Starting /dee2/code/volunteer_pipeline.sh SRR7171910 current disk space = 3089112473600 free memory = 1400684512 SRR7171910 SRAfilesize cb569758f3be7abba6e9756f77dbc3f1 SRR7171910.sra SRR7171910.sra file validated SRR7171910 is paired end SRR7171910 is conventional basespace SRR7171910 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171910_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.67725 32.0 18.0 33.0 18.0 33.0 2 32.066 33.0 32.0 33.0 28.0 34.0 3 31.22025 33.0 31.0 33.0 28.0 33.0 4 31.97775 33.0 31.0 33.0 29.0 34.0 5 32.6055 33.0 33.0 33.0 32.0 34.0 6 36.03075 37.0 36.0 38.0 33.0 38.0 7 37.25875 38.0 38.0 38.0 36.0 38.0 8 37.45875 38.0 38.0 38.0 37.0 38.0 9 37.5785 38.0 38.0 38.0 37.0 38.0 10-14 37.60485 38.0 38.0 38.0 38.0 38.0 15-19 37.60505 38.0 38.0 38.0 38.0 38.0 20-24 37.60405 38.0 38.0 38.0 38.0 38.0 25-29 37.575849999999996 38.0 38.0 38.0 38.0 38.0 30-34 37.553700000000006 38.0 38.0 38.0 37.8 38.0 35-39 37.55215 38.0 38.0 38.0 37.8 38.0 40-44 37.5616 38.0 38.0 38.0 37.8 38.0 45-49 37.50405 38.0 38.0 38.0 37.6 38.0 50-54 37.4676 38.0 38.0 38.0 37.0 38.0 55-59 37.3626 38.0 38.0 38.0 37.0 38.0 60-64 37.31465 38.0 38.0 38.0 37.0 38.0 65-69 37.273900000000005 38.0 38.0 38.0 36.2 38.0 70-74 37.2507 38.0 38.0 38.0 36.2 38.0 75-79 37.1771 38.0 38.0 38.0 36.0 38.0 80-84 37.091499999999996 38.0 38.0 38.0 36.0 38.0 85-89 37.03085 38.0 38.0 38.0 35.8 38.0 90-94 36.92745 38.0 38.0 38.0 35.4 38.0 95-99 36.8542 38.0 38.0 38.0 35.0 38.0 100-104 36.76045 38.0 38.0 38.0 35.0 38.0 105-109 36.5921 38.0 38.0 38.0 34.4 38.0 110-114 36.54495 38.0 38.0 38.0 34.0 38.0 115-119 36.3673 38.0 37.8 38.0 33.8 38.0 120-124 36.20795 38.0 37.0 38.0 33.4 38.0 125-129 36.095150000000004 38.0 37.0 38.0 33.2 38.0 130-134 35.84735 38.0 36.2 38.0 32.2 38.0 135-139 35.59054999999999 38.0 36.0 38.0 31.2 38.0 140-144 35.176849999999995 38.0 35.6 38.0 29.8 38.0 145-149 34.751349999999995 38.0 35.2 38.0 28.6 38.0 150-151 31.67675 36.5 31.5 38.0 13.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 0.0 18 3.0 19 3.0 20 0.0 21 6.0 22 1.0 23 0.0 24 5.0 25 9.0 26 7.0 27 11.0 28 16.0 29 19.0 30 30.0 31 47.0 32 62.0 33 67.0 34 114.0 35 262.0 36 752.0 37 2584.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.25 12.049999999999999 10.65 37.05 2 19.1 19.075 38.5 23.325000000000003 3 20.625 24.525 25.900000000000002 28.95 4 22.175 32.975 21.875 22.975 5 21.825 34.25 23.125 20.8 6 18.175 37.1 25.674999999999997 19.05 7 14.475 21.675 44.7 19.15 8 18.4 22.125 31.525 27.950000000000003 9 20.1 22.375 31.3 26.224999999999998 10-14 20.23 29.37 26.5 23.9 15-19 20.155 28.405 27.665 23.775 20-24 20.630000000000003 28.415000000000003 27.450000000000003 23.505000000000003 25-29 20.365 29.354999999999997 27.134999999999998 23.145 30-34 19.695 28.444999999999997 27.61 24.25 35-39 19.89 28.775000000000002 27.334999999999997 24.0 40-44 20.615 28.43 27.500000000000004 23.455000000000002 45-49 20.565 28.139999999999997 27.575 23.72 50-54 20.49 28.315 27.400000000000002 23.794999999999998 55-59 20.5 28.025 27.74 23.735 60-64 20.345 28.675 27.04 23.94 65-69 20.405 28.515 27.76 23.32 70-74 20.46 28.355000000000004 27.655 23.53 75-79 21.02 27.625 27.310000000000002 24.044999999999998 80-84 20.535 28.095 27.634999999999998 23.735 85-89 20.605 28.754999999999995 27.515 23.125 90-94 20.575 28.16 27.675 23.59 95-99 20.66 27.689999999999998 27.76 23.89 100-104 20.415 27.625 28.1 23.86 105-109 20.84 27.939999999999998 27.975 23.244999999999997 110-114 21.165 27.98 27.389999999999997 23.465 115-119 21.165 27.805000000000003 27.47 23.56 120-124 21.395 27.51 27.439999999999998 23.655 125-129 21.060000000000002 27.79 27.02 24.13 130-134 20.544999999999998 28.249999999999996 27.775 23.43 135-139 20.615 27.88 27.46 24.044999999999998 140-144 21.055 27.915 27.92 23.11 145-149 20.825 27.66 27.625 23.89 150-151 21.2375 27.3375 27.1 24.325 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.5 22 1.5 23 1.5 24 3.5 25 4.0 26 4.0 27 6.5 28 6.0 29 5.5 30 12.5 31 23.0 32 28.5 33 35.0 34 42.0 35 61.0 36 85.5 37 99.5 38 122.5 39 152.5 40 173.0 41 228.0 42 257.5 43 254.0 44 273.0 45 284.5 46 285.5 47 262.5 48 228.0 49 209.5 50 183.0 51 152.5 52 127.0 53 100.5 54 78.5 55 56.0 56 40.5 57 28.5 58 23.5 59 19.0 60 11.0 61 9.0 62 7.0 63 3.5 64 5.0 65 2.5 66 0.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79954898521673 99.575 2 0.17539463793535454 0.35000000000000003 3 0.025056376847907794 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.2625 0.0 0.0 0.0 0.0 100-101 0.32499999999999996 0.0 0.0 0.0 0.0 102-103 0.4 0.0 0.0 0.0 0.0 104-105 0.5 0.0 0.0 0.0 0.0 106-107 0.6375 0.0 0.0 0.0 0.0 108-109 0.7 0.0 0.0 0.0 0.0 110-111 0.7124999999999999 0.0 0.0 0.0 0.0 112-113 0.8374999999999999 0.0 0.0 0.0 0.0 114-115 0.9624999999999999 0.0 0.0 0.0 0.0 116-117 1.1 0.0 0.0 0.0 0.0 118-119 1.1875 0.0 0.0 0.0 0.0 120-121 1.4125 0.0 0.0 0.0 0.0 122-123 1.525 0.0 0.0 0.0 0.0 124-125 1.6875 0.0 0.0 0.0 0.0 126-127 1.9249999999999998 0.0 0.0 0.0 0.0 128-129 2.0374999999999996 0.0 0.0 0.0 0.0 130-131 2.3125 0.0 0.0 0.0 0.0 132-133 2.5625 0.0 0.0 0.0 0.0 134-135 2.7 0.0 0.0 0.0 0.0 136-137 2.8499999999999996 0.0 0.0 0.0 0.0 138-139 3.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7171910 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171910_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.135 33.0 33.0 34.0 33.0 34.0 2 33.20075 34.0 33.0 34.0 33.0 34.0 3 33.20475 34.0 33.0 34.0 33.0 34.0 4 33.19375 34.0 33.0 34.0 33.0 34.0 5 33.24625 34.0 33.0 34.0 33.0 34.0 6 37.46925 38.0 38.0 38.0 38.0 38.0 7 37.35075 38.0 38.0 38.0 37.0 38.0 8 37.393 38.0 38.0 38.0 38.0 38.0 9 37.33275 38.0 38.0 38.0 37.0 38.0 10-14 37.43385 38.0 38.0 38.0 37.8 38.0 15-19 37.381 38.0 38.0 38.0 37.2 38.0 20-24 37.388099999999994 38.0 38.0 38.0 37.2 38.0 25-29 37.32765 38.0 38.0 38.0 37.0 38.0 30-34 37.3089 38.0 38.0 38.0 37.0 38.0 35-39 37.21660000000001 38.0 38.0 38.0 37.0 38.0 40-44 37.0499 38.0 38.0 38.0 36.8 38.0 45-49 37.2421 38.0 38.0 38.0 37.0 38.0 50-54 37.238049999999994 38.0 38.0 38.0 37.0 38.0 55-59 37.155499999999996 38.0 38.0 38.0 36.8 38.0 60-64 37.10379999999999 38.0 38.0 38.0 36.4 38.0 65-69 37.04085 38.0 38.0 38.0 36.0 38.0 70-74 36.965050000000005 38.0 38.0 38.0 36.0 38.0 75-79 36.93555 38.0 38.0 38.0 36.0 38.0 80-84 36.8538 38.0 38.0 38.0 35.8 38.0 85-89 36.77825 38.0 38.0 38.0 35.8 38.0 90-94 36.601299999999995 38.0 38.0 38.0 34.8 38.0 95-99 36.49865 38.0 38.0 38.0 34.2 38.0 100-104 36.33115 38.0 38.0 38.0 34.0 38.0 105-109 36.1957 38.0 37.8 38.0 33.8 38.0 110-114 36.25795000000001 38.0 38.0 38.0 34.0 38.0 115-119 36.06699999999999 38.0 37.0 38.0 33.2 38.0 120-124 35.8281 38.0 37.0 38.0 32.2 38.0 125-129 35.69865 38.0 36.4 38.0 31.8 38.0 130-134 35.268249999999995 38.0 36.0 38.0 30.0 38.0 135-139 34.910849999999996 38.0 35.2 38.0 28.6 38.0 140-144 34.6437 38.0 35.0 38.0 27.4 38.0 145-149 33.9959 38.0 35.0 38.0 23.6 38.0 150-151 30.2795 36.5 29.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 3.0 4 4.0 5 1.0 6 0.0 7 1.0 8 1.0 9 0.0 10 2.0 11 1.0 12 2.0 13 1.0 14 0.0 15 2.0 16 1.0 17 0.0 18 2.0 19 8.0 20 4.0 21 3.0 22 4.0 23 7.0 24 10.0 25 14.0 26 18.0 27 15.0 28 17.0 29 22.0 30 36.0 31 38.0 32 59.0 33 93.0 34 145.0 35 254.0 36 637.0 37 2593.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.15 15.6 15.575 27.675 2 22.7 26.450000000000003 34.1 16.75 3 21.05 28.675 29.7 20.575 4 24.3 34.5 21.325 19.875 5 23.549999999999997 37.75 21.375 17.325 6 18.625 38.6 23.799999999999997 18.975 7 19.05 17.1 40.35 23.5 8 19.875 23.400000000000002 27.925 28.799999999999997 9 23.275000000000002 24.775 28.549999999999997 23.400000000000002 10-14 22.935 28.999999999999996 25.869999999999997 22.195 15-19 22.98 28.095 27.66 21.265 20-24 22.86 28.315 27.439999999999998 21.385 25-29 23.0 28.804999999999996 26.919999999999998 21.275 30-34 22.625 27.73 28.03 21.615000000000002 35-39 23.00920368147259 28.15126050420168 27.460984393757503 21.37855142056823 40-44 22.68258426966292 28.119983948635635 27.97451845906902 21.222913322632426 45-49 23.595 28.07 26.884999999999998 21.45 50-54 22.555 27.884999999999998 27.939999999999998 21.62 55-59 23.18 28.015 27.165 21.64 60-64 23.36 28.09 27.43 21.12 65-69 22.765 28.685 27.29 21.26 70-74 23.385 28.08 27.57 20.965 75-79 23.65 28.265 26.905 21.18 80-84 23.165 27.58 28.08 21.175 85-89 23.035 28.76 27.195000000000004 21.01 90-94 23.54 28.349999999999998 27.0 21.11 95-99 23.95 28.42 26.51 21.12 100-104 23.669999999999998 28.199999999999996 27.51 20.62 105-109 23.62 27.43 27.700000000000003 21.25 110-114 23.085 27.375 28.08 21.46 115-119 23.65 27.26 27.725 21.365000000000002 120-124 23.315 27.875 27.694999999999997 21.115000000000002 125-129 23.52 27.735 27.860000000000003 20.885 130-134 23.865 28.060000000000002 27.315 20.76 135-139 23.575 27.29 28.18 20.955 140-144 23.68 27.71 27.605 21.005 145-149 24.6 27.76 26.834999999999997 20.805 150-151 25.4375 26.637499999999996 26.887499999999996 21.0375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 1.0 26 1.5 27 2.0 28 1.5 29 3.5 30 7.5 31 10.5 32 16.5 33 25.0 34 32.5 35 53.5 36 73.0 37 102.5 38 135.0 39 151.5 40 191.5 41 237.0 42 262.5 43 275.5 44 289.5 45 287.0 46 288.0 47 263.5 48 237.0 49 236.0 50 199.5 51 153.5 52 108.0 53 80.5 54 71.5 55 53.5 56 37.0 57 34.5 58 24.0 59 14.0 60 12.5 61 7.0 62 4.5 63 4.5 64 2.5 65 1.0 66 0.5 67 2.5 68 2.5 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.04 40-44 0.32 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79949874686717 99.55000000000001 2 0.15037593984962408 0.3 3 0.05012531328320802 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.2625 0.0 0.0 0.0 0.0 100-101 0.3125 0.0 0.0 0.0 0.0 102-103 0.375 0.0 0.0 0.0 0.0 104-105 0.475 0.0 0.0 0.0 0.0 106-107 0.6125 0.0 0.0 0.0 0.0 108-109 0.675 0.0 0.0 0.0 0.0 110-111 0.6875 0.0 0.0 0.0 0.0 112-113 0.8374999999999999 0.0 0.0 0.0 0.0 114-115 0.9624999999999999 0.0 0.0 0.0 0.0 116-117 1.1 0.0 0.0 0.0 0.0 118-119 1.1875 0.0 0.0 0.0 0.0 120-121 1.4125 0.0 0.0 0.0 0.0 122-123 1.525 0.0 0.0 0.0 0.0 124-125 1.6875 0.0 0.0 0.0 0.0 126-127 1.9 0.0 0.0 0.0 0.0 128-129 2.0125 0.0 0.0 0.0 0.0 130-131 2.2874999999999996 0.0 0.0 0.0 0.0 132-133 2.5375 0.0 0.0 0.0 0.0 134-135 2.675 0.0 0.0 0.0 0.0 136-137 2.8499999999999996 0.0 0.0 0.0 0.0 138-139 3.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAATATT 10 0.006830828 145.0 4 >>END_MODULE Read 679639 spots for SRR7171910.sra Written 679639 spots for SRR7171910.sra Read 679639 spots for SRR7171910.sra Written 679639 spots for SRR7171910.sra Read 679639 spots for SRR7171910.sra Written 679639 spots for SRR7171910.sra Read 679639 spots for SRR7171910.sra Written 679639 spots for SRR7171910.sra Read 679639 spots for SRR7171910.sra Written 679639 spots for SRR7171910.sra Read 679639 spots for SRR7171910.sra Written 679639 spots for SRR7171910.sra Read 679639 spots for SRR7171910.sra Written 679639 spots for SRR7171910.sra Read 679639 spots for SRR7171910.sra Written 679639 spots for SRR7171910.sra Read 679639 spots for SRR7171910.sra Written 679639 spots for SRR7171910.sra Read 679639 spots for SRR7171910.sra Written 679639 spots for SRR7171910.sra Read 679639 spots for SRR7171910.sra Written 679639 spots for SRR7171910.sra Read 679639 spots for SRR7171910.sra Written 679639 spots for SRR7171910.sra Read 679639 spots for SRR7171910.sra Written 679639 spots for SRR7171910.sra Read 679639 spots for SRR7171910.sra Written 679639 spots for SRR7171910.sra Read 679639 spots for SRR7171910.sra Written 679639 spots for SRR7171910.sra Read 679639 spots for SRR7171910.sra Written 679639 spots for SRR7171910.sra Read 679656 spots for SRR7171910.sra Written 679656 spots for SRR7171910.sra Read 679639 spots for SRR7171910.sra Written 679639 spots for SRR7171910.sra Read 679639 spots for SRR7171910.sra Written 679639 spots for SRR7171910.sra Read 679639 spots for SRR7171910.sra Written 679639 spots for SRR7171910.sra SRR ids: ['SRR7171910.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6ds3yu_x SRR7171910.sra spots: 13592797 blocks: [[1, 679639], [679640, 1359278], [1359279, 2038917], [2038918, 2718556], [2718557, 3398195], [3398196, 4077834], [4077835, 4757473], [4757474, 5437112], [5437113, 6116751], [6116752, 6796390], [6796391, 7476029], [7476030, 8155668], [8155669, 8835307], [8835308, 9514946], [9514947, 10194585], [10194586, 10874224], [10874225, 11553863], [11553864, 12233502], [12233503, 12913141], [12913142, 13592797]] SRR7171910 file size 4584452 SRR7171910 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171910 SRR7171910_1.fastq SRR7171910_2.fastq Input file: SRR7171910_1.fastq Paired file: SRR7171910_2.fastq trimmed: SRR7171910-trimmed-pair1.fastq, SRR7171910-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 00:53:56 2025 >> started Fri Feb 14 00:54:11 2025 >> done (14.561s) 13592797 read pairs processed; of these: 8019 ( 0.06%) short read pairs filtered out after trimming by size control 10445 ( 0.08%) empty read pairs filtered out after trimming by size control 13574333 (99.86%) read pairs available; of these: 5291111 (38.98%) trimmed read pairs available after processing 8283222 (61.02%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 2 0.00% 20 3 0.00% 21 1 0.00% 22 4 0.00% 23 1 0.00% 24 3 0.00% 25 2 0.00% 26 8 0.00% 27 1 0.00% 28 5 0.00% 29 1 0.00% 30 3 0.00% 31 3 0.00% 32 6 0.00% 33 2 0.00% 34 3 0.00% 35 3 0.00% 36 3 0.00% 37 5 0.00% 38 10 0.00% 39 2 0.00% 40 6 0.00% 41 11 0.00% 42 4 0.00% 43 6 0.00% 44 17 0.00% 45 7 0.00% 46 9 0.00% 47 16 0.00% 48 18 0.00% 49 16 0.00% 50 19 0.00% 51 24 0.00% 52 28 0.00% 53 29 0.00% 54 25 0.00% 55 41 0.00% 56 40 0.00% 57 50 0.00% 58 55 0.00% 59 51 0.00% 60 72 0.00% 61 88 0.00% 62 80 0.00% 63 98 0.00% 64 114 0.00% 65 112 0.00% 66 122 0.00% 67 149 0.00% 68 170 0.00% 69 205 0.00% 70 215 0.00% 71 240 0.00% 72 303 0.00% 73 304 0.00% 74 383 0.00% 75 361 0.00% 76 571 0.00% 77 598 0.00% 78 548 0.00% 79 649 0.00% 80 711 0.01% 81 853 0.01% 82 956 0.01% 83 1045 0.01% 84 1508 0.01% 85 1853 0.01% 86 2035 0.01% 87 2356 0.02% 88 2515 0.02% 89 2517 0.02% 90 2733 0.02% 91 2915 0.02% 92 3185 0.02% 93 3317 0.02% 94 3571 0.03% 95 3683 0.03% 96 3951 0.03% 97 4264 0.03% 98 4471 0.03% 99 4710 0.03% 100 5229 0.04% 101 5527 0.04% 102 5891 0.04% 103 6142 0.05% 104 6675 0.05% 105 7042 0.05% 106 7388 0.05% 107 7747 0.06% 108 8127 0.06% 109 8815 0.06% 110 9114 0.07% 111 9402 0.07% 112 10068 0.07% 113 10707 0.08% 114 11364 0.08% 115 12239 0.09% 116 12492 0.09% 117 13021 0.10% 118 13662 0.10% 119 14017 0.10% 120 14926 0.11% 121 15501 0.11% 122 15780 0.12% 123 16975 0.13% 124 17749 0.13% 125 18660 0.14% 126 19525 0.14% 127 20693 0.15% 128 21627 0.16% 129 22498 0.17% 130 24091 0.18% 131 24933 0.18% 132 26513 0.20% 133 28351 0.21% 134 29928 0.22% 135 32369 0.24% 136 34237 0.25% 137 36714 0.27% 138 39610 0.29% 139 43058 0.32% 140 46702 0.34% 141 51817 0.38% 142 58371 0.43% 143 66282 0.49% 144 78567 0.58% 145 95788 0.71% 146 122767 0.90% 147 169931 1.25% 148 274493 2.02% 149 574151 4.23% 150 3004758 22.14% 151 8283222 61.02% 13574333 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.16 fanout-score-rank=31 prefix-density=0.22 prefix-fanout=2.1 sequence=CAGGTGCAGTTTGATCC criterion=fanout-score sequence-density=0.06 sequence-density-rank=27 fanout-score=83.57 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=15.9 sequence=CTTCTCATCAAGGT criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=6.30 fanout-score-rank=10 prefix-density=0.43 prefix-fanout=4.0 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.08 sequence-density-rank=23 fanout-score=40.55 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=10.9 sequence=TGGTGCTGAGAATGGCTGCAAGTG SRR7171910 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 00:54:53 Started mapping on | Feb 14 00:54:53 Finished on | Feb 14 00:56:23 Mapping speed, Million of reads per hour | 542.97 Number of input reads | 13574333 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 12778367 Uniquely mapped reads % | 94.14% Average mapped length | 296.99 Number of splices: Total | 13300587 Number of splices: Annotated (sjdb) | 13100710 Number of splices: GT/AG | 13094539 Number of splices: GC/AG | 169337 Number of splices: AT/AC | 9682 Number of splices: Non-canonical | 27029 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.58 Insertion rate per base | 0.02% Insertion average length | 2.64 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 341030 % of reads mapped to multiple loci | 2.51% Number of reads mapped to too many loci | 44501 % of reads mapped to too many loci | 0.33% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.96% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 463256 463256 463256 N_multimapping 341030 341030 341030 N_noFeature 254643 12664470 309302 N_ambiguous 124305 962 64327 UnstrandedReadsAssigned:12399419 PositiveStrandReadsAssigned:112935 NegativeStrandReadsAssigned:12404738 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7171910 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171910-trimmed-pair1.fastq SRR7171910-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,574,333 reads, 12,282,487 reads pseudoaligned [quant] estimated average fragment length: 259.587 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,201 rounds 52401 SRR7171910.ke.tsv 34699 SRR7171910.se.tsv 87100 total ==> SRR7171910.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1759.41 867 40.3172 Potri.005G024800.1.v4.1 1035 776.413 140 14.7528 Potri.004G059700.1.v4.1 961 702.413 21 2.44605 Potri.007G009000.2.v4.1 1416 1157.41 0 0 Potri.003G141000.2.v4.1 2943 2684.41 477.249 14.5457 Potri.016G087400.1.v4.1 270 68.0212 857.62 1031.55 Potri.015G069301.1.v4.1 564 309.604 0 0 Potri.010G195200.1.v4.1 1773 1514.41 122 6.59105 Potri.012G127500.1.v4.1 977 718.413 1641 186.885 ==> SRR7171910.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 32 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 255 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 6 Potri.001G452600.v4.1 91 SRR7171910 completed mapping pipeline successfully