Starting /dee2/code/volunteer_pipeline.sh SRR7171912 current disk space = 3087994204160 free memory = 1495862928 SRR7171912 SRAfilesize 8e7296dc104b6c61b0bd163ce482f5d9 SRR7171912.sra SRR7171912.sra file validated SRR7171912 is paired end SRR7171912 is conventional basespace SRR7171912 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171912_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.655 18.0 18.0 33.0 18.0 33.0 2 26.58675 27.0 25.0 31.0 18.0 33.0 3 29.7225 30.0 29.0 33.0 27.0 33.0 4 31.028 33.0 31.0 33.0 29.0 33.0 5 31.32675 32.0 32.0 33.0 28.0 33.0 6 34.82275 37.0 34.0 38.0 29.0 38.0 7 35.3035 37.0 34.0 38.0 30.0 38.0 8 36.3525 38.0 37.0 38.0 33.0 38.0 9 37.01525 38.0 38.0 38.0 35.0 38.0 10-14 37.37015 38.0 38.0 38.0 36.8 38.0 15-19 37.4739 38.0 38.0 38.0 37.0 38.0 20-24 37.48884999999999 38.0 38.0 38.0 37.0 38.0 25-29 37.506699999999995 38.0 38.0 38.0 37.4 38.0 30-34 37.49655 38.0 38.0 38.0 37.2 38.0 35-39 37.4838 38.0 38.0 38.0 37.0 38.0 40-44 37.44075 38.0 38.0 38.0 37.0 38.0 45-49 37.418150000000004 38.0 38.0 38.0 37.0 38.0 50-54 37.33710000000001 38.0 38.0 38.0 37.0 38.0 55-59 37.2931 38.0 38.0 38.0 36.4 38.0 60-64 37.2689 38.0 38.0 38.0 36.4 38.0 65-69 37.2242 38.0 38.0 38.0 36.2 38.0 70-74 37.124900000000004 38.0 38.0 38.0 36.0 38.0 75-79 37.099450000000004 38.0 38.0 38.0 36.0 38.0 80-84 37.06485 38.0 38.0 38.0 36.0 38.0 85-89 37.07469999999999 38.0 38.0 38.0 36.0 38.0 90-94 36.858450000000005 38.0 38.0 38.0 35.4 38.0 95-99 36.8562 38.0 38.0 38.0 35.0 38.0 100-104 36.678599999999996 38.0 38.0 38.0 34.6 38.0 105-109 36.64254999999999 38.0 38.0 38.0 34.4 38.0 110-114 36.51255 38.0 38.0 38.0 34.0 38.0 115-119 36.316199999999995 38.0 37.4 38.0 33.8 38.0 120-124 36.18305 38.0 37.0 38.0 33.0 38.0 125-129 36.049800000000005 38.0 36.8 38.0 33.0 38.0 130-134 35.7054 38.0 36.2 38.0 31.4 38.0 135-139 35.49945 38.0 36.0 38.0 30.6 38.0 140-144 35.21665 38.0 36.0 38.0 30.4 38.0 145-149 34.63485000000001 38.0 35.0 38.0 28.0 38.0 150-151 31.555750000000003 36.5 31.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 3.0 17 0.0 18 1.0 19 3.0 20 2.0 21 2.0 22 0.0 23 3.0 24 9.0 25 10.0 26 10.0 27 9.0 28 17.0 29 17.0 30 41.0 31 40.0 32 56.0 33 119.0 34 130.0 35 289.0 36 924.0 37 2312.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.55 11.1 11.35 34.0 2 21.85 15.425 39.6 23.125 3 19.45 25.35 25.35 29.849999999999998 4 23.799999999999997 33.375 19.950000000000003 22.875 5 21.725 34.975 24.775 18.525 6 18.125 35.55 26.724999999999998 19.6 7 14.075 21.4 44.224999999999994 20.3 8 17.175 22.400000000000002 31.874999999999996 28.549999999999997 9 18.5 22.825 32.9 25.775 10-14 20.349999999999998 29.225 26.384999999999998 24.04 15-19 19.715 28.360000000000003 27.72 24.205 20-24 20.485 27.905 28.205000000000002 23.405 25-29 19.634999999999998 28.77 27.61 23.985 30-34 19.695 29.409999999999997 27.395000000000003 23.5 35-39 19.985 28.095 28.105000000000004 23.815 40-44 20.294999999999998 28.18 28.17 23.355 45-49 20.36 27.855 27.689999999999998 24.095 50-54 20.29 27.955000000000002 27.72 24.035 55-59 20.005 28.18 27.48 24.335 60-64 20.225 28.4 27.644999999999996 23.73 65-69 20.305 28.499999999999996 27.515 23.68 70-74 20.205000000000002 28.060000000000002 27.815 23.919999999999998 75-79 20.330000000000002 27.79 28.205000000000002 23.674999999999997 80-84 20.165 27.889999999999997 27.96 23.985 85-89 19.955000000000002 28.22 28.62 23.205000000000002 90-94 20.31 28.285 27.505000000000003 23.9 95-99 20.805 27.295 28.03 23.87 100-104 20.16 28.46 27.67 23.71 105-109 20.03 28.585 27.6 23.785 110-114 20.53 27.92 27.67 23.880000000000003 115-119 20.72 28.505000000000003 27.21 23.565 120-124 20.055 28.29 27.375 24.279999999999998 125-129 20.380000000000003 27.384999999999998 28.055000000000003 24.18 130-134 20.880000000000003 27.91 27.065 24.145 135-139 20.3 28.1 27.700000000000003 23.9 140-144 20.91 27.365000000000002 28.139999999999997 23.585 145-149 20.595 27.250000000000004 27.82 24.335 150-151 20.375 27.3375 27.8375 24.45 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 3.0 26 5.0 27 7.0 28 7.5 29 10.5 30 13.5 31 18.0 32 30.0 33 37.0 34 41.0 35 65.0 36 83.0 37 93.5 38 130.5 39 171.5 40 196.5 41 214.5 42 239.5 43 268.5 44 286.0 45 286.0 46 284.5 47 266.5 48 233.5 49 217.5 50 193.0 51 140.5 52 103.0 53 82.5 54 67.0 55 55.5 56 35.0 57 21.0 58 19.5 59 19.5 60 14.0 61 10.0 62 7.5 63 4.0 64 4.0 65 3.5 66 2.5 67 2.5 68 1.5 69 1.0 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67385850476668 99.325 2 0.3010536879076769 0.6 3 0.025087807325639738 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.25 0.0 0.0 0.0 0.0 106-107 0.35 0.0 0.0 0.0 0.0 108-109 0.425 0.0 0.0 0.0 0.0 110-111 0.4625 0.0 0.0 0.0 0.0 112-113 0.5 0.0 0.0 0.0 0.0 114-115 0.5625 0.0 0.0 0.0 0.0 116-117 0.6875 0.0 0.0 0.0 0.0 118-119 0.8 0.0 0.0 0.0 0.0 120-121 1.0125 0.0 0.0 0.0 0.0 122-123 1.15 0.0 0.0 0.0 0.0 124-125 1.2125 0.0 0.0 0.0 0.0 126-127 1.3625 0.0 0.0 0.0 0.0 128-129 1.5375 0.0 0.0 0.0 0.0 130-131 1.7375 0.0 0.0 0.0 0.0 132-133 1.9375 0.0 0.0 0.0 0.0 134-135 2.1375 0.0 0.0 0.0 0.0 136-137 2.3125 0.0 0.0 0.0 0.0 138-139 2.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCCGAT 10 0.006830828 145.0 1 >>END_MODULE SRR7171912 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171912_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.03325 33.0 33.0 34.0 32.0 34.0 2 33.08125 34.0 33.0 34.0 32.0 34.0 3 33.2255 34.0 33.0 34.0 33.0 34.0 4 33.1855 34.0 33.0 34.0 33.0 34.0 5 33.19 34.0 33.0 34.0 33.0 34.0 6 37.411 38.0 38.0 38.0 37.0 38.0 7 37.32925 38.0 38.0 38.0 37.0 38.0 8 37.253 38.0 38.0 38.0 37.0 38.0 9 37.30575 38.0 38.0 38.0 37.0 38.0 10-14 37.35164999999999 38.0 38.0 38.0 37.0 38.0 15-19 37.26085 38.0 38.0 38.0 37.0 38.0 20-24 37.275850000000005 38.0 38.0 38.0 37.0 38.0 25-29 37.24965 38.0 38.0 38.0 37.0 38.0 30-34 37.23825000000001 38.0 38.0 38.0 37.0 38.0 35-39 37.054050000000004 38.0 38.0 38.0 37.0 38.0 40-44 36.85045 38.0 38.0 38.0 36.6 38.0 45-49 37.16395 38.0 38.0 38.0 36.8 38.0 50-54 37.1531 38.0 38.0 38.0 36.8 38.0 55-59 37.07155 38.0 38.0 38.0 36.4 38.0 60-64 37.05565 38.0 38.0 38.0 36.0 38.0 65-69 37.032 38.0 38.0 38.0 36.0 38.0 70-74 36.98175 38.0 38.0 38.0 36.0 38.0 75-79 36.89975 38.0 38.0 38.0 35.8 38.0 80-84 36.87010000000001 38.0 38.0 38.0 36.0 38.0 85-89 36.6995 38.0 38.0 38.0 35.0 38.0 90-94 36.63745 38.0 38.0 38.0 34.8 38.0 95-99 36.52969999999999 38.0 38.0 38.0 34.2 38.0 100-104 36.4157 38.0 38.0 38.0 34.0 38.0 105-109 36.27275 38.0 38.0 38.0 34.0 38.0 110-114 36.06465000000001 38.0 37.6 38.0 33.2 38.0 115-119 35.9234 38.0 37.0 38.0 33.0 38.0 120-124 35.7159 38.0 37.0 38.0 32.2 38.0 125-129 35.4959 38.0 36.2 38.0 31.0 38.0 130-134 35.28060000000001 38.0 36.0 38.0 30.2 38.0 135-139 34.99204999999999 38.0 35.4 38.0 29.8 38.0 140-144 34.63875 38.0 35.0 38.0 27.8 38.0 145-149 33.97234999999999 38.0 35.0 38.0 23.6 38.0 150-151 30.797625 36.5 29.5 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 2.0 4 1.0 5 0.0 6 2.0 7 0.0 8 1.0 9 1.0 10 2.0 11 2.0 12 1.0 13 1.0 14 2.0 15 0.0 16 1.0 17 4.0 18 3.0 19 4.0 20 5.0 21 7.0 22 7.0 23 3.0 24 5.0 25 11.0 26 13.0 27 14.0 28 21.0 29 35.0 30 31.0 31 49.0 32 69.0 33 69.0 34 156.0 35 282.0 36 660.0 37 2531.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.95 16.575 14.924999999999999 28.549999999999997 2 22.625 24.9 35.225 17.25 3 21.5 28.1 30.775000000000002 19.625 4 23.400000000000002 35.099999999999994 22.7 18.8 5 23.549999999999997 37.025000000000006 21.85 17.575 6 19.15 36.975 25.1 18.775 7 18.325 17.4 42.375 21.9 8 20.200000000000003 23.45 28.925 27.425 9 21.0 23.95 29.075 25.974999999999998 10-14 23.01 28.615000000000002 26.365 22.009999999999998 15-19 23.565 26.584999999999997 28.33 21.52 20-24 23.46 28.005000000000003 27.224999999999998 21.310000000000002 25-29 22.945 28.285 27.765 21.005 30-34 23.31 28.025 27.834999999999997 20.830000000000002 35-39 22.546951893140506 28.351913226875563 27.684041377925077 21.417093502058854 40-44 23.32761578044597 28.417919483402283 27.787307032590054 20.4671577035617 45-49 23.305 27.625 27.884999999999998 21.185000000000002 50-54 24.22 27.57 27.245 20.965 55-59 23.23 28.084999999999997 27.73 20.955 60-64 24.04 27.705000000000002 27.810000000000002 20.445 65-69 23.77 27.62 27.74 20.87 70-74 24.07 27.955000000000002 26.905 21.07 75-79 23.43 28.33 27.24 21.0 80-84 24.48 28.110000000000003 26.72 20.69 85-89 23.655 27.975 27.915 20.455000000000002 90-94 23.52 28.084999999999997 27.3 21.095 95-99 24.104999999999997 28.23 27.11 20.555 100-104 23.82 28.804999999999996 27.1 20.275000000000002 105-109 23.54 28.605000000000004 27.075 20.78 110-114 23.765 27.98 27.725 20.53 115-119 23.919999999999998 27.589999999999996 27.85 20.64 120-124 24.285 27.439999999999998 27.474999999999998 20.8 125-129 24.03 27.845 27.72 20.405 130-134 23.785 27.639999999999997 27.705000000000002 20.87 135-139 23.845 27.894999999999996 28.09 20.169999999999998 140-144 24.315 27.98 27.12 20.585 145-149 24.365000000000002 28.144999999999996 27.21 20.28 150-151 24.4125 27.787499999999998 27.875 19.925 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 0.0 22 0.5 23 0.5 24 0.5 25 1.5 26 2.5 27 3.0 28 3.5 29 6.5 30 11.5 31 13.0 32 16.5 33 26.5 34 37.0 35 54.0 36 66.0 37 85.0 38 120.0 39 154.0 40 192.5 41 232.0 42 257.0 43 288.5 44 310.5 45 303.5 46 288.0 47 264.5 48 240.5 49 204.5 50 172.5 51 142.5 52 113.5 53 98.5 54 77.5 55 54.0 56 39.0 57 29.5 58 21.0 59 15.5 60 11.0 61 9.0 62 9.5 63 7.5 64 6.0 65 3.0 66 1.0 67 1.5 68 1.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.43 40-44 0.89 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62302085951245 99.1 2 0.2764513696908771 0.5499999999999999 3 0.050263885398341285 0.15 4 0.050263885398341285 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.25 0.0 0.0 0.0 0.0 106-107 0.375 0.0 0.0 0.0 0.0 108-109 0.45 0.0 0.0 0.0 0.0 110-111 0.4875 0.0 0.0 0.0 0.0 112-113 0.525 0.0 0.0 0.0 0.0 114-115 0.5875 0.0 0.0 0.0 0.0 116-117 0.7125 0.0 0.0 0.0 0.0 118-119 0.825 0.0 0.0 0.0 0.0 120-121 1.0375 0.0 0.0 0.0 0.0 122-123 1.175 0.0 0.0 0.0 0.0 124-125 1.2375 0.0 0.0 0.0 0.0 126-127 1.3875 0.0 0.0 0.0 0.0 128-129 1.5625 0.0 0.0 0.0 0.0 130-131 1.7625 0.0 0.0 0.0 0.0 132-133 1.9874999999999998 0.0 0.0 0.0 0.0 134-135 2.1875 0.0 0.0 0.0 0.0 136-137 2.3625 0.0 0.0 0.0 0.0 138-139 2.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGATCC 10 0.006843168 144.91249 1 >>END_MODULE Read 811483 spots for SRR7171912.sra Written 811483 spots for SRR7171912.sra Read 811483 spots for SRR7171912.sra Written 811483 spots for SRR7171912.sra Read 811483 spots for SRR7171912.sra Written 811483 spots for SRR7171912.sra Read 811483 spots for SRR7171912.sra Written 811483 spots for SRR7171912.sra Read 811483 spots for SRR7171912.sra Written 811483 spots for SRR7171912.sra Read 811483 spots for SRR7171912.sra Written 811483 spots for SRR7171912.sra Read 811483 spots for SRR7171912.sra Written 811483 spots for SRR7171912.sra Read 811483 spots for SRR7171912.sra Written 811483 spots for SRR7171912.sra Read 811483 spots for SRR7171912.sra Written 811483 spots for SRR7171912.sra Read 811483 spots for SRR7171912.sra Written 811483 spots for SRR7171912.sra Read 811483 spots for SRR7171912.sra Written 811483 spots for SRR7171912.sra Read 811483 spots for SRR7171912.sra Written 811483 spots for SRR7171912.sra Read 811483 spots for SRR7171912.sra Written 811483 spots for SRR7171912.sra Read 811483 spots for SRR7171912.sra Written 811483 spots for SRR7171912.sra Read 811483 spots for SRR7171912.sra Written 811483 spots for SRR7171912.sra Read 811483 spots for SRR7171912.sra Written 811483 spots for SRR7171912.sra Read 811483 spots for SRR7171912.sra Written 811483 spots for SRR7171912.sra Read 811483 spots for SRR7171912.sra Written 811483 spots for SRR7171912.sra Read 811491 spots for SRR7171912.sra Written 811491 spots for SRR7171912.sra Read 811483 spots for SRR7171912.sra Written 811483 spots for SRR7171912.sra SRR ids: ['SRR7171912.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_44lsahfq SRR7171912.sra spots: 16229668 blocks: [[1, 811483], [811484, 1622966], [1622967, 2434449], [2434450, 3245932], [3245933, 4057415], [4057416, 4868898], [4868899, 5680381], [5680382, 6491864], [6491865, 7303347], [7303348, 8114830], [8114831, 8926313], [8926314, 9737796], [9737797, 10549279], [10549280, 11360762], [11360763, 12172245], [12172246, 12983728], [12983729, 13795211], [13795212, 14606694], [14606695, 15418177], [15418178, 16229668]] SRR7171912 file size 5478001 SRR7171912 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171912 SRR7171912_1.fastq SRR7171912_2.fastq Input file: SRR7171912_1.fastq Paired file: SRR7171912_2.fastq trimmed: SRR7171912-trimmed-pair1.fastq, SRR7171912-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 02:06:17 2025 >> started Fri Feb 14 02:06:34 2025 >> done (17.378s) 16229668 read pairs processed; of these: 10873 ( 0.07%) short read pairs filtered out after trimming by size control 6948 ( 0.04%) empty read pairs filtered out after trimming by size control 16211847 (99.89%) read pairs available; of these: 6276972 (38.72%) trimmed read pairs available after processing 9934875 (61.28%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 1 0.00% 20 1 0.00% 21 2 0.00% 22 2 0.00% 23 1 0.00% 24 3 0.00% 25 0 0.00% 26 3 0.00% 27 3 0.00% 28 2 0.00% 29 2 0.00% 30 2 0.00% 31 2 0.00% 32 3 0.00% 33 4 0.00% 34 4 0.00% 35 3 0.00% 36 0 0.00% 37 5 0.00% 38 2 0.00% 39 2 0.00% 40 8 0.00% 41 5 0.00% 42 0 0.00% 43 7 0.00% 44 7 0.00% 45 11 0.00% 46 11 0.00% 47 11 0.00% 48 4 0.00% 49 13 0.00% 50 12 0.00% 51 10 0.00% 52 16 0.00% 53 20 0.00% 54 26 0.00% 55 16 0.00% 56 32 0.00% 57 25 0.00% 58 30 0.00% 59 53 0.00% 60 60 0.00% 61 44 0.00% 62 62 0.00% 63 68 0.00% 64 79 0.00% 65 73 0.00% 66 93 0.00% 67 135 0.00% 68 105 0.00% 69 128 0.00% 70 165 0.00% 71 184 0.00% 72 219 0.00% 73 246 0.00% 74 298 0.00% 75 303 0.00% 76 379 0.00% 77 416 0.00% 78 443 0.00% 79 484 0.00% 80 527 0.00% 81 640 0.00% 82 750 0.00% 83 886 0.01% 84 1463 0.01% 85 1905 0.01% 86 1990 0.01% 87 2402 0.01% 88 2328 0.01% 89 2508 0.02% 90 2648 0.02% 91 2728 0.02% 92 3067 0.02% 93 3157 0.02% 94 3350 0.02% 95 3580 0.02% 96 3700 0.02% 97 4247 0.03% 98 4227 0.03% 99 4452 0.03% 100 4878 0.03% 101 5107 0.03% 102 5498 0.03% 103 5753 0.04% 104 6330 0.04% 105 6792 0.04% 106 7083 0.04% 107 7502 0.05% 108 8027 0.05% 109 8458 0.05% 110 8963 0.06% 111 9794 0.06% 112 9992 0.06% 113 10671 0.07% 114 11222 0.07% 115 11802 0.07% 116 12507 0.08% 117 13016 0.08% 118 13838 0.09% 119 14244 0.09% 120 15101 0.09% 121 15919 0.10% 122 16391 0.10% 123 17474 0.11% 124 18471 0.11% 125 19246 0.12% 126 20370 0.13% 127 21522 0.13% 128 22721 0.14% 129 23792 0.15% 130 25392 0.16% 131 26668 0.16% 132 28094 0.17% 133 30203 0.19% 134 32333 0.20% 135 35018 0.22% 136 37756 0.23% 137 40603 0.25% 138 43758 0.27% 139 48233 0.30% 140 52975 0.33% 141 58787 0.36% 142 66706 0.41% 143 75947 0.47% 144 91880 0.57% 145 110337 0.68% 146 144806 0.89% 147 204164 1.26% 148 325531 2.01% 149 689227 4.25% 150 3681164 22.71% 151 9934875 61.28% 16211847 reads passed initial QC criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=2.82 fanout-score-rank=25 prefix-density=0.79 prefix-fanout=2.0 sequence=CACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.10 sequence-density-rank=25 fanout-score=53.87 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=14.5 sequence=TTCTCATCAAGGTACTTCTCCGGGATAACAGGCTTGATGACA criterion=sequence-density sequence-density=0.81 sequence-density-rank=1 fanout-score=2.77 fanout-score-rank=21 prefix-density=0.83 prefix-fanout=2.7 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=30.80 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=5.8 sequence=GGATCTGTTTAATTTGAGACAGAAAACATGAAATCCTCCTACACTTTCTTCATTCTTTTCTCACTCTTTTCGTTTGCTAACGTGATCGGTGCTAGAAAAGACACTGGAGAGTATTGGAGAGCTGTCATGAAAGATCAGCCCATGCCAGAAGCAATACATGGCCTTATTCGCGAAACCACATTGTCATCAGTCTCCAATGAGAAAGCCGATTGCCACACAACCGAGTCCAATGAAAAGAATAATTTTGTCAAGGATTTTGGCCCACAGCCTACTGCTACATCTTATGACAATGGTATAAAACCAGCAAAAGATAAGTCCTTTTCGAAACATTTCCACCCAAACTCTCAGTTGTTCCTTTACAATGATGGTGACGTTAAAGGAGAGAGATCCTTCGCTGAAGATGTTGAGCCGAGGCCTAATGTGTCCGTTTACCACGACGACGCTACTCTTAAAGGAGAAAAATCTTTTCAGGAGGACTTCGAACCAGGACCTAACATATCAGTTTATGATG SRR7171912 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 02:07:18 Started mapping on | Feb 14 02:07:18 Finished on | Feb 14 02:09:13 Mapping speed, Million of reads per hour | 507.50 Number of input reads | 16211847 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 15134196 Uniquely mapped reads % | 93.35% Average mapped length | 297.39 Number of splices: Total | 15568685 Number of splices: Annotated (sjdb) | 15292158 Number of splices: GT/AG | 15325625 Number of splices: GC/AG | 194025 Number of splices: AT/AC | 11255 Number of splices: Non-canonical | 37780 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.64 Insertion rate per base | 0.02% Insertion average length | 2.57 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 430171 % of reads mapped to multiple loci | 2.65% Number of reads mapped to too many loci | 55533 % of reads mapped to too many loci | 0.34% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.57% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 659860 659860 659860 N_multimapping 430171 430171 430171 N_noFeature 345602 14993759 405721 N_ambiguous 158955 889 78081 UnstrandedReadsAssigned:14629639 PositiveStrandReadsAssigned:139548 NegativeStrandReadsAssigned:14650394 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7171912 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171912-trimmed-pair1.fastq SRR7171912-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,211,847 reads, 14,487,171 reads pseudoaligned [quant] estimated average fragment length: 265.501 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,121 rounds 52401 SRR7171912.ke.tsv 34699 SRR7171912.se.tsv 87100 total ==> SRR7171912.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1753.5 1244 42.6561 Potri.005G024800.1.v4.1 1035 770.499 307 23.957 Potri.004G059700.1.v4.1 961 696.521 24 2.07178 Potri.007G009000.2.v4.1 1416 1151.5 0 0 Potri.003G141000.2.v4.1 2943 2678.5 623 13.985 Potri.016G087400.1.v4.1 270 65.1142 1095 1011.12 Potri.015G069301.1.v4.1 564 304.33 0 0 Potri.010G195200.1.v4.1 1773 1508.5 474.633 18.9182 Potri.012G127500.1.v4.1 977 712.505 2565 216.454 ==> SRR7171912.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 40 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 621 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 324 SRR7171912 completed mapping pipeline successfully