Starting /dee2/code/volunteer_pipeline.sh SRR7171913 current disk space = 3112422219776 free memory = 1573133156 SRR7171913 SRAfilesize e8b9f755870909581398e36cc6316cab SRR7171913.sra SRR7171913.sra file validated SRR7171913 is paired end SRR7171913 is conventional basespace SRR7171913 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171913_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.74475 33.0 33.0 34.0 32.0 34.0 2 32.16675 33.0 33.0 34.0 29.0 34.0 3 32.8815 33.0 33.0 34.0 31.0 34.0 4 32.10725 33.0 33.0 34.0 31.0 34.0 5 32.521 33.0 33.0 34.0 31.0 34.0 6 36.65325 38.0 37.0 38.0 34.0 38.0 7 37.302 38.0 38.0 38.0 36.0 38.0 8 37.41275 38.0 38.0 38.0 37.0 38.0 9 37.5295 38.0 38.0 38.0 37.0 38.0 10-14 37.478750000000005 38.0 38.0 38.0 37.0 38.0 15-19 37.5141 38.0 38.0 38.0 37.6 38.0 20-24 37.4898 38.0 38.0 38.0 37.4 38.0 25-29 37.45885 38.0 38.0 38.0 37.2 38.0 30-34 37.44855 38.0 38.0 38.0 37.0 38.0 35-39 37.414300000000004 38.0 38.0 38.0 37.0 38.0 40-44 37.41180000000001 38.0 38.0 38.0 37.0 38.0 45-49 37.3585 38.0 38.0 38.0 37.0 38.0 50-54 37.333999999999996 38.0 38.0 38.0 36.8 38.0 55-59 37.271699999999996 38.0 38.0 38.0 36.8 38.0 60-64 37.2586 38.0 38.0 38.0 36.4 38.0 65-69 37.19285 38.0 38.0 38.0 36.2 38.0 70-74 37.11865 38.0 38.0 38.0 36.0 38.0 75-79 37.11300000000001 38.0 38.0 38.0 36.0 38.0 80-84 37.0152 38.0 38.0 38.0 36.0 38.0 85-89 36.97995 38.0 38.0 38.0 35.6 38.0 90-94 36.86535 38.0 38.0 38.0 35.0 38.0 95-99 36.79615 38.0 38.0 38.0 35.0 38.0 100-104 36.70784999999999 38.0 38.0 38.0 34.8 38.0 105-109 36.5911 38.0 38.0 38.0 34.2 38.0 110-114 36.4039 38.0 37.8 38.0 34.0 38.0 115-119 36.3849 38.0 37.6 38.0 34.0 38.0 120-124 36.209500000000006 38.0 37.4 38.0 33.4 38.0 125-129 36.04785 38.0 36.8 38.0 33.0 38.0 130-134 35.7412 38.0 36.2 38.0 31.2 38.0 135-139 35.48225 38.0 36.0 38.0 31.0 38.0 140-144 35.2033 38.0 36.0 38.0 30.2 38.0 145-149 34.7457 38.0 35.2 38.0 29.2 38.0 150-151 31.723875 36.5 31.5 38.0 14.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 0.0 14 1.0 15 1.0 16 0.0 17 0.0 18 1.0 19 2.0 20 2.0 21 3.0 22 1.0 23 5.0 24 8.0 25 10.0 26 4.0 27 16.0 28 24.0 29 24.0 30 32.0 31 44.0 32 61.0 33 95.0 34 148.0 35 223.0 36 634.0 37 2660.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.1 13.950000000000001 10.8 36.15 2 20.305076269067268 19.554888722180543 37.35933983495874 22.780695173793447 3 18.975 26.575 26.3 28.15 4 22.95 34.449999999999996 21.525 21.075 5 22.35 35.85 23.625 18.175 6 16.3 36.975 26.05 20.674999999999997 7 12.9 22.475 44.875 19.75 8 18.2 22.35 30.55 28.9 9 18.35 22.775000000000002 32.125 26.75 10-14 19.919999999999998 29.609999999999996 26.555 23.915 15-19 20.165 28.89 27.355 23.59 20-24 19.865 28.945 27.71 23.48 25-29 19.915 29.01 27.634999999999998 23.44 30-34 19.91 28.43 27.715 23.945 35-39 20.13 29.085 27.400000000000002 23.385 40-44 20.119999999999997 28.79 27.145000000000003 23.945 45-49 19.825 28.694999999999997 27.565 23.915 50-54 19.744999999999997 28.749999999999996 27.97 23.535 55-59 20.24 29.29 27.345000000000002 23.125 60-64 20.665 28.599999999999998 27.415 23.32 65-69 20.465 29.154999999999998 26.924999999999997 23.455000000000002 70-74 20.385 28.63 27.375 23.61 75-79 20.385 28.310000000000002 27.779999999999998 23.525 80-84 20.705000000000002 28.194999999999997 27.735 23.365 85-89 20.68 28.694999999999997 27.01 23.615 90-94 20.810000000000002 28.494999999999997 27.055 23.64 95-99 20.565 28.26 27.900000000000002 23.275000000000002 100-104 20.645 28.365000000000002 28.055000000000003 22.935 105-109 20.565 27.810000000000002 27.57 24.055 110-114 20.49 28.560000000000002 27.58 23.369999999999997 115-119 20.75 28.005000000000003 27.72 23.525 120-124 20.835 27.54 28.175 23.45 125-129 20.630000000000003 27.88 27.560000000000002 23.93 130-134 20.4 27.855 27.58 24.165 135-139 20.7 28.305000000000003 27.16 23.835 140-144 20.84 27.26 28.015 23.885 145-149 21.025 27.994999999999997 27.915 23.064999999999998 150-151 20.175 28.249999999999996 26.950000000000003 24.625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 0.5 20 1.5 21 1.0 22 0.5 23 1.0 24 1.0 25 1.0 26 2.0 27 4.5 28 10.0 29 13.0 30 14.5 31 19.5 32 27.5 33 40.0 34 54.0 35 69.0 36 96.5 37 121.5 38 127.0 39 156.5 40 190.0 41 203.0 42 240.0 43 282.0 44 296.5 45 293.5 46 284.0 47 253.5 48 229.0 49 206.0 50 170.5 51 138.0 52 110.0 53 84.0 54 66.0 55 57.5 56 37.0 57 23.0 58 16.5 59 11.5 60 8.5 61 8.5 62 9.0 63 7.0 64 5.0 65 1.5 66 0.0 67 0.0 68 0.5 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87484355444305 99.75 2 0.1251564455569462 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.025 0.0 0.0 0.0 90-91 0.075 0.025 0.0 0.0 0.0 92-93 0.075 0.025 0.0 0.0 0.0 94-95 0.075 0.025 0.0 0.0 0.0 96-97 0.075 0.025 0.0 0.0 0.0 98-99 0.1 0.025 0.0 0.0 0.0 100-101 0.15 0.025 0.0 0.0 0.0 102-103 0.16249999999999998 0.025 0.0 0.0 0.0 104-105 0.1875 0.025 0.0 0.0 0.0 106-107 0.2 0.025 0.0 0.0 0.0 108-109 0.2 0.025 0.0 0.0 0.0 110-111 0.2375 0.025 0.0 0.0 0.0 112-113 0.3125 0.025 0.0 0.0 0.0 114-115 0.3625 0.025 0.0 0.0 0.0 116-117 0.375 0.025 0.0 0.0 0.0 118-119 0.4625 0.025 0.0 0.0 0.0 120-121 0.5375000000000001 0.025 0.0 0.0 0.0 122-123 0.65 0.025 0.0 0.0 0.0 124-125 0.7125 0.025 0.0 0.0 0.0 126-127 0.8125 0.025 0.0 0.0 0.0 128-129 0.9125000000000001 0.025 0.0 0.0 0.0 130-131 1.0 0.025 0.0 0.0 0.0 132-133 1.125 0.025 0.0 0.0 0.0 134-135 1.225 0.025 0.0 0.0 0.0 136-137 1.4 0.025 0.0 0.0 0.0 138-139 1.5875 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTAATCA 10 0.006830828 145.0 3 >>END_MODULE SRR7171913 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171913_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.845 33.0 33.0 34.0 32.0 34.0 2 32.98925 33.0 33.0 34.0 32.0 34.0 3 33.0065 34.0 33.0 34.0 32.0 34.0 4 32.9395 34.0 33.0 34.0 32.0 34.0 5 32.93125 34.0 33.0 34.0 32.0 34.0 6 37.173 38.0 38.0 38.0 37.0 38.0 7 37.1225 38.0 38.0 38.0 37.0 38.0 8 37.20125 38.0 38.0 38.0 37.0 38.0 9 37.18675 38.0 38.0 38.0 37.0 38.0 10-14 37.0678 38.0 38.0 38.0 36.6 38.0 15-19 37.106100000000005 38.0 38.0 38.0 37.0 38.0 20-24 37.0279 38.0 38.0 38.0 36.2 38.0 25-29 37.0491 38.0 38.0 38.0 36.2 38.0 30-34 37.000800000000005 38.0 38.0 38.0 36.2 38.0 35-39 36.69495 38.0 38.0 38.0 35.6 38.0 40-44 36.32785 38.0 38.0 38.0 34.8 38.0 45-49 36.8024 38.0 38.0 38.0 35.4 38.0 50-54 36.88420000000001 38.0 38.0 38.0 35.6 38.0 55-59 36.910399999999996 38.0 38.0 38.0 36.0 38.0 60-64 36.8323 38.0 38.0 38.0 35.8 38.0 65-69 36.685 38.0 38.0 38.0 35.0 38.0 70-74 36.629250000000006 38.0 38.0 38.0 34.8 38.0 75-79 36.616800000000005 38.0 38.0 38.0 34.6 38.0 80-84 36.57955 38.0 38.0 38.0 34.4 38.0 85-89 36.40259999999999 38.0 38.0 38.0 34.0 38.0 90-94 36.2804 38.0 38.0 38.0 33.8 38.0 95-99 36.11 38.0 37.2 38.0 33.0 38.0 100-104 35.99595 38.0 37.0 38.0 33.0 38.0 105-109 35.883799999999994 38.0 37.0 38.0 32.6 38.0 110-114 35.720150000000004 38.0 37.0 38.0 31.2 38.0 115-119 35.51975 38.0 36.8 38.0 31.0 38.0 120-124 35.35765 38.0 36.2 38.0 29.8 38.0 125-129 35.09425 38.0 36.0 38.0 28.2 38.0 130-134 34.72455 38.0 35.0 38.0 27.4 38.0 135-139 34.37365 38.0 35.0 38.0 24.4 38.0 140-144 34.1259 38.0 35.0 38.0 24.0 38.0 145-149 33.53444999999999 38.0 34.8 38.0 20.6 38.0 150-151 29.83425 36.0 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 2.0 4 2.0 5 0.0 6 0.0 7 2.0 8 0.0 9 0.0 10 1.0 11 1.0 12 1.0 13 2.0 14 0.0 15 4.0 16 3.0 17 1.0 18 5.0 19 7.0 20 10.0 21 9.0 22 7.0 23 14.0 24 15.0 25 21.0 26 17.0 27 34.0 28 22.0 29 31.0 30 42.0 31 60.0 32 87.0 33 114.0 34 151.0 35 336.0 36 757.0 37 2239.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.3 17.025000000000002 15.075 29.599999999999998 2 22.95 25.275 35.449999999999996 16.325 3 20.724999999999998 27.725 29.975 21.575 4 24.175 34.275 22.1 19.45 5 23.575 37.4 21.65 17.375 6 19.2 37.625 22.375 20.8 7 17.4 18.5 41.05 23.05 8 20.875 22.875 27.525 28.725 9 21.475 24.075 28.999999999999996 25.45 10-14 23.04 28.560000000000002 26.63 21.77 15-19 22.89 27.495000000000005 27.725 21.89 20-24 22.425 28.355000000000004 27.615000000000002 21.605 25-29 22.770000000000003 28.505000000000003 27.750000000000004 20.974999999999998 30-34 22.965334400480216 28.072632684708122 27.417337802010906 21.54469511280076 35-39 22.61066398390342 28.777665995975855 27.736418511066397 20.875251509054326 40-44 23.424108727623107 28.251939753537197 26.913129469040015 21.410822049799684 45-49 23.13 27.92 27.650000000000002 21.3 50-54 22.715 28.53 27.42 21.335 55-59 23.275000000000002 28.199999999999996 27.025 21.5 60-64 23.080000000000002 28.144999999999996 27.79 20.985 65-69 23.195 28.725 27.195000000000004 20.885 70-74 23.755000000000003 28.044999999999998 27.245 20.955 75-79 23.415 28.754999999999995 27.0 20.830000000000002 80-84 23.494999999999997 27.42 28.015 21.07 85-89 23.78 27.67 27.544999999999998 21.005 90-94 23.150000000000002 28.095 28.315 20.44 95-99 24.07 27.735 27.61 20.585 100-104 23.669999999999998 27.54 28.060000000000002 20.73 105-109 23.345 27.500000000000004 28.310000000000002 20.845 110-114 23.61 27.295 28.105000000000004 20.990000000000002 115-119 23.785 27.83 27.555000000000003 20.830000000000002 120-124 23.665 27.425 28.21 20.7 125-129 23.645 27.74 27.74 20.875 130-134 24.07 27.889999999999997 27.36 20.68 135-139 23.9 27.095000000000002 28.175 20.830000000000002 140-144 24.2 27.915 27.505000000000003 20.380000000000003 145-149 23.66 28.07 27.55 20.72 150-151 23.525 28.849999999999998 26.875 20.75 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 0.5 24 0.0 25 0.0 26 2.0 27 3.0 28 6.0 29 10.0 30 11.0 31 15.0 32 21.5 33 31.5 34 40.0 35 51.5 36 65.5 37 95.0 38 130.0 39 155.5 40 180.5 41 222.0 42 263.0 43 286.0 44 290.5 45 297.5 46 289.0 47 265.5 48 250.0 49 206.5 50 179.0 51 157.0 52 125.0 53 104.0 54 70.5 55 39.0 56 29.0 57 28.0 58 23.0 59 15.5 60 12.5 61 8.5 62 6.0 63 4.0 64 1.0 65 0.5 66 1.0 67 0.5 68 0.5 69 1.0 70 0.5 71 0.5 72 0.5 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.045 35-39 0.6 40-44 1.405 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.16249999999999998 0.0 0.0 0.0 0.0 104-105 0.1875 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.2 0.0 0.0 0.0 0.0 110-111 0.2375 0.0 0.0 0.0 0.0 112-113 0.3125 0.0 0.0 0.0 0.0 114-115 0.3625 0.0 0.0 0.0 0.0 116-117 0.375 0.0 0.0 0.0 0.0 118-119 0.4625 0.0 0.0 0.0 0.0 120-121 0.5375000000000001 0.0 0.0 0.0 0.0 122-123 0.65 0.0 0.0 0.0 0.0 124-125 0.7125 0.0 0.0 0.0 0.0 126-127 0.8125 0.0 0.0 0.0 0.0 128-129 0.9125000000000001 0.0 0.0 0.0 0.0 130-131 1.0 0.0 0.0 0.0 0.0 132-133 1.15 0.0 0.0 0.0 0.0 134-135 1.25 0.0 0.0 0.0 0.0 136-137 1.4375 0.0 0.0 0.0 0.0 138-139 1.6375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGACAAC 10 0.0068803662 144.65 2 CATGGAC 10 0.0068803662 144.65 1 >>END_MODULE Read 715049 spots for SRR7171913.sra Written 715049 spots for SRR7171913.sra Read 715049 spots for SRR7171913.sra Written 715049 spots for SRR7171913.sra Read 715049 spots for SRR7171913.sra Written 715049 spots for SRR7171913.sra Read 715049 spots for SRR7171913.sra Written 715049 spots for SRR7171913.sra Read 715049 spots for SRR7171913.sra Written 715049 spots for SRR7171913.sra Read 715049 spots for SRR7171913.sra Written 715049 spots for SRR7171913.sra Read 715049 spots for SRR7171913.sra Written 715049 spots for SRR7171913.sra Read 715049 spots for SRR7171913.sra Written 715049 spots for SRR7171913.sra Read 715049 spots for SRR7171913.sra Written 715049 spots for SRR7171913.sra Read 715049 spots for SRR7171913.sra Written 715049 spots for SRR7171913.sra Read 715049 spots for SRR7171913.sra Written 715049 spots for SRR7171913.sra Read 715049 spots for SRR7171913.sra Written 715049 spots for SRR7171913.sra Read 715049 spots for SRR7171913.sra Written 715049 spots for SRR7171913.sra Read 715049 spots for SRR7171913.sra Written 715049 spots for SRR7171913.sra Read 715049 spots for SRR7171913.sra Written 715049 spots for SRR7171913.sra Read 715049 spots for SRR7171913.sra Written 715049 spots for SRR7171913.sra Read 715049 spots for SRR7171913.sra Written 715049 spots for SRR7171913.sra Read 715049 spots for SRR7171913.sra Written 715049 spots for SRR7171913.sra Read 715049 spots for SRR7171913.sra Written 715049 spots for SRR7171913.sra Read 715064 spots for SRR7171913.sra Written 715064 spots for SRR7171913.sra SRR ids: ['SRR7171913.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_68cz4gn7 SRR7171913.sra spots: 14300995 blocks: [[1, 715049], [715050, 1430098], [1430099, 2145147], [2145148, 2860196], [2860197, 3575245], [3575246, 4290294], [4290295, 5005343], [5005344, 5720392], [5720393, 6435441], [6435442, 7150490], [7150491, 7865539], [7865540, 8580588], [8580589, 9295637], [9295638, 10010686], [10010687, 10725735], [10725736, 11440784], [11440785, 12155833], [12155834, 12870882], [12870883, 13585931], [13585932, 14300995]] SRR7171913 file size 4824437 SRR7171913 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171913 SRR7171913_1.fastq SRR7171913_2.fastq Input file: SRR7171913_1.fastq Paired file: SRR7171913_2.fastq trimmed: SRR7171913-trimmed-pair1.fastq, SRR7171913-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 14:44:44 2025 >> started Fri Feb 14 14:45:01 2025 >> done (16.964s) 14300995 read pairs processed; of these: 9275 ( 0.06%) short read pairs filtered out after trimming by size control 6737 ( 0.05%) empty read pairs filtered out after trimming by size control 14284983 (99.89%) read pairs available; of these: 5384644 (37.69%) trimmed read pairs available after processing 8900339 (62.31%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 3 0.00% 21 0 0.00% 22 1 0.00% 23 1 0.00% 24 2 0.00% 25 3 0.00% 26 4 0.00% 27 1 0.00% 28 2 0.00% 29 3 0.00% 30 4 0.00% 31 3 0.00% 32 3 0.00% 33 1 0.00% 34 4 0.00% 35 2 0.00% 36 4 0.00% 37 3 0.00% 38 1 0.00% 39 2 0.00% 40 7 0.00% 41 4 0.00% 42 10 0.00% 43 9 0.00% 44 6 0.00% 45 0 0.00% 46 8 0.00% 47 7 0.00% 48 11 0.00% 49 9 0.00% 50 13 0.00% 51 14 0.00% 52 21 0.00% 53 19 0.00% 54 17 0.00% 55 23 0.00% 56 26 0.00% 57 23 0.00% 58 33 0.00% 59 37 0.00% 60 46 0.00% 61 43 0.00% 62 59 0.00% 63 56 0.00% 64 65 0.00% 65 75 0.00% 66 87 0.00% 67 105 0.00% 68 110 0.00% 69 117 0.00% 70 144 0.00% 71 142 0.00% 72 193 0.00% 73 202 0.00% 74 239 0.00% 75 256 0.00% 76 301 0.00% 77 335 0.00% 78 346 0.00% 79 419 0.00% 80 443 0.00% 81 516 0.00% 82 613 0.00% 83 738 0.01% 84 1191 0.01% 85 1567 0.01% 86 1649 0.01% 87 2168 0.02% 88 2143 0.02% 89 2039 0.01% 90 2048 0.01% 91 2267 0.02% 92 2281 0.02% 93 2519 0.02% 94 2623 0.02% 95 2797 0.02% 96 2987 0.02% 97 3208 0.02% 98 3365 0.02% 99 3583 0.03% 100 3684 0.03% 101 3994 0.03% 102 4297 0.03% 103 4396 0.03% 104 4934 0.03% 105 5076 0.04% 106 5490 0.04% 107 5590 0.04% 108 6003 0.04% 109 6496 0.05% 110 6994 0.05% 111 7518 0.05% 112 7664 0.05% 113 8176 0.06% 114 8849 0.06% 115 9216 0.06% 116 9826 0.07% 117 10371 0.07% 118 10744 0.08% 119 11352 0.08% 120 12028 0.08% 121 12817 0.09% 122 13458 0.09% 123 14055 0.10% 124 15003 0.11% 125 15849 0.11% 126 16667 0.12% 127 17683 0.12% 128 18655 0.13% 129 20183 0.14% 130 21640 0.15% 131 22951 0.16% 132 24562 0.17% 133 26712 0.19% 134 28461 0.20% 135 31155 0.22% 136 34082 0.24% 137 36453 0.26% 138 39424 0.28% 139 43669 0.31% 140 48459 0.34% 141 54214 0.38% 142 62602 0.44% 143 72479 0.51% 144 85472 0.60% 145 104129 0.73% 146 134180 0.94% 147 186170 1.30% 148 292701 2.05% 149 598452 4.19% 150 3095178 21.67% 151 8900339 62.31% 14284983 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=40 prefix-density=0.16 prefix-fanout=2.0 sequence=TGCCAACGGTGACATTAAGCAATGAACCGAGCAAATCAGCACATACACCTAATTTAAGTGCATCCTTTGGGCACTTTCC criterion=fanout-score sequence-density=0.10 sequence-density-rank=5 fanout-score=352.49 fanout-score-rank=1 prefix-density=1.01 prefix-fanout=35.5 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=4.00 fanout-score-rank=31 prefix-density=0.18 prefix-fanout=3.1 sequence=TTTAGCCAGTACGGTGAAATCATCGATTCGAAGATTATAAA criterion=fanout-score sequence-density=0.09 sequence-density-rank=18 fanout-score=286.80 fanout-score-rank=1 prefix-density=0.85 prefix-fanout=29.4 sequence=GAAGAAGAAGAAA SRR7171913 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 14:46:22 Started mapping on | Feb 14 14:46:23 Finished on | Feb 14 14:47:38 Mapping speed, Million of reads per hour | 685.68 Number of input reads | 14284983 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 13543235 Uniquely mapped reads % | 94.81% Average mapped length | 297.55 Number of splices: Total | 14589095 Number of splices: Annotated (sjdb) | 14361442 Number of splices: GT/AG | 14362137 Number of splices: GC/AG | 184556 Number of splices: AT/AC | 10561 Number of splices: Non-canonical | 31841 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.68 Insertion rate per base | 0.02% Insertion average length | 2.60 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 342709 % of reads mapped to multiple loci | 2.40% Number of reads mapped to too many loci | 36358 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.49% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 409759 409759 409759 N_multimapping 342709 342709 342709 N_noFeature 275680 13435153 323701 N_ambiguous 129330 645 68892 UnstrandedReadsAssigned:13138225 PositiveStrandReadsAssigned:107437 NegativeStrandReadsAssigned:13150642 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171913 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171913-trimmed-pair1.fastq SRR7171913-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,284,983 reads, 12,971,105 reads pseudoaligned [quant] estimated average fragment length: 282.097 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,100 rounds 52401 SRR7171913.ke.tsv 34699 SRR7171913.se.tsv 87100 total ==> SRR7171913.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1736.9 643 26.4882 Potri.005G024800.1.v4.1 1035 753.903 120 11.3889 Potri.004G059700.1.v4.1 961 679.936 11 1.15755 Potri.007G009000.2.v4.1 1416 1134.9 0 0 Potri.003G141000.2.v4.1 2943 2661.9 423.114 11.3732 Potri.016G087400.1.v4.1 270 59.9319 943 1125.82 Potri.015G069301.1.v4.1 564 289.484 0 0 Potri.010G195200.1.v4.1 1773 1491.9 77.7156 3.72722 Potri.012G127500.1.v4.1 977 695.923 2075 213.341 ==> SRR7171913.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 15 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 193 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 111 SRR7171913 completed mapping pipeline successfully