Starting /dee2/code/volunteer_pipeline.sh SRR7171914 current disk space = 3112628170752 free memory = 1573906772 SRR7171914 SRAfilesize 325c0ff9ec71ee8f1a4aca7720095641 SRR7171914.sra SRR7171914.sra file validated SRR7171914 is paired end SRR7171914 is conventional basespace SRR7171914 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171914_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.00875 25.0 18.0 30.0 18.0 32.0 2 21.8085 18.0 18.0 27.0 18.0 31.0 3 23.2885 25.0 18.0 27.0 18.0 29.0 4 24.49075 27.0 15.0 29.0 15.0 31.0 5 25.0795 27.0 15.0 31.0 15.0 33.0 6 28.20575 29.0 26.0 34.0 16.0 37.0 7 32.44825 35.0 29.0 37.0 26.0 38.0 8 35.9495 37.0 36.0 38.0 32.0 38.0 9 36.548 38.0 37.0 38.0 34.0 38.0 10-14 37.01185 38.0 37.8 38.0 35.2 38.0 15-19 37.23515 38.0 38.0 38.0 36.2 38.0 20-24 37.40965 38.0 38.0 38.0 37.0 38.0 25-29 37.3535 38.0 38.0 38.0 37.0 38.0 30-34 37.3803 38.0 38.0 38.0 37.0 38.0 35-39 37.2701 38.0 38.0 38.0 37.0 38.0 40-44 37.3133 38.0 38.0 38.0 37.0 38.0 45-49 37.2352 38.0 38.0 38.0 36.6 38.0 50-54 37.21679999999999 38.0 38.0 38.0 36.6 38.0 55-59 37.13205 38.0 38.0 38.0 36.0 38.0 60-64 37.08825 38.0 38.0 38.0 36.0 38.0 65-69 37.0687 38.0 38.0 38.0 36.0 38.0 70-74 37.019099999999995 38.0 38.0 38.0 36.0 38.0 75-79 36.972449999999995 38.0 38.0 38.0 35.8 38.0 80-84 36.90650000000001 38.0 38.0 38.0 35.4 38.0 85-89 36.826 38.0 38.0 38.0 35.0 38.0 90-94 36.65185 38.0 38.0 38.0 34.4 38.0 95-99 36.6565 38.0 38.0 38.0 34.0 38.0 100-104 36.50165 38.0 38.0 38.0 34.0 38.0 105-109 36.3554 38.0 37.8 38.0 34.0 38.0 110-114 36.18625 38.0 37.0 38.0 33.6 38.0 115-119 36.07935 38.0 37.0 38.0 33.2 38.0 120-124 35.98135 38.0 37.0 38.0 33.0 38.0 125-129 35.77669999999999 38.0 36.6 38.0 31.8 38.0 130-134 35.51555 38.0 36.0 38.0 31.0 38.0 135-139 35.2029 38.0 35.8 38.0 28.8 38.0 140-144 34.84439999999999 38.0 35.0 38.0 27.8 38.0 145-149 34.3444 38.0 35.0 38.0 26.8 38.0 150-151 31.29675 36.5 31.5 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 4.0 20 4.0 21 3.0 22 5.0 23 7.0 24 9.0 25 15.0 26 12.0 27 23.0 28 36.0 29 33.0 30 44.0 31 52.0 32 84.0 33 133.0 34 171.0 35 378.0 36 1239.0 37 1745.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 65.55 0.25 8.5 25.7 2 39.85 6.550000000000001 34.925 18.675 3 25.124999999999996 24.275 30.275000000000002 20.325 4 26.1 32.625 26.875 14.399999999999999 5 34.1 28.425 22.25 15.225 6 20.4 33.650000000000006 26.0 19.950000000000003 7 14.975 23.175 42.9 18.95 8 19.15 22.125 30.5 28.225 9 19.35 22.650000000000002 32.225 25.775 10-14 20.91 28.88 26.8 23.41 15-19 21.36 27.93 27.865000000000002 22.845 20-24 20.815 27.55 28.235 23.400000000000002 25-29 20.505000000000003 27.860000000000003 28.244999999999997 23.39 30-34 20.64 28.349999999999998 27.675 23.335 35-39 20.674999999999997 27.82 27.950000000000003 23.555 40-44 21.085 28.175 27.77 22.97 45-49 20.724999999999998 27.99 27.725 23.56 50-54 21.25 27.85 27.54 23.36 55-59 20.76 27.85 28.134999999999998 23.255 60-64 20.655 28.1 27.6 23.645 65-69 20.849999999999998 27.665 27.295 24.19 70-74 21.325 27.950000000000003 27.534999999999997 23.189999999999998 75-79 21.09 27.639999999999997 27.860000000000003 23.41 80-84 20.82 27.950000000000003 27.589999999999996 23.64 85-89 21.055 27.11 27.975 23.86 90-94 20.91 27.644999999999996 27.77 23.674999999999997 95-99 20.745 27.785 28.189999999999998 23.28 100-104 20.93 27.905 28.000000000000004 23.165 105-109 20.435 27.54 28.18 23.845 110-114 21.075 27.339999999999996 28.044999999999998 23.54 115-119 20.89 27.92 28.12 23.07 120-124 20.48 27.46 27.950000000000003 24.11 125-129 21.07 27.839999999999996 27.505000000000003 23.585 130-134 21.37 27.74 27.61 23.28 135-139 20.77 28.09 27.744999999999997 23.395 140-144 20.990000000000002 27.61 28.205000000000002 23.195 145-149 21.63 26.825 27.96 23.585 150-151 21.8125 27.700000000000003 27.6375 22.85 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.0 21 1.0 22 1.5 23 2.0 24 2.0 25 1.0 26 2.5 27 3.5 28 3.0 29 4.0 30 7.0 31 13.5 32 22.0 33 31.0 34 39.5 35 46.5 36 69.0 37 91.0 38 108.5 39 150.0 40 177.0 41 201.5 42 239.5 43 260.5 44 281.0 45 297.0 46 292.5 47 268.0 48 244.0 49 225.5 50 186.5 51 153.5 52 134.0 53 106.5 54 86.5 55 63.5 56 46.5 57 38.0 58 25.0 59 16.0 60 12.5 61 13.5 62 9.0 63 6.5 64 6.5 65 2.0 66 1.0 67 2.0 68 1.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62330487192365 99.175 2 0.3264691109994977 0.65 3 0.025113008538422906 0.075 4 0.025113008538422906 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.07500000000000001 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.21250000000000002 0.0 0.0 0.0 0.0 98-99 0.2375 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.3375 0.0 0.0 0.0 0.0 104-105 0.3625 0.0 0.0 0.0 0.0 106-107 0.5125 0.0 0.0 0.0 0.0 108-109 0.575 0.0 0.0 0.0 0.0 110-111 0.5874999999999999 0.0 0.0 0.0 0.0 112-113 0.6125 0.0 0.0 0.0 0.0 114-115 0.7 0.0 0.0 0.0 0.0 116-117 0.75 0.0 0.0 0.0 0.0 118-119 0.825 0.0 0.0 0.0 0.0 120-121 0.85 0.0 0.0 0.0 0.0 122-123 0.9625 0.0 0.0 0.0 0.0 124-125 1.1375 0.0 0.0 0.0 0.0 126-127 1.4625 0.0 0.0 0.0 0.0 128-129 1.675 0.0 0.0 0.0 0.0 130-131 1.8125 0.0 0.0 0.0 0.0 132-133 2.0 0.0 0.0 0.0 0.0 134-135 2.1625 0.0 0.0 0.0 0.0 136-137 2.4000000000000004 0.0 0.0 0.0 0.0 138-139 2.6125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTGATT 10 0.006830828 145.0 1 CATTTCC 10 0.006830828 145.0 3 TTGATAG 10 0.006830828 145.0 5 CTGTTCC 10 0.006830828 145.0 6 >>END_MODULE SRR7171914 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171914_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.69625 33.0 33.0 34.0 32.0 34.0 2 32.81275 33.0 33.0 34.0 32.0 34.0 3 32.86775 33.0 33.0 34.0 32.0 34.0 4 32.791 33.0 33.0 34.0 32.0 34.0 5 32.72025 33.0 33.0 34.0 32.0 34.0 6 36.9185 38.0 38.0 38.0 36.0 38.0 7 37.0585 38.0 38.0 38.0 36.0 38.0 8 37.09425 38.0 38.0 38.0 36.0 38.0 9 37.05675 38.0 38.0 38.0 36.0 38.0 10-14 37.095349999999996 38.0 38.0 38.0 36.4 38.0 15-19 37.068599999999996 38.0 38.0 38.0 36.0 38.0 20-24 37.02625 38.0 38.0 38.0 36.0 38.0 25-29 36.97089999999999 38.0 38.0 38.0 36.0 38.0 30-34 36.9961 38.0 38.0 38.0 36.0 38.0 35-39 36.82055 38.0 38.0 38.0 36.0 38.0 40-44 36.602850000000004 38.0 38.0 38.0 35.2 38.0 45-49 36.82455 38.0 38.0 38.0 35.2 38.0 50-54 36.790800000000004 38.0 38.0 38.0 35.0 38.0 55-59 36.752449999999996 38.0 38.0 38.0 35.0 38.0 60-64 36.6331 38.0 38.0 38.0 34.8 38.0 65-69 36.549 38.0 38.0 38.0 34.0 38.0 70-74 36.518100000000004 38.0 38.0 38.0 34.0 38.0 75-79 36.44435 38.0 38.0 38.0 34.0 38.0 80-84 36.416250000000005 38.0 38.0 38.0 34.0 38.0 85-89 36.2596 38.0 37.8 38.0 33.8 38.0 90-94 36.1015 38.0 37.0 38.0 33.0 38.0 95-99 36.0377 38.0 37.0 38.0 32.8 38.0 100-104 35.90755 38.0 37.0 38.0 32.6 38.0 105-109 35.7088 38.0 36.8 38.0 30.8 38.0 110-114 35.55065 38.0 36.6 38.0 30.6 38.0 115-119 35.3152 38.0 36.0 38.0 29.4 38.0 120-124 35.227850000000004 38.0 36.0 38.0 29.0 38.0 125-129 34.87415 38.0 35.8 38.0 27.8 38.0 130-134 34.5021 38.0 35.0 38.0 26.4 38.0 135-139 34.07405 38.0 35.0 38.0 23.2 38.0 140-144 33.6912 38.0 34.6 38.0 21.8 38.0 145-149 32.995349999999995 38.0 34.0 38.0 14.2 38.0 150-151 29.370625 36.0 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 0.0 4 1.0 5 0.0 6 1.0 7 0.0 8 0.0 9 2.0 10 1.0 11 1.0 12 0.0 13 2.0 14 0.0 15 1.0 16 6.0 17 3.0 18 5.0 19 11.0 20 8.0 21 8.0 22 13.0 23 7.0 24 20.0 25 19.0 26 34.0 27 33.0 28 23.0 29 46.0 30 53.0 31 63.0 32 99.0 33 126.0 34 192.0 35 325.0 36 687.0 37 2207.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.95 17.974999999999998 14.274999999999999 28.799999999999997 2 23.45 24.675 33.725 18.15 3 20.775 28.125 29.875 21.224999999999998 4 24.125 34.625 21.375 19.875 5 24.575 37.574999999999996 20.45 17.4 6 19.325 38.25 24.375 18.05 7 19.325 18.85 39.65 22.175 8 20.75 23.1 28.325 27.825 9 21.525 25.15 28.625 24.7 10-14 22.795 29.28 26.405 21.52 15-19 22.54 28.000000000000004 27.794999999999998 21.665 20-24 23.03 28.355000000000004 27.224999999999998 21.39 25-29 22.725 29.205 26.775 21.295 30-34 22.88144072036018 28.269134567283643 27.613806903451728 21.235617808904454 35-39 23.36326694426328 29.17774544724828 26.087392765765316 21.37159484272312 40-44 23.208981523435533 28.283743643961134 27.241604994210338 21.26566983839299 45-49 23.325000000000003 28.365000000000002 27.224999999999998 21.085 50-54 23.66 28.249999999999996 26.924999999999997 21.165 55-59 23.3 28.07 27.794999999999998 20.835 60-64 23.275000000000002 28.21 27.22 21.295 65-69 23.03 28.485 27.005000000000003 21.48 70-74 23.1 28.49 27.235 21.175 75-79 23.794999999999998 27.765 27.235 21.205 80-84 23.735 27.71 27.425 21.13 85-89 23.395 28.26 27.229999999999997 21.115000000000002 90-94 23.565 28.16 27.27 21.005 95-99 23.794999999999998 28.01 26.855 21.34 100-104 23.77 28.189999999999998 26.939999999999998 21.099999999999998 105-109 23.845 27.534999999999997 27.425 21.195 110-114 23.875 27.810000000000002 27.01 21.305 115-119 23.494999999999997 28.015 27.575 20.915 120-124 23.405 27.79 27.67 21.135 125-129 23.49 28.15 27.175 21.185000000000002 130-134 23.630000000000003 28.025 27.200000000000003 21.145 135-139 23.919999999999998 28.235 26.645000000000003 21.2 140-144 23.474999999999998 28.000000000000004 27.91 20.615 145-149 24.035 28.285 26.875 20.805 150-151 24.4 28.050000000000004 26.6 20.95 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.5 23 0.5 24 0.5 25 1.0 26 1.0 27 0.5 28 2.5 29 7.5 30 8.0 31 10.5 32 13.0 33 19.0 34 38.0 35 55.0 36 63.0 37 82.0 38 121.0 39 158.0 40 187.5 41 227.5 42 269.5 43 287.5 44 292.5 45 322.5 46 310.5 47 269.0 48 243.0 49 215.5 50 177.5 51 136.5 52 113.5 53 87.5 54 76.5 55 53.5 56 36.0 57 34.5 58 22.5 59 17.0 60 12.0 61 7.0 62 6.5 63 5.0 64 3.0 65 1.0 66 0.5 67 0.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.05 35-39 0.335 40-44 0.685 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47143216712811 98.8 2 0.4027183488547697 0.8 3 0.10067958721369243 0.3 4 0.025169896803423106 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.07500000000000001 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.1875 0.0 0.0 0.0 0.0 98-99 0.23750000000000002 0.0 0.0 0.0 0.0 100-101 0.30000000000000004 0.0 0.0 0.0 0.0 102-103 0.3625 0.0 0.0 0.0 0.0 104-105 0.3875 0.0 0.0 0.0 0.0 106-107 0.5375000000000001 0.0 0.0 0.0 0.0 108-109 0.6 0.0 0.0 0.0 0.0 110-111 0.6125 0.0 0.0 0.0 0.0 112-113 0.6625000000000001 0.0 0.0 0.0 0.0 114-115 0.75 0.0 0.0 0.0 0.0 116-117 0.8 0.0 0.0 0.0 0.0 118-119 0.875 0.0 0.0 0.0 0.0 120-121 0.9 0.0 0.0 0.0 0.0 122-123 1.0125 0.0 0.0 0.0 0.0 124-125 1.2125 0.0 0.0 0.0 0.0 126-127 1.5375 0.0 0.0 0.0 0.0 128-129 1.75 0.0 0.0 0.0 0.0 130-131 1.9 0.0 0.0 0.0 0.0 132-133 2.0999999999999996 0.0 0.0 0.0 0.0 134-135 2.2625 0.0 0.0 0.0 0.0 136-137 2.5 0.0 0.0 0.0 0.0 138-139 2.7249999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 701332 spots for SRR7171914.sra Written 701332 spots for SRR7171914.sra Read 701332 spots for SRR7171914.sra Written 701332 spots for SRR7171914.sra Read 701332 spots for SRR7171914.sra Written 701332 spots for SRR7171914.sra Read 701332 spots for SRR7171914.sra Written 701332 spots for SRR7171914.sra Read 701332 spots for SRR7171914.sra Written 701332 spots for SRR7171914.sra Read 701332 spots for SRR7171914.sra Written 701332 spots for SRR7171914.sra Read 701332 spots for SRR7171914.sra Written 701332 spots for SRR7171914.sra Read 701349 spots for SRR7171914.sra Written 701349 spots for SRR7171914.sra Read 701332 spots for SRR7171914.sra Written 701332 spots for SRR7171914.sra Read 701332 spots for SRR7171914.sra Written 701332 spots for SRR7171914.sra Read 701332 spots for SRR7171914.sra Written 701332 spots for SRR7171914.sra Read 701332 spots for SRR7171914.sra Written 701332 spots for SRR7171914.sra Read 701332 spots for SRR7171914.sra Written 701332 spots for SRR7171914.sra Read 701332 spots for SRR7171914.sra Written 701332 spots for SRR7171914.sra Read 701332 spots for SRR7171914.sra Written 701332 spots for SRR7171914.sra Read 701332 spots for SRR7171914.sra Written 701332 spots for SRR7171914.sra Read 701332 spots for SRR7171914.sra Written 701332 spots for SRR7171914.sra Read 701332 spots for SRR7171914.sra Written 701332 spots for SRR7171914.sra Read 701332 spots for SRR7171914.sra Written 701332 spots for SRR7171914.sra Read 701332 spots for SRR7171914.sra Written 701332 spots for SRR7171914.sra SRR ids: ['SRR7171914.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mtqu6rza SRR7171914.sra spots: 14026657 blocks: [[1, 701332], [701333, 1402664], [1402665, 2103996], [2103997, 2805328], [2805329, 3506660], [3506661, 4207992], [4207993, 4909324], [4909325, 5610656], [5610657, 6311988], [6311989, 7013320], [7013321, 7714652], [7714653, 8415984], [8415985, 9117316], [9117317, 9818648], [9818649, 10519980], [10519981, 11221312], [11221313, 11922644], [11922645, 12623976], [12623977, 13325308], [13325309, 14026657]] SRR7171914 file size 4731473 SRR7171914 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171914 SRR7171914_1.fastq SRR7171914_2.fastq Input file: SRR7171914_1.fastq Paired file: SRR7171914_2.fastq trimmed: SRR7171914-trimmed-pair1.fastq, SRR7171914-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 15:06:35 2025 >> started Fri Feb 14 15:06:50 2025 >> done (14.468s) 14026657 read pairs processed; of these: 12901 ( 0.09%) short read pairs filtered out after trimming by size control 12266 ( 0.09%) empty read pairs filtered out after trimming by size control 14001490 (99.82%) read pairs available; of these: 5689232 (40.63%) trimmed read pairs available after processing 8312258 (59.37%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 3 0.00% 21 1 0.00% 22 2 0.00% 23 3 0.00% 24 1 0.00% 25 3 0.00% 26 2 0.00% 27 1 0.00% 28 3 0.00% 29 4 0.00% 30 1 0.00% 31 2 0.00% 32 2 0.00% 33 7 0.00% 34 4 0.00% 35 4 0.00% 36 1 0.00% 37 1 0.00% 38 1 0.00% 39 8 0.00% 40 3 0.00% 41 8 0.00% 42 8 0.00% 43 5 0.00% 44 10 0.00% 45 8 0.00% 46 13 0.00% 47 9 0.00% 48 18 0.00% 49 12 0.00% 50 25 0.00% 51 22 0.00% 52 22 0.00% 53 24 0.00% 54 22 0.00% 55 37 0.00% 56 32 0.00% 57 39 0.00% 58 43 0.00% 59 43 0.00% 60 44 0.00% 61 65 0.00% 62 72 0.00% 63 68 0.00% 64 104 0.00% 65 82 0.00% 66 90 0.00% 67 120 0.00% 68 144 0.00% 69 165 0.00% 70 134 0.00% 71 224 0.00% 72 252 0.00% 73 289 0.00% 74 311 0.00% 75 339 0.00% 76 409 0.00% 77 419 0.00% 78 518 0.00% 79 585 0.00% 80 598 0.00% 81 753 0.01% 82 879 0.01% 83 984 0.01% 84 1658 0.01% 85 2142 0.02% 86 2230 0.02% 87 2824 0.02% 88 2819 0.02% 89 2676 0.02% 90 3002 0.02% 91 3039 0.02% 92 3362 0.02% 93 3528 0.03% 94 3683 0.03% 95 3986 0.03% 96 4063 0.03% 97 4384 0.03% 98 4698 0.03% 99 4832 0.03% 100 5089 0.04% 101 5562 0.04% 102 5960 0.04% 103 6492 0.05% 104 6740 0.05% 105 7153 0.05% 106 7698 0.05% 107 7974 0.06% 108 8468 0.06% 109 9070 0.06% 110 9758 0.07% 111 10393 0.07% 112 10814 0.08% 113 11509 0.08% 114 12206 0.09% 115 13351 0.10% 116 13741 0.10% 117 14078 0.10% 118 14808 0.11% 119 15400 0.11% 120 16041 0.11% 121 16969 0.12% 122 17678 0.13% 123 18935 0.14% 124 20204 0.14% 125 21206 0.15% 126 22364 0.16% 127 23254 0.17% 128 24249 0.17% 129 25357 0.18% 130 27213 0.19% 131 28513 0.20% 132 30988 0.22% 133 33033 0.24% 134 35293 0.25% 135 37722 0.27% 136 40920 0.29% 137 44147 0.32% 138 46978 0.34% 139 50983 0.36% 140 56202 0.40% 141 61890 0.44% 142 70306 0.50% 143 81080 0.58% 144 95046 0.68% 145 114630 0.82% 146 146901 1.05% 147 202862 1.45% 148 315222 2.25% 149 633867 4.53% 150 3071883 21.94% 151 8312258 59.37% 14001490 reads passed initial QC criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=2.99 fanout-score-rank=20 prefix-density=0.70 prefix-fanout=2.0 sequence=CACTTGCAGCCATTCTCAGCACCA criterion=fanout-score sequence-density=0.02 sequence-density-rank=30 fanout-score=30.07 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=5.2 sequence=ATGAAAACACCTTGAAAGTTGAAGCAGCCAACAAAGCAGTGACGCGTACACAAGACAAAGGATTTATAGGAACCCTTTGCTGTTTATTATTATTTAACAA criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=3.53 fanout-score-rank=17 prefix-density=0.67 prefix-fanout=3.0 sequence=TGCAAGTGCGGCAGTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=63.29 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=3.9 sequence=TCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCC SRR7171914 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 15:07:47 Started mapping on | Feb 14 15:07:48 Finished on | Feb 14 15:09:35 Mapping speed, Million of reads per hour | 471.08 Number of input reads | 14001490 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 13040352 Uniquely mapped reads % | 93.14% Average mapped length | 296.56 Number of splices: Total | 13203163 Number of splices: Annotated (sjdb) | 12956939 Number of splices: GT/AG | 12993090 Number of splices: GC/AG | 167414 Number of splices: AT/AC | 10052 Number of splices: Non-canonical | 32607 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.63 Insertion rate per base | 0.02% Insertion average length | 2.65 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 334069 % of reads mapped to multiple loci | 2.39% Number of reads mapped to too many loci | 35694 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.16% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 639653 639653 639653 N_multimapping 334069 334069 334069 N_noFeature 296702 12907687 359752 N_ambiguous 135464 1004 65133 UnstrandedReadsAssigned:12608186 PositiveStrandReadsAssigned:131661 NegativeStrandReadsAssigned:12615467 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7171914 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171914-trimmed-pair1.fastq SRR7171914-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,001,490 reads, 12,481,493 reads pseudoaligned [quant] estimated average fragment length: 259.868 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,073 rounds 52401 SRR7171914.ke.tsv 34699 SRR7171914.se.tsv 87100 total ==> SRR7171914.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1759.13 946 38.8838 Potri.005G024800.1.v4.1 1035 776.132 149 13.8812 Potri.004G059700.1.v4.1 961 702.19 23 2.36837 Potri.007G009000.2.v4.1 1416 1157.13 1 0.0624874 Potri.003G141000.2.v4.1 2943 2684.13 511 13.7655 Potri.016G087400.1.v4.1 270 69.3592 1019 1062.3 Potri.015G069301.1.v4.1 564 310.807 0 0 Potri.010G195200.1.v4.1 1773 1514.13 323 15.4246 Potri.012G127500.1.v4.1 977 718.174 4927 496.053 ==> SRR7171914.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 72 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 342 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 170 SRR7171914 completed mapping pipeline successfully