs available after processing 8622680 (60.37%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 2 0.00% 20 0 0.00% 21 4 0.00% 22 4 0.00% 23 5 0.00% 24 7 0.00% 25 2 0.00% 26 8 0.00% 27 2 0.00% 28 7 0.00% 29 6 0.00% 30 3 0.00% 31 5 0.00% 32 3 0.00% 33 5 0.00% 34 4 0.00% 35 6 0.00% 36 7 0.00% 37 6 0.00% 38 9 0.00% 39 6 0.00% 40 8 0.00% 41 7 0.00% 42 7 0.00% 43 5 0.00% 44 14 0.00% 45 9 0.00% 46 14 0.00% 47 9 0.00% 48 15 0.00% 49 15 0.00% 50 25 0.00% 51 21 0.00% 52 20 0.00% 53 31 0.00% 54 40 0.00% 55 36 0.00% 56 34 0.00% 57 46 0.00% 58 50 0.00% 59 51 0.00% 60 76 0.00% 61 73 0.00% 62 76 0.00% 63 93 0.00% 64 99 0.00% 65 135 0.00% 66 139 0.00% 67 161 0.00% 68 180 0.00% 69 199 0.00% 70 218 0.00% 71 227 0.00% 72 272 0.00% 73 347 0.00% 74 385 0.00% 75 413 0.00% 76 509 0.00% 77 622 0.00% 78 626 0.00% 79 688 0.00% 80 735 0.01% 81 906 0.01% 82 1033 0.01% 83 1278 0.01% 84 2204 0.02% 85 2864 0.02% 86 3109 0.02% 87 3625 0.03% 88 3760 0.03% 89 3602 0.03% 90 3752 0.03% 91 3903 0.03% 92 4027 0.03% 93 4201 0.03% 94 4595 0.03% 95 4792 0.03% 96 4927 0.03% 97 5266 0.04% 98 5499 0.04% 99 5862 0.04% 100 6217 0.04% 101 6608 0.05% 102 7022 0.05% 103 7711 0.05% 104 8012 0.06% 105 8549 0.06% 106 8919 0.06% 107 9562 0.07% 108 9950 0.07% 109 10466 0.07% 110 11207 0.08% 111 11897 0.08% 112 12449 0.09% 113 13175 0.09% 114 13906 0.10% 115 14727 0.10% 116 15635 0.11% 117 16011 0.11% 118 16903 0.12% 119 17533 0.12% 120 18024 0.13% 121 18882 0.13% 122 19915 0.14% 123 21401 0.15% 124 22007 0.15% 125 22994 0.16% 126 24410 0.17% 127 25487 0.18% 128 26746 0.19% 129 27817 0.19% 130 29611 0.21% 131 31010 0.22% 132 33140 0.23% 133 35128 0.25% 134 37421 0.26% 135 39719 0.28% 136 43149 0.30% 137 45936 0.32% 138 49281 0.35% 139 53337 0.37% 140 57630 0.40% 141 63394 0.44% 142 70760 0.50% 143 81081 0.57% 144 94537 0.66% 145 112888 0.79% 146 141060 0.99% 147 191464 1.34% 148 294849 2.06% 149 590231 4.13% 150 3034431 21.25% 151 8622680 60.37% 14282919 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=3.38 fanout-score-rank=26 prefix-density=0.37 prefix-fanout=2.2 sequence=CACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.05 sequence-density-rank=27 fanout-score=34.18 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=5.9 sequence=CAAGAACAAAGATCATGCCACCAAAGGCCCAAGCGAT criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=2.52 fanout-score-rank=30 prefix-density=0.34 prefix-fanout=2.5 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.13 sequence-density-rank=11 fanout-score=17.73 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=6.7 sequence=GGTGCTGAGAATGGCTGCAAGTG SRR7171907 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 01:49:16 Started mapping on | Feb 14 01:49:17 Finished on | Feb 14 01:51:07 Mapping speed, Million of reads per hour | 467.44 Number of input reads | 14282919 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 13254920 Uniquely mapped reads % | 92.80% Average mapped length | 296.18 Number of splices: Total | 13040634 Number of splices: Annotated (sjdb) | 12767848 Number of splices: GT/AG | 12833803 Number of splices: GC/AG | 161344 Number of splices: AT/AC | 9839 Number of splices: Non-canonical | 35648 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.56 Insertion rate per base | 0.02% Insertion average length | 2.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 334275 % of reads mapped to multiple loci | 2.34% Number of reads mapped to too many loci | 32664 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.56% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 714103 714103 714103 N_multimapping 334275 334275 334275 N_noFeature 347247 13122632 411529 N_ambiguous 144455 830 75944 UnstrandedReadsAssigned:12763218 PositiveStrandReadsAssigned:131458 NegativeStrandReadsAssigned:12767447 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7171907 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171907-trimmed-pair1.fastq SRR7171907-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,282,919 reads, 12,663,581 reads pseudoaligned [quant] estimated average fragment length: 254.586 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,133 rounds 52401 SRR7171907.ke.tsv 34699 SRR7171907.se.tsv 87100 total ==> SRR7171907.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1764.41 2082 92.9967 Potri.005G024800.1.v4.1 1035 781.414 761 76.7522 Potri.004G059700.1.v4.1 961 707.431 10 1.11405 Potri.007G009000.2.v4.1 1416 1162.41 0 0 Potri.003G141000.2.v4.1 2943 2689.41 617 18.0807 Potri.016G087400.1.v4.1 270 69.7194 662 748.327 Potri.015G069301.1.v4.1 564 314.145 0 0 Potri.010G195200.1.v4.1 1773 1519.41 445.964 23.1319 Potri.012G127500.1.v4.1 977 723.419 7401 806.283 ==> SRR7171907.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 20 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 486 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 150 SRR7171907 completed mapping pipeline successfully