Starting /dee2/code/volunteer_pipeline.sh SRR7171915 current disk space = 3110321389568 free memory = 1015208256 SRR7171915 SRAfilesize cc287ea761c7ee3001d5aa2a07c3d927 SRR7171915.sra SRR7171915.sra file validated SRR7171915 is paired end SRR7171915 is conventional basespace SRR7171915 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171915_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.17175 33.0 32.0 33.0 27.0 33.0 2 25.91325 29.0 18.0 31.0 18.0 33.0 3 30.8505 32.0 31.0 33.0 27.0 33.0 4 29.83975 31.0 29.0 33.0 25.0 33.0 5 31.4925 33.0 32.0 33.0 28.0 33.0 6 35.545 37.0 35.0 38.0 31.0 38.0 7 36.2465 38.0 36.0 38.0 33.0 38.0 8 37.0655 38.0 38.0 38.0 36.0 38.0 9 37.1045 38.0 38.0 38.0 36.0 38.0 10-14 37.186550000000004 38.0 38.0 38.0 36.0 38.0 15-19 37.3086 38.0 38.0 38.0 37.0 38.0 20-24 37.3154 38.0 38.0 38.0 37.0 38.0 25-29 37.28855 38.0 38.0 38.0 37.0 38.0 30-34 37.30735 38.0 38.0 38.0 37.0 38.0 35-39 37.233050000000006 38.0 38.0 38.0 36.6 38.0 40-44 37.2266 38.0 38.0 38.0 36.8 38.0 45-49 37.155899999999995 38.0 38.0 38.0 36.4 38.0 50-54 37.12415 38.0 38.0 38.0 36.0 38.0 55-59 37.08495 38.0 38.0 38.0 36.0 38.0 60-64 37.00345 38.0 38.0 38.0 36.0 38.0 65-69 36.9396 38.0 38.0 38.0 35.6 38.0 70-74 36.848 38.0 38.0 38.0 35.2 38.0 75-79 36.81995 38.0 38.0 38.0 35.0 38.0 80-84 36.7918 38.0 38.0 38.0 35.0 38.0 85-89 36.7364 38.0 38.0 38.0 34.6 38.0 90-94 36.6485 38.0 38.0 38.0 34.4 38.0 95-99 36.49 38.0 38.0 38.0 34.0 38.0 100-104 36.39125 38.0 37.8 38.0 34.0 38.0 105-109 36.27140000000001 38.0 37.4 38.0 33.8 38.0 110-114 36.0545 38.0 37.0 38.0 33.0 38.0 115-119 35.936899999999994 38.0 37.0 38.0 32.2 38.0 120-124 35.65775 38.0 36.4 38.0 31.0 38.0 125-129 35.7096 38.0 36.2 38.0 31.2 38.0 130-134 35.27945 38.0 36.0 38.0 29.4 38.0 135-139 35.044650000000004 38.0 35.6 38.0 28.2 38.0 140-144 34.743500000000004 38.0 35.0 38.0 27.6 38.0 145-149 34.0798 38.0 35.0 38.0 24.2 38.0 150-151 30.929875000000003 36.5 31.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 3.0 19 1.0 20 1.0 21 6.0 22 8.0 23 6.0 24 11.0 25 15.0 26 19.0 27 16.0 28 30.0 29 44.0 30 46.0 31 66.0 32 81.0 33 112.0 34 157.0 35 287.0 36 771.0 37 2316.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.9 33.900000000000006 5.7 35.5 2 12.375 53.2 20.7 13.725000000000001 3 19.675 32.775 21.325 26.224999999999998 4 17.974999999999998 45.025 15.275 21.725 5 16.85 48.175000000000004 17.7 17.275 6 16.45 40.699999999999996 23.474999999999998 19.375 7 12.775 24.4 42.675000000000004 20.150000000000002 8 18.4 22.8 29.725 29.075 9 18.325 23.599999999999998 31.900000000000002 26.174999999999997 10-14 19.405 30.095 26.38 24.12 15-19 19.575 28.875 27.415 24.135 20-24 19.759999999999998 28.689999999999998 27.744999999999997 23.805 25-29 19.48 29.03 27.525 23.965 30-34 19.64 28.599999999999998 28.105000000000004 23.655 35-39 19.675 28.985 27.950000000000003 23.39 40-44 20.119999999999997 28.849999999999998 27.48 23.549999999999997 45-49 19.665 28.29 27.894999999999996 24.15 50-54 20.035 28.825 27.955000000000002 23.185 55-59 20.225 28.715000000000003 27.775 23.285 60-64 19.61 29.160000000000004 27.439999999999998 23.79 65-69 20.424999999999997 28.625 27.71 23.24 70-74 19.325 29.720000000000002 27.465 23.49 75-79 20.044999999999998 28.810000000000002 27.3 23.845 80-84 19.97 28.54 28.075 23.415 85-89 19.935 29.13 26.955000000000002 23.98 90-94 20.150000000000002 28.285 27.73 23.835 95-99 20.200000000000003 28.625 27.925 23.25 100-104 20.25 28.17 27.54 24.04 105-109 20.505000000000003 27.675 27.825 23.995 110-114 20.265 28.194999999999997 27.55 23.990000000000002 115-119 20.369999999999997 28.255000000000003 27.155 24.22 120-124 19.595000000000002 28.799999999999997 27.87 23.735 125-129 20.235 27.694999999999997 27.834999999999997 24.235 130-134 20.595 28.405 27.105 23.895 135-139 20.575 27.33 28.095 24.0 140-144 20.810000000000002 27.725 27.595 23.87 145-149 20.919999999999998 28.105000000000004 27.6 23.375 150-151 20.625 27.375 27.575 24.425 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.5 21 2.0 22 1.5 23 2.0 24 2.5 25 2.0 26 3.5 27 5.5 28 11.5 29 13.0 30 12.5 31 25.0 32 37.5 33 46.0 34 63.0 35 79.5 36 104.0 37 132.5 38 159.0 39 189.5 40 207.0 41 238.5 42 283.0 43 300.5 44 285.5 45 278.0 46 262.5 47 222.0 48 197.0 49 174.5 50 153.0 51 131.0 52 101.0 53 82.0 54 59.0 55 35.5 56 25.0 57 18.5 58 16.0 59 10.5 60 7.0 61 6.0 62 4.0 63 3.0 64 2.0 65 0.5 66 0.0 67 0.0 68 0.0 69 0.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.7491219267436 99.4 2 0.17561465127947817 0.35000000000000003 3 0.050175614651279475 0.15 4 0.025087807325639738 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.21250000000000002 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.25 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.3 0.0 0.0 0.0 0.0 104-105 0.35 0.0 0.0 0.0 0.0 106-107 0.4375 0.0 0.0 0.0 0.0 108-109 0.55 0.0 0.0 0.0 0.0 110-111 0.6 0.0 0.0 0.0 0.0 112-113 0.75 0.0 0.0 0.0 0.0 114-115 0.8 0.0 0.0 0.0 0.0 116-117 0.95 0.0 0.0 0.0 0.0 118-119 1.15 0.0 0.0 0.0 0.0 120-121 1.3624999999999998 0.0 0.0 0.0 0.0 122-123 1.5125 0.0 0.0 0.0 0.0 124-125 1.5750000000000002 0.0 0.0 0.0 0.0 126-127 1.6625 0.0 0.0 0.0 0.0 128-129 1.8 0.0 0.0 0.0 0.0 130-131 1.9375 0.0 0.0 0.0 0.0 132-133 2.25 0.0 0.0 0.0 0.0 134-135 2.4749999999999996 0.0 0.0 0.0 0.0 136-137 2.7875 0.0 0.0 0.0 0.0 138-139 3.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAACTTT 10 0.006830828 145.0 2 AACCTAA 10 0.006830828 145.0 5 AAGCACC 10 0.006830828 145.0 6 >>END_MODULE SRR7171915 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171915_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.83025 33.0 33.0 34.0 32.0 34.0 2 32.907 33.0 33.0 34.0 32.0 34.0 3 32.93175 34.0 33.0 34.0 32.0 34.0 4 32.89525 34.0 33.0 34.0 32.0 34.0 5 32.92125 34.0 33.0 34.0 32.0 34.0 6 36.95925 38.0 38.0 38.0 36.0 38.0 7 37.0685 38.0 38.0 38.0 36.0 38.0 8 37.017 38.0 38.0 38.0 36.0 38.0 9 37.10725 38.0 38.0 38.0 36.0 38.0 10-14 37.022200000000005 38.0 38.0 38.0 36.2 38.0 15-19 37.034200000000006 38.0 38.0 38.0 36.2 38.0 20-24 36.99060000000001 38.0 38.0 38.0 36.0 38.0 25-29 36.96115 38.0 38.0 38.0 36.0 38.0 30-34 36.89985 38.0 38.0 38.0 36.0 38.0 35-39 36.67165 38.0 38.0 38.0 35.4 38.0 40-44 36.63985 38.0 38.0 38.0 35.0 38.0 45-49 36.841499999999996 38.0 38.0 38.0 36.0 38.0 50-54 36.776700000000005 38.0 38.0 38.0 35.6 38.0 55-59 36.767999999999994 38.0 38.0 38.0 35.6 38.0 60-64 36.6996 38.0 38.0 38.0 35.2 38.0 65-69 36.72859999999999 38.0 38.0 38.0 35.0 38.0 70-74 36.66405 38.0 38.0 38.0 35.0 38.0 75-79 36.56875 38.0 38.0 38.0 34.4 38.0 80-84 36.492549999999994 38.0 38.0 38.0 34.2 38.0 85-89 36.4064 38.0 38.0 38.0 34.0 38.0 90-94 36.29375 38.0 38.0 38.0 34.0 38.0 95-99 36.206100000000006 38.0 38.0 38.0 33.4 38.0 100-104 36.07565 38.0 37.6 38.0 33.2 38.0 105-109 35.905899999999995 38.0 37.2 38.0 33.0 38.0 110-114 35.75015 38.0 37.0 38.0 31.2 38.0 115-119 35.653000000000006 38.0 37.0 38.0 30.6 38.0 120-124 35.31224999999999 38.0 36.2 38.0 29.4 38.0 125-129 35.19495 38.0 36.0 38.0 28.8 38.0 130-134 35.0236 38.0 36.0 38.0 28.0 38.0 135-139 34.676750000000006 38.0 35.2 38.0 27.0 38.0 140-144 34.411500000000004 38.0 35.0 38.0 25.6 38.0 145-149 33.8626 38.0 34.6 38.0 22.8 38.0 150-151 30.225749999999998 36.5 29.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 1.0 4 2.0 5 3.0 6 0.0 7 0.0 8 0.0 9 1.0 10 2.0 11 1.0 12 3.0 13 2.0 14 2.0 15 4.0 16 3.0 17 5.0 18 1.0 19 6.0 20 7.0 21 8.0 22 6.0 23 8.0 24 21.0 25 13.0 26 26.0 27 29.0 28 37.0 29 39.0 30 53.0 31 58.0 32 76.0 33 112.0 34 148.0 35 254.0 36 620.0 37 2445.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.824999999999996 18.95 13.775 23.45 2 23.575 24.3 32.95 19.175 3 20.925 27.275 31.900000000000002 19.900000000000002 4 24.825 33.775 22.8 18.6 5 23.65 38.074999999999996 20.1 18.175 6 19.425 37.875 23.25 19.45 7 18.85 18.6 40.75 21.8 8 20.674999999999997 22.05 27.975 29.299999999999997 9 22.95 24.875 27.6 24.575 10-14 23.055 28.915000000000003 26.1 21.93 15-19 23.075000000000003 28.1 27.72 21.105 20-24 22.56 29.025000000000002 27.694999999999997 20.72 25-29 23.035 29.349999999999998 27.1 20.515 30-34 23.070381671752287 28.742934320444203 27.09719373718173 21.08949027062178 35-39 23.326969453376208 28.155144694533764 27.07998392282958 21.43790192926045 40-44 22.728872354331102 28.233874616660803 27.364134533205974 21.67311849580212 45-49 23.155 28.34 27.685 20.82 50-54 22.98 28.634999999999998 27.644999999999996 20.74 55-59 23.005 28.095 27.87 21.029999999999998 60-64 23.165 28.175 27.97 20.69 65-69 22.985 28.549999999999997 27.785 20.68 70-74 23.915 28.555000000000003 27.83 19.7 75-79 23.630000000000003 28.105000000000004 27.389999999999997 20.875 80-84 24.025 27.555000000000003 28.33 20.09 85-89 23.785 28.64 27.24 20.335 90-94 23.655 28.215 27.584999999999997 20.544999999999998 95-99 24.005000000000003 27.889999999999997 27.88 20.225 100-104 24.060000000000002 28.005000000000003 27.700000000000003 20.235 105-109 23.77 28.065 27.905 20.26 110-114 23.51 28.000000000000004 27.634999999999998 20.855 115-119 23.69 28.610000000000003 27.61 20.09 120-124 23.69 27.58 28.115000000000002 20.615 125-129 24.115000000000002 28.675 27.04 20.169999999999998 130-134 23.66 28.16 27.735 20.445 135-139 24.575 27.3 28.54 19.585 140-144 24.175 27.435 28.439999999999998 19.950000000000003 145-149 24.585 28.17 27.82 19.425 150-151 24.65 27.0875 27.900000000000002 20.3625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.5 23 0.5 24 0.5 25 1.0 26 1.5 27 3.0 28 7.5 29 9.0 30 8.5 31 12.5 32 16.0 33 22.0 34 37.0 35 59.5 36 78.5 37 95.0 38 135.0 39 180.0 40 211.5 41 238.0 42 272.5 43 293.5 44 286.5 45 294.5 46 294.5 47 266.5 48 227.5 49 191.0 50 172.5 51 142.0 52 110.0 53 95.0 54 66.5 55 41.5 56 35.5 57 26.0 58 16.5 59 14.0 60 9.5 61 6.5 62 4.5 63 4.0 64 3.0 65 2.0 66 2.5 67 2.5 68 1.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.045 35-39 0.48 40-44 0.545 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74880683245416 99.275 2 0.15071590052750566 0.3 3 0.050238633509168545 0.15 4 0.025119316754584273 0.1 5 0.0 0.0 6 0.0 0.0 7 0.025119316754584273 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTTGAGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTTATCC 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.21250000000000002 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.25 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.3 0.0 0.0 0.0 0.0 104-105 0.35 0.0 0.0 0.0 0.0 106-107 0.4375 0.0 0.0 0.0 0.0 108-109 0.55 0.0 0.0 0.0 0.0 110-111 0.6 0.0 0.0 0.0 0.0 112-113 0.725 0.0 0.0 0.0 0.0 114-115 0.775 0.0 0.0 0.0 0.0 116-117 0.925 0.0 0.0 0.0 0.0 118-119 1.125 0.0 0.0 0.0 0.0 120-121 1.3375 0.0 0.0 0.0 0.0 122-123 1.4875 0.0 0.0 0.0 0.0 124-125 1.5499999999999998 0.0 0.0 0.0 0.0 126-127 1.625 0.0 0.0 0.0 0.0 128-129 1.7374999999999998 0.0 0.0 0.0 0.0 130-131 1.8624999999999998 0.0 0.0 0.0 0.0 132-133 2.175 0.0 0.0 0.0 0.0 134-135 2.3875 0.0 0.0 0.0 0.0 136-137 2.7 0.0 0.0 0.0 0.0 138-139 3.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACACTC 10 0.0068555363 144.825 3 GCAACAT 10 0.0068555363 144.825 1 >>END_MODULE Read 579695 spots for SRR7171915.sra Written 579695 spots for SRR7171915.sra Read 579695 spots for SRR7171915.sra Written 579695 spots for SRR7171915.sra Read 579695 spots for SRR7171915.sra Written 579695 spots for SRR7171915.sra Read 579695 spots for SRR7171915.sra Written 579695 spots for SRR7171915.sra Read 579695 spots for SRR7171915.sra Written 579695 spots for SRR7171915.sra Read 579695 spots for SRR7171915.sra Written 579695 spots for SRR7171915.sra Read 579695 spots for SRR7171915.sra Written 579695 spots for SRR7171915.sra Read 579695 spots for SRR7171915.sra Written 579695 spots for SRR7171915.sra Read 579695 spots for SRR7171915.sra Written 579695 spots for SRR7171915.sra Read 579695 spots for SRR7171915.sra Written 579695 spots for SRR7171915.sra Read 579695 spots for SRR7171915.sra Written 579695 spots for SRR7171915.sra Read 579695 spots for SRR7171915.sra Written 579695 spots for SRR7171915.sra Read 579695 spots for SRR7171915.sra Written 579695 spots for SRR7171915.sra Read 579695 spots for SRR7171915.sra Written 579695 spots for SRR7171915.sra Read 579695 spots for SRR7171915.sra Written 579695 spots for SRR7171915.sra Read 579695 spots for SRR7171915.sra Written 579695 spots for SRR7171915.sra Read 579695 spots for SRR7171915.sra Written 579695 spots for SRR7171915.sra Read 579695 spots for SRR7171915.sra Written 579695 spots for SRR7171915.sra Read 579700 spots for SRR7171915.sra Written 579700 spots for SRR7171915.sra Read 579695 spots for SRR7171915.sra Written 579695 spots for SRR7171915.sra SRR ids: ['SRR7171915.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_69mj_gbf SRR7171915.sra spots: 11593905 blocks: [[1, 579695], [579696, 1159390], [1159391, 1739085], [1739086, 2318780], [2318781, 2898475], [2898476, 3478170], [3478171, 4057865], [4057866, 4637560], [4637561, 5217255], [5217256, 5796950], [5796951, 6376645], [6376646, 6956340], [6956341, 7536035], [7536036, 8115730], [8115731, 8695425], [8695426, 9275120], [9275121, 9854815], [9854816, 10434510], [10434511, 11014205], [11014206, 11593905]] SRR7171915 file size 3907093 SRR7171915 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171915 SRR7171915_1.fastq SRR7171915_2.fastq Input file: SRR7171915_1.fastq Paired file: SRR7171915_2.fastq trimmed: SRR7171915-trimmed-pair1.fastq, SRR7171915-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 13:26:00 2025 >> started Fri Feb 14 13:26:21 2025 >> done (21.081s) 11593905 read pairs processed; of these: 10975 ( 0.09%) short read pairs filtered out after trimming by size control 7902 ( 0.07%) empty read pairs filtered out after trimming by size control 11575028 (99.84%) read pairs available; of these: 4875081 (42.12%) trimmed read pairs available after processing 6699947 (57.88%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 5 0.00% 21 3 0.00% 22 1 0.00% 23 2 0.00% 24 2 0.00% 25 2 0.00% 26 3 0.00% 27 4 0.00% 28 1 0.00% 29 4 0.00% 30 4 0.00% 31 4 0.00% 32 6 0.00% 33 6 0.00% 34 1 0.00% 35 4 0.00% 36 5 0.00% 37 1 0.00% 38 6 0.00% 39 3 0.00% 40 5 0.00% 41 6 0.00% 42 7 0.00% 43 11 0.00% 44 16 0.00% 45 9 0.00% 46 6 0.00% 47 15 0.00% 48 15 0.00% 49 21 0.00% 50 16 0.00% 51 25 0.00% 52 22 0.00% 53 20 0.00% 54 29 0.00% 55 32 0.00% 56 29 0.00% 57 35 0.00% 58 53 0.00% 59 64 0.00% 60 59 0.00% 61 78 0.00% 62 81 0.00% 63 94 0.00% 64 95 0.00% 65 113 0.00% 66 133 0.00% 67 152 0.00% 68 162 0.00% 69 182 0.00% 70 231 0.00% 71 241 0.00% 72 275 0.00% 73 324 0.00% 74 377 0.00% 75 401 0.00% 76 534 0.00% 77 571 0.00% 78 650 0.01% 79 665 0.01% 80 767 0.01% 81 916 0.01% 82 1037 0.01% 83 1228 0.01% 84 1708 0.01% 85 2164 0.02% 86 2228 0.02% 87 2516 0.02% 88 2551 0.02% 89 2756 0.02% 90 2935 0.03% 91 3019 0.03% 92 3333 0.03% 93 3448 0.03% 94 3791 0.03% 95 4005 0.03% 96 4189 0.04% 97 4370 0.04% 98 4571 0.04% 99 4892 0.04% 100 5153 0.04% 101 5508 0.05% 102 5901 0.05% 103 6213 0.05% 104 6570 0.06% 105 7044 0.06% 106 7321 0.06% 107 7601 0.07% 108 7831 0.07% 109 8354 0.07% 110 8860 0.08% 111 9180 0.08% 112 9933 0.09% 113 10573 0.09% 114 11081 0.10% 115 11866 0.10% 116 12107 0.10% 117 12678 0.11% 118 13276 0.11% 119 13660 0.12% 120 14292 0.12% 121 14964 0.13% 122 15816 0.14% 123 16610 0.14% 124 17959 0.16% 125 18796 0.16% 126 19409 0.17% 127 20535 0.18% 128 21000 0.18% 129 22130 0.19% 130 23385 0.20% 131 24574 0.21% 132 26286 0.23% 133 28362 0.25% 134 30507 0.26% 135 32560 0.28% 136 34562 0.30% 137 37212 0.32% 138 39960 0.35% 139 42954 0.37% 140 47296 0.41% 141 52409 0.45% 142 59458 0.51% 143 68157 0.59% 144 79791 0.69% 145 97650 0.84% 146 124459 1.08% 147 172573 1.49% 148 268337 2.32% 149 541907 4.68% 150 2618114 22.62% 151 6699947 57.88% 11575028 reads passed initial QC criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=3.61 fanout-score-rank=20 prefix-density=0.57 prefix-fanout=3.3 sequence=CCACATTTGCAGCCA criterion=fanout-score sequence-density=0.06 sequence-density-rank=32 fanout-score=20.70 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=6.7 sequence=ACATTGTCAATGGTATCAGAGCTCTCCACCTCCAAGGTGATGGTCTT criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=3.54 fanout-score-rank=18 prefix-density=0.73 prefix-fanout=3.0 sequence=TGCAAGTGCGGCAGTG criterion=fanout-score sequence-density=0.02 sequence-density-rank=31 fanout-score=87.89 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=11.9 sequence=AAGAAAAACAAAAAAGAAATGGATGCCAAAGCTCTCTTCTTCTTTGCCTTGTTGTCCTTCTCAGCTGTGTCGGTCAGGCCGGCATTAGCAGAAAATGAAGAAGACCCTGGTCTTGTTATGAACTTTTACAAGGATACATGCCCTCAAGCTGAGGACATTGTCAAAGAACAAGTTAGACTCCTTTACAAGAGACACAAAAACACTGCATTTTCTTGGCTAAGAAACATCTTCCATGACTGTGCTGTTCAGTCATGTGATGCTTCACTGCTGCTGGACTCAACAAGGAGGACCTTGTCCGAGAAGGAGACAGACAGGAGCTTTGGCCTCAGGAACTTTAGATACTTTGACGATATCAAAGAAGCTGTTGAAAGAGAGTGTCCTGGAGTCGTTTCCTGTGCTGATATTCTTGTCCTGTCTGCTAGAGATGGCATTGTTTCGCTAGGAGGACCTCATATCCCTCTCAAAACTGGAAGAAGGGATGGCAGGAAGAGCAGAGCAGATGTGATCGAGG SRR7171915 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 13:27:22 Started mapping on | Feb 14 13:27:22 Finished on | Feb 14 13:29:21 Mapping speed, Million of reads per hour | 350.17 Number of input reads | 11575028 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 10684917 Uniquely mapped reads % | 92.31% Average mapped length | 296.18 Number of splices: Total | 10993298 Number of splices: Annotated (sjdb) | 10793471 Number of splices: GT/AG | 10818715 Number of splices: GC/AG | 139764 Number of splices: AT/AC | 8014 Number of splices: Non-canonical | 26805 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.50 Insertion rate per base | 0.02% Insertion average length | 2.56 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 279388 % of reads mapped to multiple loci | 2.41% Number of reads mapped to too many loci | 34005 % of reads mapped to too many loci | 0.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.89% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 620966 620966 620966 N_multimapping 279388 279388 279388 N_noFeature 243243 10579445 294550 N_ambiguous 106456 582 51958 UnstrandedReadsAssigned:10335218 PositiveStrandReadsAssigned:104890 NegativeStrandReadsAssigned:10338409 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7171915 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171915-trimmed-pair1.fastq SRR7171915-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,575,028 reads, 10,222,095 reads pseudoaligned [quant] estimated average fragment length: 256.922 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,118 rounds 52401 SRR7171915.ke.tsv 34699 SRR7171915.se.tsv 87100 total ==> SRR7171915.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1762.08 916 44.5808 Potri.005G024800.1.v4.1 1035 779.078 186 20.4743 Potri.004G059700.1.v4.1 961 705.112 13 1.58111 Potri.007G009000.2.v4.1 1416 1160.08 0 0 Potri.003G141000.2.v4.1 2943 2687.08 438 13.9789 Potri.016G087400.1.v4.1 270 71.8478 809 965.635 Potri.015G069301.1.v4.1 564 314.238 0 0 Potri.010G195200.1.v4.1 1773 1517.08 321 18.1458 Potri.012G127500.1.v4.1 977 721.084 2672 317.781 ==> SRR7171915.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 33 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 290 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 257 SRR7171915 completed mapping pipeline successfully