Starting /dee2/code/volunteer_pipeline.sh SRR7171908 current disk space = 3088908439552 free memory = 1581109060 SRR7171908 SRAfilesize 85329289ac15a074316392a25dceb913 SRR7171908.sra SRR7171908.sra file validated SRR7171908 is paired end SRR7171908 is conventional basespace SRR7171908 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171908_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.95475 31.0 18.0 33.0 18.0 34.0 2 32.16675 33.0 31.0 34.0 30.0 34.0 3 32.63075 33.0 33.0 34.0 31.0 34.0 4 32.93575 33.0 33.0 34.0 33.0 34.0 5 32.78825 33.0 33.0 34.0 32.0 34.0 6 36.8345 38.0 37.0 38.0 35.0 38.0 7 37.284 38.0 38.0 38.0 36.0 38.0 8 37.41525 38.0 38.0 38.0 37.0 38.0 9 37.59975 38.0 38.0 38.0 37.0 38.0 10-14 37.615300000000005 38.0 38.0 38.0 38.0 38.0 15-19 37.61945 38.0 38.0 38.0 38.0 38.0 20-24 37.610600000000005 38.0 38.0 38.0 38.0 38.0 25-29 37.567600000000006 38.0 38.0 38.0 38.0 38.0 30-34 37.52355 38.0 38.0 38.0 37.8 38.0 35-39 37.5192 38.0 38.0 38.0 38.0 38.0 40-44 37.47405 38.0 38.0 38.0 37.2 38.0 45-49 37.426 38.0 38.0 38.0 37.2 38.0 50-54 37.40475 38.0 38.0 38.0 37.0 38.0 55-59 37.322849999999995 38.0 38.0 38.0 37.0 38.0 60-64 37.26985 38.0 38.0 38.0 36.4 38.0 65-69 37.22335 38.0 38.0 38.0 36.4 38.0 70-74 37.171800000000005 38.0 38.0 38.0 36.0 38.0 75-79 37.0832 38.0 38.0 38.0 36.0 38.0 80-84 37.0608 38.0 38.0 38.0 36.0 38.0 85-89 37.00079999999999 38.0 38.0 38.0 36.0 38.0 90-94 36.906 38.0 38.0 38.0 35.8 38.0 95-99 36.76875 38.0 38.0 38.0 35.2 38.0 100-104 36.6426 38.0 38.0 38.0 34.6 38.0 105-109 36.563849999999995 38.0 38.0 38.0 34.0 38.0 110-114 36.3677 38.0 38.0 38.0 34.0 38.0 115-119 36.3156 38.0 38.0 38.0 34.0 38.0 120-124 36.0546 38.0 37.2 38.0 33.4 38.0 125-129 35.82095 38.0 36.6 38.0 32.2 38.0 130-134 35.6736 38.0 36.4 38.0 31.6 38.0 135-139 35.22575 38.0 36.0 38.0 29.8 38.0 140-144 35.0089 38.0 35.8 38.0 29.2 38.0 145-149 34.4564 38.0 35.0 38.0 27.4 38.0 150-151 31.465625000000003 36.5 31.5 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 0.0 16 1.0 17 1.0 18 4.0 19 3.0 20 2.0 21 6.0 22 2.0 23 13.0 24 9.0 25 10.0 26 9.0 27 10.0 28 21.0 29 26.0 30 34.0 31 28.0 32 49.0 33 78.0 34 137.0 35 235.0 36 678.0 37 2642.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.05 13.375 11.525 37.05 2 19.979994998749685 18.27956989247312 37.90947736934234 23.830957739434858 3 18.95 23.625 27.675 29.75 4 22.6 32.225 23.35 21.825 5 21.5 33.7 25.775 19.025 6 17.849999999999998 35.325 25.650000000000002 21.175 7 13.925 22.35 44.224999999999994 19.5 8 18.025 22.325 30.725 28.925 9 17.05 22.525000000000002 33.675 26.75 10-14 19.725 28.335 27.725 24.215 15-19 19.96 27.700000000000003 28.265 24.075 20-24 19.689999999999998 27.474999999999998 28.37 24.465 25-29 20.044999999999998 28.33 28.000000000000004 23.625 30-34 21.060000000000002 27.27 27.755000000000003 23.915 35-39 20.255000000000003 28.16 27.694999999999997 23.89 40-44 20.06 28.405 27.72 23.815 45-49 20.36 27.54 28.065 24.035 50-54 20.645 27.975 27.77 23.61 55-59 20.11 28.025 27.705000000000002 24.16 60-64 20.76 27.055 27.965 24.22 65-69 20.45 27.529999999999998 27.800000000000004 24.22 70-74 20.405 27.794999999999998 28.294999999999998 23.505000000000003 75-79 20.495 27.595 27.994999999999997 23.915 80-84 20.244999999999997 27.905 27.584999999999997 24.265 85-89 20.65 27.915 27.665 23.77 90-94 20.13 28.249999999999996 27.625 23.995 95-99 20.265 27.034999999999997 28.455000000000002 24.245 100-104 20.29 27.725 28.365000000000002 23.62 105-109 20.51 27.400000000000002 27.87 24.22 110-114 20.395 28.17 27.935 23.5 115-119 20.794999999999998 27.35 28.09 23.765 120-124 20.95 28.005000000000003 27.534999999999997 23.51 125-129 20.560000000000002 27.725 27.68 24.035 130-134 21.065 27.855 27.725 23.355 135-139 21.275 27.845 27.250000000000004 23.630000000000003 140-144 20.565 27.744999999999997 27.83 23.86 145-149 21.63 27.92 26.905 23.544999999999998 150-151 20.7875 28.1875 26.887499999999996 24.1375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 1.5 23 1.0 24 0.5 25 3.0 26 4.5 27 5.0 28 5.0 29 8.0 30 17.5 31 22.5 32 30.5 33 36.0 34 41.5 35 52.0 36 74.0 37 101.0 38 119.0 39 152.5 40 184.5 41 216.0 42 243.0 43 264.5 44 278.5 45 270.0 46 271.0 47 262.5 48 241.0 49 220.5 50 191.0 51 161.0 52 124.5 53 98.5 54 76.5 55 49.5 56 40.0 57 35.5 58 24.5 59 14.0 60 14.0 61 14.0 62 5.5 63 4.5 64 5.5 65 2.0 66 1.5 67 2.5 68 2.0 69 0.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.0875 0.0 0.0 0.0 0.0 100-101 0.16249999999999998 0.0 0.0 0.0 0.0 102-103 0.2625 0.0 0.0 0.0 0.0 104-105 0.3375 0.0 0.0 0.0 0.0 106-107 0.35 0.0 0.0 0.0 0.0 108-109 0.35 0.0 0.0 0.0 0.0 110-111 0.375 0.0 0.0 0.0 0.0 112-113 0.4625 0.0 0.0 0.0 0.0 114-115 0.525 0.0 0.0 0.0 0.0 116-117 0.7125 0.0 0.0 0.0 0.0 118-119 0.8 0.0 0.0 0.0 0.0 120-121 0.925 0.0 0.0 0.0 0.0 122-123 1.0375 0.0 0.0 0.0 0.0 124-125 1.2875 0.0 0.0 0.0 0.0 126-127 1.4875 0.0 0.0 0.0 0.0 128-129 1.6625 0.0 0.0 0.0 0.0 130-131 1.9 0.0 0.0 0.0 0.0 132-133 2.1375 0.0 0.0 0.0 0.0 134-135 2.4375 0.0 0.0 0.0 0.0 136-137 2.675 0.0 0.0 0.0 0.0 138-139 2.9375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCAATCA 10 0.006830828 145.0 3 >>END_MODULE SRR7171908 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171908_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.05575 33.0 33.0 34.0 32.0 34.0 2 33.168 34.0 33.0 34.0 33.0 34.0 3 33.18175 34.0 33.0 34.0 33.0 34.0 4 33.20625 34.0 33.0 34.0 33.0 34.0 5 33.203 34.0 33.0 34.0 33.0 34.0 6 37.477 38.0 38.0 38.0 38.0 38.0 7 37.427 38.0 38.0 38.0 38.0 38.0 8 37.34025 38.0 38.0 38.0 38.0 38.0 9 37.4155 38.0 38.0 38.0 38.0 38.0 10-14 37.3778 38.0 38.0 38.0 37.4 38.0 15-19 37.3605 38.0 38.0 38.0 37.2 38.0 20-24 37.33220000000001 38.0 38.0 38.0 37.2 38.0 25-29 37.317400000000006 38.0 38.0 38.0 37.2 38.0 30-34 37.299400000000006 38.0 38.0 38.0 37.0 38.0 35-39 37.08485 38.0 38.0 38.0 37.0 38.0 40-44 36.8003 38.0 38.0 38.0 36.8 38.0 45-49 37.26475 38.0 38.0 38.0 37.0 38.0 50-54 37.2666 38.0 38.0 38.0 37.0 38.0 55-59 37.22875 38.0 38.0 38.0 37.0 38.0 60-64 37.18445 38.0 38.0 38.0 36.8 38.0 65-69 37.1452 38.0 38.0 38.0 36.6 38.0 70-74 37.0915 38.0 38.0 38.0 36.2 38.0 75-79 37.0333 38.0 38.0 38.0 36.0 38.0 80-84 36.94500000000001 38.0 38.0 38.0 36.0 38.0 85-89 36.849599999999995 38.0 38.0 38.0 36.0 38.0 90-94 36.730500000000006 38.0 38.0 38.0 35.0 38.0 95-99 36.624900000000004 38.0 38.0 38.0 35.0 38.0 100-104 36.547349999999994 38.0 38.0 38.0 34.4 38.0 105-109 36.30355 38.0 38.0 38.0 34.0 38.0 110-114 36.3206 38.0 38.0 38.0 34.0 38.0 115-119 36.23035 38.0 38.0 38.0 34.0 38.0 120-124 36.0921 38.0 37.8 38.0 33.4 38.0 125-129 35.8568 38.0 37.2 38.0 32.6 38.0 130-134 35.38825 38.0 36.0 38.0 31.0 38.0 135-139 35.343650000000004 38.0 36.0 38.0 31.0 38.0 140-144 34.78595 38.0 36.0 38.0 28.0 38.0 145-149 34.485049999999994 38.0 35.6 38.0 27.6 38.0 150-151 30.916125 35.5 31.0 38.0 14.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 0.0 10 0.0 11 4.0 12 0.0 13 1.0 14 1.0 15 0.0 16 2.0 17 1.0 18 3.0 19 4.0 20 9.0 21 3.0 22 7.0 23 5.0 24 15.0 25 3.0 26 12.0 27 20.0 28 14.0 29 28.0 30 39.0 31 60.0 32 52.0 33 81.0 34 125.0 35 224.0 36 561.0 37 2719.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.075 17.125 13.875000000000002 28.925 2 24.0 25.324999999999996 33.675 17.0 3 21.5 28.249999999999996 29.775000000000002 20.474999999999998 4 24.625 34.525 21.625 19.225 5 23.7 36.3 20.9 19.1 6 19.575 38.550000000000004 22.675 19.2 7 18.675 17.75 41.349999999999994 22.225 8 20.724999999999998 23.75 26.8 28.725 9 22.1 24.8 29.075 24.025 10-14 23.305 28.18 26.490000000000002 22.025 15-19 23.05 27.875 27.405 21.67 20-24 22.830000000000002 28.735 26.745 21.69 25-29 23.26 28.225 27.08 21.435000000000002 30-34 22.601951463597697 28.58143607705779 27.675756817613212 21.1408556417313 35-39 23.421475970239293 28.177156645887795 27.49849185602252 20.90287552785039 40-44 23.40640980203534 28.525137967697837 26.753075793630703 21.315376436636118 45-49 23.315 28.075 27.505000000000003 21.105 50-54 23.05 28.384999999999998 27.83 20.735 55-59 23.715 27.525 27.865000000000002 20.895 60-64 23.825 28.21 27.005000000000003 20.96 65-69 23.445 27.875 27.96 20.72 70-74 23.845 28.115000000000002 27.33 20.71 75-79 23.674999999999997 28.299999999999997 27.500000000000004 20.525 80-84 24.08 27.155 27.529999999999998 21.235 85-89 23.395 28.215 27.405 20.985 90-94 23.36 28.349999999999998 27.500000000000004 20.79 95-99 24.205 27.615000000000002 27.060000000000002 21.12 100-104 23.82 27.785 27.439999999999998 20.955 105-109 23.945 27.71 27.534999999999997 20.810000000000002 110-114 24.265 27.88 27.435 20.419999999999998 115-119 23.84 28.28 27.365000000000002 20.515 120-124 23.395 27.939999999999998 27.534999999999997 21.13 125-129 23.925 27.650000000000002 27.58 20.845 130-134 24.060000000000002 28.225 27.345000000000002 20.369999999999997 135-139 23.94 28.275 27.045 20.74 140-144 23.945 29.685 25.765 20.605 145-149 24.535 28.365000000000002 26.729999999999997 20.369999999999997 150-151 24.45 27.8375 26.4625 21.25 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 2.0 20 2.0 21 1.0 22 0.5 23 1.0 24 1.5 25 0.5 26 0.5 27 2.0 28 3.0 29 3.5 30 4.5 31 8.5 32 18.0 33 24.0 34 33.5 35 42.0 36 67.5 37 90.5 38 117.0 39 157.0 40 184.0 41 218.5 42 265.5 43 289.0 44 298.0 45 305.0 46 288.5 47 275.0 48 252.5 49 223.5 50 183.0 51 147.5 52 116.5 53 92.0 54 78.0 55 58.0 56 42.5 57 31.0 58 21.0 59 11.0 60 8.5 61 8.0 62 6.5 63 5.0 64 2.5 65 1.0 66 1.5 67 1.5 68 1.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.075 35-39 0.54 40-44 1.2449999999999999 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.0875 0.0 0.0 0.0 0.0 100-101 0.16249999999999998 0.0 0.0 0.0 0.0 102-103 0.2625 0.0 0.0 0.0 0.0 104-105 0.3375 0.0 0.0 0.0 0.0 106-107 0.35 0.0 0.0 0.0 0.0 108-109 0.35 0.0 0.0 0.0 0.0 110-111 0.375 0.0 0.0 0.0 0.0 112-113 0.4625 0.0 0.0 0.0 0.0 114-115 0.525 0.0 0.0 0.0 0.0 116-117 0.7250000000000001 0.0 0.0 0.0 0.0 118-119 0.825 0.0 0.0 0.0 0.0 120-121 0.9625 0.0 0.0 0.0 0.0 122-123 1.0875 0.0 0.0 0.0 0.0 124-125 1.3624999999999998 0.0 0.0 0.0 0.0 126-127 1.5625 0.0 0.0 0.0 0.0 128-129 1.7125 0.0 0.0 0.0 0.0 130-131 1.9625 0.0 0.0 0.0 0.0 132-133 2.1875 0.0 0.0 0.0 0.0 134-135 2.4749999999999996 0.0 0.0 0.0 0.0 136-137 2.7 0.0 0.0 0.0 0.0 138-139 2.9875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTACAA 10 0.006864391 144.7625 5 >>END_MODULE Read 829188 spots for SRR7171908.sra Written 829188 spots for SRR7171908.sra Read 829188 spots for SRR7171908.sra Written 829188 spots for SRR7171908.sra Read 829188 spots for SRR7171908.sra Written 829188 spots for SRR7171908.sra Read 829188 spots for SRR7171908.sra Written 829188 spots for SRR7171908.sra Read 829188 spots for SRR7171908.sra Written 829188 spots for SRR7171908.sra Read 829188 spots for SRR7171908.sra Written 829188 spots for SRR7171908.sra Read 829204 spots for SRR7171908.sra Written 829204 spots for SRR7171908.sra Read 829188 spots for SRR7171908.sra Written 829188 spots for SRR7171908.sra Read 829188 spots for SRR7171908.sra Written 829188 spots for SRR7171908.sra Read 829188 spots for SRR7171908.sra Written 829188 spots for SRR7171908.sra Read 829188 spots for SRR7171908.sra Written 829188 spots for SRR7171908.sra Read 829188 spots for SRR7171908.sra Written 829188 spots for SRR7171908.sra Read 829188 spots for SRR7171908.sra Written 829188 spots for SRR7171908.sra Read 829188 spots for SRR7171908.sra Written 829188 spots for SRR7171908.sra Read 829188 spots for SRR7171908.sra Written 829188 spots for SRR7171908.sra Read 829188 spots for SRR7171908.sra Written 829188 spots for SRR7171908.sra Read 829188 spots for SRR7171908.sra Written 829188 spots for SRR7171908.sra Read 829188 spots for SRR7171908.sra Written 829188 spots for SRR7171908.sra Read 829188 spots for SRR7171908.sra Written 829188 spots for SRR7171908.sra Read 829188 spots for SRR7171908.sra Written 829188 spots for SRR7171908.sra SRR ids: ['SRR7171908.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bkdlp9uy SRR7171908.sra spots: 16583776 blocks: [[1, 829188], [829189, 1658376], [1658377, 2487564], [2487565, 3316752], [3316753, 4145940], [4145941, 4975128], [4975129, 5804316], [5804317, 6633504], [6633505, 7462692], [7462693, 8291880], [8291881, 9121068], [9121069, 9950256], [9950257, 10779444], [10779445, 11608632], [11608633, 12437820], [12437821, 13267008], [13267009, 14096196], [14096197, 14925384], [14925385, 15754572], [15754573, 16583776]] SRR7171908 file size 5597997 SRR7171908 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171908 SRR7171908_1.fastq SRR7171908_2.fastq Input file: SRR7171908_1.fastq Paired file: SRR7171908_2.fastq trimmed: SRR7171908-trimmed-pair1.fastq, SRR7171908-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 01:48:37 2025 >> started Fri Feb 14 01:48:56 2025 >> done (19.004s) 16583776 read pairs processed; of these: 8460 ( 0.05%) short read pairs filtered out after trimming by size control 6255 ( 0.04%) empty read pairs filtered out after trimming by size control 16569061 (99.91%) read pairs available; of these: 6698891 (40.43%) trimmed read pairs available after processing 9870170 (59.57%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 5 0.00% 20 3 0.00% 21 3 0.00% 22 1 0.00% 23 4 0.00% 24 4 0.00% 25 3 0.00% 26 4 0.00% 27 2 0.00% 28 9 0.00% 29 3 0.00% 30 5 0.00% 31 7 0.00% 32 5 0.00% 33 6 0.00% 34 6 0.00% 35 6 0.00% 36 4 0.00% 37 4 0.00% 38 6 0.00% 39 4 0.00% 40 9 0.00% 41 6 0.00% 42 7 0.00% 43 10 0.00% 44 11 0.00% 45 9 0.00% 46 8 0.00% 47 19 0.00% 48 15 0.00% 49 10 0.00% 50 10 0.00% 51 25 0.00% 52 31 0.00% 53 24 0.00% 54 30 0.00% 55 34 0.00% 56 30 0.00% 57 41 0.00% 58 44 0.00% 59 48 0.00% 60 62 0.00% 61 77 0.00% 62 70 0.00% 63 85 0.00% 64 95 0.00% 65 100 0.00% 66 100 0.00% 67 122 0.00% 68 144 0.00% 69 163 0.00% 70 208 0.00% 71 220 0.00% 72 244 0.00% 73 279 0.00% 74 292 0.00% 75 338 0.00% 76 385 0.00% 77 478 0.00% 78 493 0.00% 79 525 0.00% 80 586 0.00% 81 705 0.00% 82 819 0.00% 83 973 0.01% 84 1438 0.01% 85 1743 0.01% 86 1956 0.01% 87 2258 0.01% 88 2411 0.01% 89 2629 0.02% 90 2622 0.02% 91 2827 0.02% 92 3092 0.02% 93 3491 0.02% 94 3515 0.02% 95 3956 0.02% 96 4219 0.03% 97 4418 0.03% 98 4633 0.03% 99 4977 0.03% 100 5235 0.03% 101 5912 0.04% 102 6150 0.04% 103 6703 0.04% 104 7234 0.04% 105 7628 0.05% 106 7819 0.05% 107 8455 0.05% 108 8908 0.05% 109 9493 0.06% 110 10142 0.06% 111 10861 0.07% 112 11549 0.07% 113 12362 0.07% 114 13139 0.08% 115 13919 0.08% 116 14706 0.09% 117 15268 0.09% 118 15951 0.10% 119 16413 0.10% 120 17318 0.10% 121 18210 0.11% 122 19110 0.12% 123 20316 0.12% 124 21419 0.13% 125 22418 0.14% 126 23928 0.14% 127 25134 0.15% 128 26381 0.16% 129 27904 0.17% 130 29352 0.18% 131 31345 0.19% 132 33330 0.20% 133 35782 0.22% 134 38170 0.23% 135 40974 0.25% 136 43404 0.26% 137 46585 0.28% 138 51099 0.31% 139 54538 0.33% 140 59680 0.36% 141 66665 0.40% 142 74845 0.45% 143 85630 0.52% 144 101515 0.61% 145 124221 0.75% 146 159097 0.96% 147 219525 1.32% 148 347983 2.10% 149 726975 4.39% 150 3839927 23.18% 151 9870170 59.57% 16569061 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.16 fanout-score-rank=33 prefix-density=0.16 prefix-fanout=2.2 sequence=CGACACCATCAT criterion=fanout-score sequence-density=0.07 sequence-density-rank=22 fanout-score=74.98 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=16.5 sequence=TCATCCTCATCA criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=3.10 fanout-score-rank=27 prefix-density=0.20 prefix-fanout=2.9 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.07 sequence-density-rank=21 fanout-score=373.82 fanout-score-rank=1 prefix-density=0.79 prefix-fanout=32.2 sequence=GAAGAAGAAGAAA SRR7171908 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 01:49:37 Started mapping on | Feb 14 01:49:37 Finished on | Feb 14 01:51:28 Mapping speed, Million of reads per hour | 537.37 Number of input reads | 16569061 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 15590655 Uniquely mapped reads % | 94.09% Average mapped length | 297.15 Number of splices: Total | 16178589 Number of splices: Annotated (sjdb) | 15901973 Number of splices: GT/AG | 15923080 Number of splices: GC/AG | 207676 Number of splices: AT/AC | 11388 Number of splices: Non-canonical | 36445 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.63 Insertion rate per base | 0.02% Insertion average length | 2.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 394292 % of reads mapped to multiple loci | 2.38% Number of reads mapped to too many loci | 42919 % of reads mapped to too many loci | 0.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.21% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 593355 593355 593355 N_multimapping 394292 394292 394292 N_noFeature 335668 15447158 396686 N_ambiguous 166862 1239 83412 UnstrandedReadsAssigned:15088125 PositiveStrandReadsAssigned:142258 NegativeStrandReadsAssigned:15110557 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7171908 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171908-trimmed-pair1.fastq SRR7171908-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,569,061 reads, 14,998,661 reads pseudoaligned [quant] estimated average fragment length: 260.69 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,156 rounds 52401 SRR7171908.ke.tsv 34699 SRR7171908.se.tsv 87100 total ==> SRR7171908.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1758.31 1157 44.5303 Potri.005G024800.1.v4.1 1035 775.31 176 15.3623 Potri.004G059700.1.v4.1 961 701.351 25 2.41225 Potri.007G009000.2.v4.1 1416 1156.31 0 0 Potri.003G141000.2.v4.1 2943 2683.31 531 13.3919 Potri.016G087400.1.v4.1 270 67.3686 844.607 848.429 Potri.015G069301.1.v4.1 564 309.188 0 0 Potri.010G195200.1.v4.1 1773 1513.31 310.833 13.9001 Potri.012G127500.1.v4.1 977 717.339 3446 325.094 ==> SRR7171908.se.tsv <== Potri.001G166300.v4.1 2 Potri.001G448400.v4.1 81 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 349 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 7 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 221 SRR7171908 completed mapping pipeline successfully