Starting /dee2/code/volunteer_pipeline.sh SRR7171911 current disk space = 3089107251200 free memory = 1446609308 SRR7171911 SRAfilesize 92f62add7751f6b66d768e6c0853353c SRR7171911.sra SRR7171911.sra file validated SRR7171911 is paired end SRR7171911 is conventional basespace SRR7171911 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171911_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.14125 33.0 32.0 33.0 32.0 33.0 2 29.1775 31.0 28.0 33.0 18.0 34.0 3 29.918 31.0 29.0 33.0 25.0 33.0 4 31.549 33.0 31.0 33.0 29.0 33.0 5 30.77275 33.0 31.0 33.0 28.0 33.0 6 34.662 37.0 34.0 38.0 29.0 38.0 7 36.8305 38.0 37.0 38.0 35.0 38.0 8 37.09025 38.0 38.0 38.0 36.0 38.0 9 37.30725 38.0 38.0 38.0 36.0 38.0 10-14 37.33055 38.0 38.0 38.0 37.0 38.0 15-19 37.349500000000006 38.0 38.0 38.0 37.0 38.0 20-24 37.3395 38.0 38.0 38.0 37.0 38.0 25-29 37.293899999999994 38.0 38.0 38.0 37.0 38.0 30-34 37.30685 38.0 38.0 38.0 37.0 38.0 35-39 37.2987 38.0 38.0 38.0 37.0 38.0 40-44 37.2845 38.0 38.0 38.0 36.6 38.0 45-49 37.246050000000004 38.0 38.0 38.0 36.6 38.0 50-54 37.1644 38.0 38.0 38.0 36.0 38.0 55-59 37.0707 38.0 38.0 38.0 36.0 38.0 60-64 37.01735 38.0 38.0 38.0 36.0 38.0 65-69 36.98965 38.0 38.0 38.0 36.0 38.0 70-74 36.96305 38.0 38.0 38.0 36.0 38.0 75-79 36.8702 38.0 38.0 38.0 35.4 38.0 80-84 36.8343 38.0 38.0 38.0 35.2 38.0 85-89 36.70795 38.0 38.0 38.0 34.6 38.0 90-94 36.66635 38.0 38.0 38.0 34.2 38.0 95-99 36.6296 38.0 38.0 38.0 34.4 38.0 100-104 36.48505 38.0 37.8 38.0 34.0 38.0 105-109 36.382349999999995 38.0 37.4 38.0 34.0 38.0 110-114 36.119550000000004 38.0 37.0 38.0 33.4 38.0 115-119 36.064949999999996 38.0 37.0 38.0 33.0 38.0 120-124 35.972449999999995 38.0 37.0 38.0 33.0 38.0 125-129 35.75625 38.0 36.6 38.0 32.0 38.0 130-134 35.3573 38.0 36.0 38.0 30.4 38.0 135-139 35.2365 38.0 36.0 38.0 30.4 38.0 140-144 34.88270000000001 38.0 35.0 38.0 28.0 38.0 145-149 34.20819999999999 38.0 35.0 38.0 25.6 38.0 150-151 31.358375000000002 36.5 31.5 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 1.0 10 1.0 11 0.0 12 0.0 13 0.0 14 1.0 15 0.0 16 1.0 17 2.0 18 1.0 19 3.0 20 4.0 21 2.0 22 7.0 23 11.0 24 7.0 25 14.0 26 15.0 27 16.0 28 23.0 29 28.0 30 42.0 31 53.0 32 83.0 33 105.0 34 150.0 35 286.0 36 745.0 37 2398.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.75 17.05 6.35 33.85 2 22.3 23.200000000000003 26.525 27.975 3 21.05 27.525 28.050000000000004 23.375 4 30.7 32.525 20.45 16.325 5 30.925000000000004 34.5 18.65 15.925 6 18.825 38.025 22.275 20.875 7 14.924999999999999 23.825 42.475 18.775 8 17.849999999999998 24.275 29.9 27.975 9 18.775 23.75 32.675 24.8 10-14 20.615 29.775000000000002 26.105 23.505000000000003 15-19 20.27 27.625 28.425 23.68 20-24 19.634999999999998 28.634999999999998 27.575 24.154999999999998 25-29 20.375 28.975 27.655 22.994999999999997 30-34 20.455000000000002 27.99 27.650000000000002 23.905 35-39 20.34 28.735 27.24 23.685000000000002 40-44 19.965 27.894999999999996 28.23 23.91 45-49 20.315 28.01 27.889999999999997 23.785 50-54 20.985 28.15 27.575 23.29 55-59 20.275000000000002 28.13 27.565 24.03 60-64 20.405 28.38 27.415 23.799999999999997 65-69 20.974999999999998 27.800000000000004 27.165 24.060000000000002 70-74 20.72 27.474999999999998 27.61 24.195 75-79 21.105 27.93 27.384999999999998 23.580000000000002 80-84 20.635 27.48 28.1 23.785 85-89 20.82 27.925 27.639999999999997 23.615 90-94 20.57 28.365000000000002 27.33 23.735 95-99 20.655 27.55 27.96 23.835 100-104 20.94 27.860000000000003 27.560000000000002 23.64 105-109 20.615 27.944999999999997 27.544999999999998 23.895 110-114 20.64 28.625 27.175 23.56 115-119 20.855 27.37 27.675 24.099999999999998 120-124 20.435 27.67 27.689999999999998 24.205 125-129 20.59 27.66 27.384999999999998 24.365000000000002 130-134 21.060000000000002 27.765 27.794999999999998 23.380000000000003 135-139 20.72 27.72 27.87 23.69 140-144 21.07 27.825 27.74 23.365 145-149 20.815 27.450000000000003 27.815 23.919999999999998 150-151 21.0125 27.900000000000002 27.375 23.7125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 2.0 24 2.0 25 2.0 26 5.5 27 6.5 28 7.5 29 8.5 30 11.5 31 17.0 32 28.0 33 41.5 34 43.5 35 58.0 36 77.5 37 93.5 38 127.0 39 140.0 40 160.0 41 207.0 42 245.5 43 262.5 44 268.5 45 271.5 46 290.0 47 281.0 48 237.0 49 223.5 50 195.0 51 153.5 52 123.5 53 98.0 54 77.5 55 63.5 56 44.5 57 29.5 58 27.0 59 17.5 60 13.0 61 11.5 62 6.5 63 6.0 64 4.5 65 1.0 66 1.5 67 2.0 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1375 0.0 0.0 0.0 0.0 102-103 0.1875 0.0 0.0 0.0 0.0 104-105 0.2625 0.0 0.0 0.0 0.0 106-107 0.3375 0.0 0.0 0.0 0.0 108-109 0.4375 0.0 0.0 0.0 0.0 110-111 0.5 0.0 0.0 0.0 0.0 112-113 0.5625 0.0 0.0 0.0 0.0 114-115 0.675 0.0 0.0 0.0 0.0 116-117 0.8125 0.0 0.0 0.0 0.0 118-119 0.9125000000000001 0.0 0.0 0.0 0.0 120-121 1.025 0.0 0.0 0.0 0.0 122-123 1.1375000000000002 0.0 0.0 0.0 0.0 124-125 1.2999999999999998 0.0 0.0 0.0 0.0 126-127 1.5125000000000002 0.0 0.0 0.0 0.0 128-129 1.7125 0.0 0.0 0.0 0.0 130-131 1.875 0.0 0.0 0.0 0.0 132-133 2.1125 0.0 0.0 0.0 0.0 134-135 2.4000000000000004 0.0 0.0 0.0 0.0 136-137 2.625 0.0 0.0 0.0 0.0 138-139 2.8875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACTTGA 10 0.006830828 145.0 4 >>END_MODULE SRR7171911 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171911_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.82275 33.0 33.0 34.0 32.0 34.0 2 32.88225 33.0 33.0 34.0 32.0 34.0 3 32.90375 34.0 33.0 34.0 32.0 34.0 4 32.91625 34.0 33.0 34.0 32.0 34.0 5 32.86475 34.0 33.0 34.0 32.0 34.0 6 36.972 38.0 38.0 38.0 36.0 38.0 7 37.04875 38.0 38.0 38.0 36.0 38.0 8 36.9395 38.0 38.0 38.0 36.0 38.0 9 36.93375 38.0 38.0 38.0 36.0 38.0 10-14 36.9708 38.0 38.0 38.0 36.2 38.0 15-19 36.96554999999999 38.0 38.0 38.0 36.0 38.0 20-24 36.94780000000001 38.0 38.0 38.0 36.0 38.0 25-29 36.92195 38.0 38.0 38.0 36.0 38.0 30-34 36.87735 38.0 38.0 38.0 36.0 38.0 35-39 36.63895000000001 38.0 38.0 38.0 35.6 38.0 40-44 36.2652 38.0 38.0 38.0 34.2 38.0 45-49 36.675250000000005 38.0 38.0 38.0 34.6 38.0 50-54 36.73855 38.0 38.0 38.0 35.0 38.0 55-59 36.71565 38.0 38.0 38.0 35.4 38.0 60-64 36.69585 38.0 38.0 38.0 35.0 38.0 65-69 36.53135 38.0 38.0 38.0 34.4 38.0 70-74 36.43150000000001 38.0 38.0 38.0 34.0 38.0 75-79 36.45095 38.0 38.0 38.0 34.0 38.0 80-84 36.400549999999996 38.0 38.0 38.0 34.0 38.0 85-89 36.24745 38.0 38.0 38.0 34.0 38.0 90-94 36.1462 38.0 37.2 38.0 33.2 38.0 95-99 35.98575 38.0 37.4 38.0 32.6 38.0 100-104 35.84465 38.0 37.0 38.0 31.2 38.0 105-109 35.708850000000005 38.0 37.0 38.0 31.2 38.0 110-114 35.528949999999995 38.0 36.8 38.0 30.2 38.0 115-119 35.3883 38.0 36.0 38.0 29.8 38.0 120-124 35.1757 38.0 36.0 38.0 29.0 38.0 125-129 34.81505 38.0 35.8 38.0 27.6 38.0 130-134 34.4342 38.0 35.0 38.0 25.4 38.0 135-139 34.19775 38.0 35.0 38.0 24.2 38.0 140-144 33.828950000000006 38.0 34.8 38.0 22.4 38.0 145-149 32.94985 38.0 34.0 38.0 14.4 38.0 150-151 29.5965 36.0 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 6.0 4 2.0 5 1.0 6 1.0 7 1.0 8 1.0 9 1.0 10 2.0 11 1.0 12 2.0 13 1.0 14 2.0 15 3.0 16 2.0 17 3.0 18 4.0 19 6.0 20 13.0 21 9.0 22 5.0 23 13.0 24 12.0 25 23.0 26 19.0 27 32.0 28 40.0 29 46.0 30 53.0 31 66.0 32 96.0 33 118.0 34 174.0 35 303.0 36 718.0 37 2219.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.5 18.925 13.325000000000001 23.25 2 24.375 24.775 31.874999999999996 18.975 3 19.900000000000002 28.275 31.125000000000004 20.7 4 24.825 34.375 22.325 18.475 5 23.974999999999998 36.15 21.475 18.4 6 19.85 37.625 23.200000000000003 19.325 7 20.200000000000003 18.625 40.849999999999994 20.325 8 21.05 23.35 27.35 28.249999999999996 9 22.85 23.474999999999998 28.275 25.4 10-14 22.869999999999997 29.244999999999997 26.185000000000002 21.7 15-19 23.015 28.57 27.084999999999997 21.33 20-24 22.765 28.405 27.250000000000004 21.58 25-29 23.565 28.205000000000002 26.865 21.365000000000002 30-34 23.152364273204903 28.521391043282463 27.005253940455344 21.320990743057294 35-39 23.367870435569863 28.030379237501258 27.54250075445126 21.05924957247762 40-44 23.971042373310382 28.441249430466257 26.735179466410163 20.852528729813194 45-49 23.43 28.12 27.384999999999998 21.065 50-54 23.465 28.435 27.134999999999998 20.965 55-59 24.03 27.644999999999996 27.02 21.305 60-64 22.759999999999998 28.38 27.084999999999997 21.775 65-69 23.235 28.645 27.005000000000003 21.115000000000002 70-74 23.885 28.449999999999996 27.169999999999998 20.495 75-79 23.765 27.76 27.310000000000002 21.165 80-84 23.505000000000003 28.360000000000003 26.85 21.285 85-89 23.669999999999998 27.765 27.76 20.805 90-94 23.385 28.49 27.27 20.855 95-99 23.89 27.715 27.765 20.630000000000003 100-104 24.16 28.15 26.82 20.87 105-109 24.03 27.175 27.915 20.880000000000003 110-114 23.494999999999997 28.365000000000002 27.24 20.9 115-119 23.885 28.12 27.055 20.94 120-124 24.065 26.834999999999997 28.084999999999997 21.015 125-129 23.990000000000002 27.61 27.384999999999998 21.015 130-134 24.215 27.765 27.41 20.61 135-139 24.4 28.189999999999998 26.735 20.674999999999997 140-144 23.86 27.925 27.339999999999996 20.875 145-149 24.555 27.689999999999998 27.575 20.18 150-151 24.55 27.750000000000004 27.450000000000003 20.25 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 0.5 24 0.5 25 2.0 26 2.5 27 2.5 28 3.0 29 2.5 30 3.5 31 11.5 32 19.5 33 23.5 34 28.0 35 35.5 36 56.5 37 90.0 38 116.5 39 156.5 40 190.0 41 235.0 42 273.0 43 283.0 44 301.0 45 301.5 46 292.5 47 271.0 48 261.0 49 227.0 50 167.0 51 148.0 52 124.5 53 100.5 54 79.5 55 52.5 56 36.0 57 27.0 58 22.5 59 11.5 60 10.5 61 10.5 62 5.5 63 3.5 64 3.5 65 2.0 66 0.5 67 0.0 68 1.0 69 1.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.075 35-39 0.59 40-44 1.2349999999999999 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1375 0.0 0.0 0.0 0.0 102-103 0.21250000000000002 0.0 0.0 0.0 0.0 104-105 0.2875 0.0 0.0 0.0 0.0 106-107 0.3625 0.0 0.0 0.0 0.0 108-109 0.4625 0.0 0.0 0.0 0.0 110-111 0.525 0.0 0.0 0.0 0.0 112-113 0.5874999999999999 0.0 0.0 0.0 0.0 114-115 0.7 0.0 0.0 0.0 0.0 116-117 0.8375 0.0 0.0 0.0 0.0 118-119 0.9375 0.0 0.0 0.0 0.0 120-121 1.0499999999999998 0.0 0.0 0.0 0.0 122-123 1.1375000000000002 0.0 0.0 0.0 0.0 124-125 1.2999999999999998 0.0 0.0 0.0 0.0 126-127 1.5125000000000002 0.0 0.0 0.0 0.0 128-129 1.7 0.0 0.0 0.0 0.0 130-131 1.85 0.0 0.0 0.0 0.0 132-133 2.0875 0.0 0.0 0.0 0.0 134-135 2.4000000000000004 0.0 0.0 0.0 0.0 136-137 2.625 0.0 0.0 0.0 0.0 138-139 2.8875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGGAGT 10 0.006846698 144.88751 3 >>END_MODULE Read 765311 spots for SRR7171911.sra Written 765311 spots for SRR7171911.sra Read 765311 spots for SRR7171911.sra Written 765311 spots for SRR7171911.sra Read 765311 spots for SRR7171911.sra Written 765311 spots for SRR7171911.sra Read 765311 spots for SRR7171911.sra Written 765311 spots for SRR7171911.sra Read 765311 spots for SRR7171911.sra Written 765311 spots for SRR7171911.sra Read 765311 spots for SRR7171911.sra Written 765311 spots for SRR7171911.sra Read 765311 spots for SRR7171911.sra Written 765311 spots for SRR7171911.sra Read 765311 spots for SRR7171911.sra Written 765311 spots for SRR7171911.sra Read 765311 spots for SRR7171911.sra Written 765311 spots for SRR7171911.sra Read 765311 spots for SRR7171911.sra Written 765311 spots for SRR7171911.sra Read 765311 spots for SRR7171911.sra Written 765311 spots for SRR7171911.sra Read 765328 spots for SRR7171911.sra Written 765328 spots for SRR7171911.sra Read 765311 spots for SRR7171911.sra Written 765311 spots for SRR7171911.sra Read 765311 spots for SRR7171911.sra Written 765311 spots for SRR7171911.sra Read 765311 spots for SRR7171911.sra Written 765311 spots for SRR7171911.sra Read 765311 spots for SRR7171911.sra Written 765311 spots for SRR7171911.sra Read 765311 spots for SRR7171911.sra Written 765311 spots for SRR7171911.sra Read 765311 spots for SRR7171911.sra Written 765311 spots for SRR7171911.sra Read 765311 spots for SRR7171911.sra Written 765311 spots for SRR7171911.sra Read 765311 spots for SRR7171911.sra Written 765311 spots for SRR7171911.sra SRR ids: ['SRR7171911.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gide6jmp SRR7171911.sra spots: 15306237 blocks: [[1, 765311], [765312, 1530622], [1530623, 2295933], [2295934, 3061244], [3061245, 3826555], [3826556, 4591866], [4591867, 5357177], [5357178, 6122488], [6122489, 6887799], [6887800, 7653110], [7653111, 8418421], [8418422, 9183732], [9183733, 9949043], [9949044, 10714354], [10714355, 11479665], [11479666, 12244976], [12244977, 13010287], [13010288, 13775598], [13775599, 14540909], [14540910, 15306237]] SRR7171911 file size 5165081 SRR7171911 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171911 SRR7171911_1.fastq SRR7171911_2.fastq Input file: SRR7171911_1.fastq Paired file: SRR7171911_2.fastq trimmed: SRR7171911-trimmed-pair1.fastq, SRR7171911-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 00:48:02 2025 >> started Fri Feb 14 00:48:25 2025 >> done (23.424s) 15306237 read pairs processed; of these: 16700 ( 0.11%) short read pairs filtered out after trimming by size control 11676 ( 0.08%) empty read pairs filtered out after trimming by size control 15277861 (99.81%) read pairs available; of these: 6309960 (41.30%) trimmed read pairs available after processing 8967901 (58.70%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 1 0.00% 20 7 0.00% 21 3 0.00% 22 2 0.00% 23 7 0.00% 24 5 0.00% 25 6 0.00% 26 5 0.00% 27 1 0.00% 28 7 0.00% 29 7 0.00% 30 4 0.00% 31 1 0.00% 32 9 0.00% 33 5 0.00% 34 4 0.00% 35 4 0.00% 36 9 0.00% 37 5 0.00% 38 7 0.00% 39 6 0.00% 40 8 0.00% 41 9 0.00% 42 7 0.00% 43 10 0.00% 44 7 0.00% 45 8 0.00% 46 8 0.00% 47 8 0.00% 48 15 0.00% 49 14 0.00% 50 19 0.00% 51 23 0.00% 52 24 0.00% 53 35 0.00% 54 29 0.00% 55 31 0.00% 56 50 0.00% 57 37 0.00% 58 47 0.00% 59 55 0.00% 60 63 0.00% 61 64 0.00% 62 89 0.00% 63 92 0.00% 64 112 0.00% 65 101 0.00% 66 110 0.00% 67 153 0.00% 68 155 0.00% 69 184 0.00% 70 205 0.00% 71 233 0.00% 72 242 0.00% 73 304 0.00% 74 337 0.00% 75 411 0.00% 76 475 0.00% 77 505 0.00% 78 537 0.00% 79 658 0.00% 80 765 0.01% 81 934 0.01% 82 961 0.01% 83 1161 0.01% 84 1989 0.01% 85 2632 0.02% 86 2771 0.02% 87 3368 0.02% 88 3254 0.02% 89 3279 0.02% 90 3349 0.02% 91 3612 0.02% 92 3813 0.02% 93 4004 0.03% 94 4336 0.03% 95 4461 0.03% 96 4786 0.03% 97 5144 0.03% 98 5318 0.03% 99 5773 0.04% 100 6116 0.04% 101 6542 0.04% 102 7005 0.05% 103 7380 0.05% 104 8084 0.05% 105 8493 0.06% 106 9098 0.06% 107 9389 0.06% 108 10051 0.07% 109 10391 0.07% 110 11251 0.07% 111 12005 0.08% 112 12454 0.08% 113 13256 0.09% 114 13945 0.09% 115 14919 0.10% 116 15426 0.10% 117 16349 0.11% 118 17201 0.11% 119 17878 0.12% 120 18795 0.12% 121 19456 0.13% 122 20431 0.13% 123 21595 0.14% 124 22524 0.15% 125 24051 0.16% 126 25217 0.17% 127 26573 0.17% 128 27765 0.18% 129 29242 0.19% 130 30657 0.20% 131 32273 0.21% 132 34688 0.23% 133 36906 0.24% 134 39682 0.26% 135 42049 0.28% 136 46108 0.30% 137 48456 0.32% 138 52272 0.34% 139 56823 0.37% 140 61554 0.40% 141 68129 0.45% 142 77125 0.50% 143 88794 0.58% 144 104341 0.68% 145 125439 0.82% 146 162357 1.06% 147 222057 1.45% 148 346811 2.27% 149 705348 4.62% 150 3393917 22.21% 151 8967901 58.70% 15277861 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=4.30 fanout-score-rank=22 prefix-density=0.29 prefix-fanout=3.2 sequence=AAGGATCTCTCTCCTTTAACG criterion=fanout-score sequence-density=0.09 sequence-density-rank=27 fanout-score=377.33 fanout-score-rank=1 prefix-density=1.01 prefix-fanout=35.3 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=7.65 fanout-score-rank=15 prefix-density=0.30 prefix-fanout=4.7 sequence=CAAGGATTTTGGCCCACAGCCTACTGCTACATCTTATGACAA criterion=fanout-score sequence-density=0.09 sequence-density-rank=22 fanout-score=112.68 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=20.9 sequence=CAAAGAAGAAGAT SRR7171911 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 00:49:11 Started mapping on | Feb 14 00:49:11 Finished on | Feb 14 00:50:50 Mapping speed, Million of reads per hour | 555.56 Number of input reads | 15277861 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 14386512 Uniquely mapped reads % | 94.17% Average mapped length | 296.44 Number of splices: Total | 15120386 Number of splices: Annotated (sjdb) | 14897626 Number of splices: GT/AG | 14888645 Number of splices: GC/AG | 190458 Number of splices: AT/AC | 10523 Number of splices: Non-canonical | 30760 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.68 Insertion rate per base | 0.02% Insertion average length | 2.64 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 374278 % of reads mapped to multiple loci | 2.45% Number of reads mapped to too many loci | 33437 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.11% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 534214 534214 534214 N_multimapping 374278 374278 374278 N_noFeature 253919 14256620 318177 N_ambiguous 134065 820 67877 UnstrandedReadsAssigned:13998528 PositiveStrandReadsAssigned:129072 NegativeStrandReadsAssigned:14000458 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7171911 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171911-trimmed-pair1.fastq SRR7171911-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,277,861 reads, 13,872,823 reads pseudoaligned [quant] estimated average fragment length: 255.709 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,177 rounds 52401 SRR7171911.ke.tsv 34699 SRR7171911.se.tsv 87100 total ==> SRR7171911.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1763.29 803 30.8042 Potri.005G024800.1.v4.1 1035 780.291 154 13.35 Potri.004G059700.1.v4.1 961 706.309 20 1.91537 Potri.007G009000.2.v4.1 1416 1161.29 0 0 Potri.003G141000.2.v4.1 2943 2688.29 385.21 9.6926 Potri.016G087400.1.v4.1 270 69.1258 1140 1115.53 Potri.015G069301.1.v4.1 564 313.078 0 0 Potri.010G195200.1.v4.1 1773 1518.29 175.796 7.83198 Potri.012G127500.1.v4.1 977 722.297 2916 273.08 ==> SRR7171911.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 18 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 219 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 8 Potri.001G452600.v4.1 141 SRR7171911 completed mapping pipeline successfully