Starting /dee2/code/volunteer_pipeline.sh SRR7171916 current disk space = 3110867099648 free memory = 1467308156 SRR7171916 SRAfilesize 850688c3c8b00c15d8052623b79f762b SRR7171916.sra SRR7171916.sra file validated SRR7171916 is paired end SRR7171916 is conventional basespace SRR7171916 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171916_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.67875 32.0 28.0 33.0 18.0 34.0 2 32.20025 33.0 31.0 34.0 29.0 34.0 3 31.76775 33.0 31.0 33.0 29.0 34.0 4 32.484 33.0 33.0 33.0 32.0 34.0 5 32.93375 33.0 33.0 34.0 33.0 34.0 6 36.6325 38.0 37.0 38.0 34.0 38.0 7 36.79825 38.0 37.0 38.0 34.0 38.0 8 37.353 38.0 38.0 38.0 36.0 38.0 9 37.51475 38.0 38.0 38.0 37.0 38.0 10-14 37.55915 38.0 38.0 38.0 37.0 38.0 15-19 37.556000000000004 38.0 38.0 38.0 37.6 38.0 20-24 37.56015 38.0 38.0 38.0 37.8 38.0 25-29 37.52 38.0 38.0 38.0 37.6 38.0 30-34 37.49735 38.0 38.0 38.0 37.2 38.0 35-39 37.46045 38.0 38.0 38.0 37.0 38.0 40-44 37.419050000000006 38.0 38.0 38.0 37.0 38.0 45-49 37.398700000000005 38.0 38.0 38.0 37.0 38.0 50-54 37.3248 38.0 38.0 38.0 36.8 38.0 55-59 37.229800000000004 38.0 38.0 38.0 36.8 38.0 60-64 37.2245 38.0 38.0 38.0 36.2 38.0 65-69 37.16725 38.0 38.0 38.0 36.0 38.0 70-74 37.103699999999996 38.0 38.0 38.0 36.0 38.0 75-79 36.978100000000005 38.0 38.0 38.0 36.0 38.0 80-84 36.9389 38.0 38.0 38.0 36.0 38.0 85-89 36.90755 38.0 38.0 38.0 36.0 38.0 90-94 36.787 38.0 38.0 38.0 35.0 38.0 95-99 36.67305 38.0 38.0 38.0 34.4 38.0 100-104 36.58395 38.0 38.0 38.0 34.2 38.0 105-109 36.37485 38.0 37.8 38.0 34.0 38.0 110-114 36.22775 38.0 37.4 38.0 33.6 38.0 115-119 36.158300000000004 38.0 37.4 38.0 33.6 38.0 120-124 35.970299999999995 38.0 36.8 38.0 32.6 38.0 125-129 35.6484 38.0 36.4 38.0 31.4 38.0 130-134 35.447500000000005 38.0 36.0 38.0 31.0 38.0 135-139 35.08315 38.0 35.8 38.0 29.0 38.0 140-144 34.7467 38.0 35.0 38.0 27.4 38.0 145-149 34.26525 38.0 35.0 38.0 25.8 38.0 150-151 31.08325 36.5 31.5 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 0.0 12 1.0 13 1.0 14 1.0 15 1.0 16 3.0 17 0.0 18 3.0 19 3.0 20 3.0 21 3.0 22 7.0 23 9.0 24 7.0 25 7.0 26 7.0 27 20.0 28 21.0 29 23.0 30 22.0 31 39.0 32 70.0 33 97.0 34 128.0 35 318.0 36 748.0 37 2457.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.725 12.325 13.125 35.825 2 20.41531148361271 17.788341255941955 36.35226419814861 25.444083062296723 3 20.05 23.875 25.374999999999996 30.7 4 21.3 33.475 22.375 22.85 5 21.375 33.475 25.45 19.7 6 18.7 34.300000000000004 26.85 20.150000000000002 7 13.600000000000001 23.175 44.474999999999994 18.75 8 17.875 22.775000000000002 30.875000000000004 28.475 9 18.25 23.200000000000003 32.525 26.025 10-14 19.865 29.970000000000002 26.729999999999997 23.435 15-19 20.04 28.24 27.735 23.985 20-24 19.470000000000002 28.92 27.750000000000004 23.86 25-29 19.439999999999998 28.865000000000002 27.615000000000002 24.08 30-34 19.98 29.459999999999997 27.235 23.325000000000003 35-39 20.0 28.87 27.46 23.669999999999998 40-44 19.7 28.18 27.900000000000002 24.22 45-49 20.150000000000002 28.299999999999997 27.750000000000004 23.799999999999997 50-54 20.16 28.915000000000003 27.169999999999998 23.755000000000003 55-59 19.64 28.49 28.144999999999996 23.724999999999998 60-64 19.81 29.044999999999998 27.47 23.674999999999997 65-69 20.765 28.105000000000004 26.99 24.14 70-74 20.525 28.255000000000003 27.54 23.68 75-79 20.405 28.48 27.425 23.69 80-84 20.830000000000002 28.37 27.055 23.745 85-89 19.84 28.804999999999996 27.985 23.369999999999997 90-94 20.36 28.215 27.77 23.655 95-99 20.765 27.96 27.310000000000002 23.965 100-104 20.674999999999997 28.08 27.785 23.46 105-109 20.335 28.455000000000002 27.49 23.72 110-114 20.28 29.015 26.939999999999998 23.765 115-119 20.53 27.800000000000004 27.68 23.990000000000002 120-124 20.495 28.355000000000004 27.66 23.49 125-129 20.73 27.87 27.650000000000002 23.75 130-134 20.635 27.750000000000004 27.465 24.15 135-139 20.74 28.155 27.189999999999998 23.915 140-144 20.244999999999997 28.275 27.12 24.36 145-149 20.45 28.335 27.35 23.865 150-151 20.375 29.012500000000003 26.5125 24.099999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 1.5 22 4.0 23 4.0 24 4.5 25 6.0 26 5.0 27 6.5 28 9.5 29 15.0 30 17.0 31 18.5 32 28.0 33 45.5 34 59.5 35 67.5 36 81.5 37 90.0 38 118.0 39 160.0 40 194.5 41 215.0 42 229.0 43 256.5 44 280.0 45 281.0 46 270.5 47 254.5 48 243.0 49 217.0 50 188.5 51 160.0 52 107.5 53 87.0 54 73.5 55 48.0 56 34.0 57 28.5 58 26.5 59 19.0 60 11.0 61 7.5 62 7.5 63 6.0 64 3.5 65 2.0 66 1.0 67 1.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.0625 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.1125 0.0 0.0 0.0 0.0 106-107 0.16249999999999998 0.0 0.0 0.0 0.0 108-109 0.225 0.0 0.0 0.0 0.0 110-111 0.275 0.0 0.0 0.0 0.0 112-113 0.3 0.0 0.0 0.0 0.0 114-115 0.375 0.0 0.0 0.0 0.0 116-117 0.44999999999999996 0.0 0.0 0.0 0.0 118-119 0.5125 0.0 0.0 0.0 0.0 120-121 0.625 0.0 0.0 0.0 0.0 122-123 0.6625000000000001 0.0 0.0 0.0 0.0 124-125 0.7 0.0 0.0 0.0 0.0 126-127 0.75 0.0 0.0 0.0 0.0 128-129 0.9125 0.0 0.0 0.0 0.0 130-131 1.075 0.0 0.0 0.0 0.0 132-133 1.2125 0.0 0.0 0.0 0.0 134-135 1.475 0.0 0.0 0.0 0.0 136-137 1.625 0.0 0.0 0.0 0.0 138-139 1.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCATTTT 10 0.006830828 145.0 2 TTTTTTT 40 0.0076550315 18.125 140-144 >>END_MODULE SRR7171916 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171916_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.03925 33.0 33.0 34.0 32.0 34.0 2 33.13925 34.0 33.0 34.0 33.0 34.0 3 33.16475 34.0 33.0 34.0 33.0 34.0 4 33.15725 34.0 33.0 34.0 33.0 34.0 5 33.14975 34.0 33.0 34.0 33.0 34.0 6 37.42825 38.0 38.0 38.0 38.0 38.0 7 37.341 38.0 38.0 38.0 38.0 38.0 8 37.33925 38.0 38.0 38.0 37.0 38.0 9 37.37375 38.0 38.0 38.0 38.0 38.0 10-14 37.286699999999996 38.0 38.0 38.0 37.0 38.0 15-19 37.222699999999996 38.0 38.0 38.0 37.0 38.0 20-24 37.23555 38.0 38.0 38.0 37.0 38.0 25-29 37.2264 38.0 38.0 38.0 37.0 38.0 30-34 37.16180000000001 38.0 38.0 38.0 37.0 38.0 35-39 36.93325 38.0 38.0 38.0 36.8 38.0 40-44 36.5916 38.0 38.0 38.0 36.0 38.0 45-49 37.08705 38.0 38.0 38.0 36.8 38.0 50-54 37.095600000000005 38.0 38.0 38.0 37.0 38.0 55-59 37.0741 38.0 38.0 38.0 37.0 38.0 60-64 37.008599999999994 38.0 38.0 38.0 36.2 38.0 65-69 36.958549999999995 38.0 38.0 38.0 36.0 38.0 70-74 36.913 38.0 38.0 38.0 36.0 38.0 75-79 36.861749999999994 38.0 38.0 38.0 36.0 38.0 80-84 36.81165 38.0 38.0 38.0 36.0 38.0 85-89 36.7124 38.0 38.0 38.0 35.6 38.0 90-94 36.5885 38.0 38.0 38.0 35.0 38.0 95-99 36.46225 38.0 38.0 38.0 34.6 38.0 100-104 36.37035 38.0 38.0 38.0 34.0 38.0 105-109 36.220549999999996 38.0 38.0 38.0 34.0 38.0 110-114 36.15659999999999 38.0 38.0 38.0 33.8 38.0 115-119 36.0526 38.0 37.8 38.0 34.0 38.0 120-124 35.834950000000006 38.0 37.2 38.0 33.0 38.0 125-129 35.62695 38.0 36.8 38.0 31.4 38.0 130-134 35.273900000000005 38.0 36.0 38.0 30.4 38.0 135-139 35.1601 38.0 36.0 38.0 29.6 38.0 140-144 34.78245 38.0 35.4 38.0 28.0 38.0 145-149 34.331450000000004 38.0 35.0 38.0 26.8 38.0 150-151 30.908 35.5 30.5 38.0 14.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 6.0 4 1.0 5 0.0 6 1.0 7 2.0 8 0.0 9 0.0 10 2.0 11 2.0 12 1.0 13 3.0 14 5.0 15 0.0 16 2.0 17 2.0 18 2.0 19 6.0 20 4.0 21 8.0 22 7.0 23 6.0 24 10.0 25 17.0 26 11.0 27 18.0 28 24.0 29 27.0 30 26.0 31 47.0 32 62.0 33 89.0 34 109.0 35 218.0 36 616.0 37 2660.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.65 17.275 17.025000000000002 27.05 2 24.9 24.4 32.675 18.025 3 21.325 27.925 30.2 20.549999999999997 4 24.45 34.075 22.15 19.325 5 23.525 37.25 21.825 17.4 6 19.45 36.85 24.15 19.55 7 19.875 17.95 39.975 22.2 8 19.75 23.849999999999998 27.700000000000003 28.7 9 22.325 25.35 27.875 24.45 10-14 23.165 28.925 26.11 21.8 15-19 22.855 27.79 27.54 21.815 20-24 22.875 28.315 27.650000000000002 21.16 25-29 23.195 28.144999999999996 27.77 20.89 30-34 22.669735327963174 27.703006954520436 28.54855656176515 21.07870115575124 35-39 23.43207765427752 27.84791027510939 27.60649801337826 21.113514057234823 40-44 23.792631632291087 27.882227740333455 27.248771094106317 21.076369533269144 45-49 23.895 27.49 28.050000000000004 20.565 50-54 24.005000000000003 27.82 27.279999999999998 20.895 55-59 23.244999999999997 28.17 27.93 20.655 60-64 23.96 28.470000000000002 26.875 20.695 65-69 23.31 28.21 27.26 21.22 70-74 23.200000000000003 27.975 27.925 20.9 75-79 23.805 27.575 27.235 21.385 80-84 24.154999999999998 27.915 27.48 20.45 85-89 24.05 27.87 27.400000000000002 20.68 90-94 23.74 28.02 27.384999999999998 20.855 95-99 23.7 27.845 26.88 21.575 100-104 23.87 27.3 27.725 21.105 105-109 23.990000000000002 26.895000000000003 27.965 21.15 110-114 24.29 27.694999999999997 27.74 20.275000000000002 115-119 23.69 28.075 27.6 20.635 120-124 23.45 27.715 27.785 21.05 125-129 24.315 27.485 27.865000000000002 20.335 130-134 23.815 28.555000000000003 27.21 20.419999999999998 135-139 23.810000000000002 28.125 27.595 20.47 140-144 24.03 27.950000000000003 27.505000000000003 20.515 145-149 23.98 27.435 28.244999999999997 20.34 150-151 24.1625 28.000000000000004 27.287499999999998 20.549999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 1.0 19 1.0 20 0.0 21 0.0 22 0.5 23 0.5 24 1.0 25 2.5 26 2.5 27 3.0 28 5.0 29 6.0 30 9.5 31 15.5 32 17.5 33 22.0 34 32.5 35 53.0 36 67.5 37 82.5 38 121.0 39 155.0 40 190.5 41 229.5 42 269.5 43 280.5 44 273.5 45 299.5 46 291.5 47 262.5 48 245.0 49 216.0 50 178.5 51 147.5 52 121.5 53 98.5 54 82.0 55 58.0 56 40.0 57 31.5 58 24.0 59 16.5 60 9.5 61 5.0 62 6.0 63 6.0 64 3.0 65 3.5 66 3.5 67 3.0 68 2.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.065 35-39 0.585 40-44 1.335 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74931060416145 99.47500000000001 2 0.22562045625470042 0.44999999999999996 3 0.0250689395838556 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.0875 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1375 0.0 0.0 0.0 0.0 106-107 0.1875 0.0 0.0 0.0 0.0 108-109 0.25 0.0 0.0 0.0 0.0 110-111 0.3 0.0 0.0 0.0 0.0 112-113 0.325 0.0 0.0 0.0 0.0 114-115 0.4 0.0 0.0 0.0 0.0 116-117 0.475 0.0 0.0 0.0 0.0 118-119 0.5375 0.0 0.0 0.0 0.0 120-121 0.65 0.0 0.0 0.0 0.0 122-123 0.6875 0.0 0.0 0.0 0.0 124-125 0.725 0.0 0.0 0.0 0.0 126-127 0.775 0.0 0.0 0.0 0.0 128-129 0.9375 0.0 0.0 0.0 0.0 130-131 1.1 0.0 0.0 0.0 0.0 132-133 1.2375 0.0 0.0 0.0 0.0 134-135 1.5 0.0 0.0 0.0 0.0 136-137 1.6375 0.0 0.0 0.0 0.0 138-139 1.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGGCAA 10 0.006883923 144.625 7 >>END_MODULE Read 891668 spots for SRR7171916.sra Written 891668 spots for SRR7171916.sra Read 891668 spots for SRR7171916.sra Written 891668 spots for SRR7171916.sra Read 891668 spots for SRR7171916.sra Written 891668 spots for SRR7171916.sra Read 891668 spots for SRR7171916.sra Written 891668 spots for SRR7171916.sra Read 891668 spots for SRR7171916.sra Written 891668 spots for SRR7171916.sra Read 891668 spots for SRR7171916.sra Written 891668 spots for SRR7171916.sra Read 891668 spots for SRR7171916.sra Written 891668 spots for SRR7171916.sra Read 891668 spots for SRR7171916.sra Written 891668 spots for SRR7171916.sra Read 891668 spots for SRR7171916.sra Written 891668 spots for SRR7171916.sra Read 891668 spots for SRR7171916.sra Written 891668 spots for SRR7171916.sra Read 891668 spots for SRR7171916.sra Written 891668 spots for SRR7171916.sra Read 891668 spots for SRR7171916.sra Written 891668 spots for SRR7171916.sra Read 891668 spots for SRR7171916.sra Written 891668 spots for SRR7171916.sra Read 891668 spots for SRR7171916.sra Written 891668 spots for SRR7171916.sra Read 891668 spots for SRR7171916.sra Written 891668 spots for SRR7171916.sra Read 891668 spots for SRR7171916.sra Written 891668 spots for SRR7171916.sra Read 891668 spots for SRR7171916.sra Written 891668 spots for SRR7171916.sra Read 891668 spots for SRR7171916.sra Written 891668 spots for SRR7171916.sra Read 891668 spots for SRR7171916.sra Written 891668 spots for SRR7171916.sra Read 891686 spots for SRR7171916.sra Written 891686 spots for SRR7171916.sra SRR ids: ['SRR7171916.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1objz1yf SRR7171916.sra spots: 17833378 blocks: [[1, 891668], [891669, 1783336], [1783337, 2675004], [2675005, 3566672], [3566673, 4458340], [4458341, 5350008], [5350009, 6241676], [6241677, 7133344], [7133345, 8025012], [8025013, 8916680], [8916681, 9808348], [9808349, 10700016], [10700017, 11591684], [11591685, 12483352], [12483353, 13375020], [13375021, 14266688], [14266689, 15158356], [15158357, 16050024], [16050025, 16941692], [16941693, 17833378]] SRR7171916 file size 6021446 SRR7171916 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171916 SRR7171916_1.fastq SRR7171916_2.fastq Input file: SRR7171916_1.fastq Paired file: SRR7171916_2.fastq trimmed: SRR7171916-trimmed-pair1.fastq, SRR7171916-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 14:05:05 2025 >> started Fri Feb 14 14:05:25 2025 >> done (19.835s) 17833378 read pairs processed; of these: 19504 ( 0.11%) short read pairs filtered out after trimming by size control 12675 ( 0.07%) empty read pairs filtered out after trimming by size control 17801199 (99.82%) read pairs available; of these: 7684845 (43.17%) trimmed read pairs available after processing 10116354 (56.83%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 4 0.00% 20 6 0.00% 21 5 0.00% 22 10 0.00% 23 8 0.00% 24 10 0.00% 25 5 0.00% 26 6 0.00% 27 9 0.00% 28 5 0.00% 29 9 0.00% 30 4 0.00% 31 9 0.00% 32 4 0.00% 33 12 0.00% 34 2 0.00% 35 5 0.00% 36 12 0.00% 37 9 0.00% 38 6 0.00% 39 10 0.00% 40 10 0.00% 41 11 0.00% 42 6 0.00% 43 13 0.00% 44 16 0.00% 45 10 0.00% 46 12 0.00% 47 15 0.00% 48 24 0.00% 49 16 0.00% 50 25 0.00% 51 37 0.00% 52 34 0.00% 53 26 0.00% 54 41 0.00% 55 39 0.00% 56 41 0.00% 57 42 0.00% 58 57 0.00% 59 51 0.00% 60 78 0.00% 61 65 0.00% 62 78 0.00% 63 85 0.00% 64 108 0.00% 65 92 0.00% 66 111 0.00% 67 134 0.00% 68 143 0.00% 69 168 0.00% 70 192 0.00% 71 206 0.00% 72 212 0.00% 73 270 0.00% 74 299 0.00% 75 386 0.00% 76 464 0.00% 77 486 0.00% 78 450 0.00% 79 555 0.00% 80 674 0.00% 81 700 0.00% 82 823 0.00% 83 1008 0.01% 84 1910 0.01% 85 2499 0.01% 86 2597 0.01% 87 3005 0.02% 88 3131 0.02% 89 3141 0.02% 90 3181 0.02% 91 3462 0.02% 92 3678 0.02% 93 3750 0.02% 94 3979 0.02% 95 4061 0.02% 96 4406 0.02% 97 4690 0.03% 98 4933 0.03% 99 5296 0.03% 100 5619 0.03% 101 6039 0.03% 102 6399 0.04% 103 6898 0.04% 104 7166 0.04% 105 7830 0.04% 106 8371 0.05% 107 8910 0.05% 108 9285 0.05% 109 9773 0.05% 110 10428 0.06% 111 11074 0.06% 112 11932 0.07% 113 12612 0.07% 114 13389 0.08% 115 14301 0.08% 116 14879 0.08% 117 15707 0.09% 118 16631 0.09% 119 17182 0.10% 120 18073 0.10% 121 19124 0.11% 122 20024 0.11% 123 21160 0.12% 124 22149 0.12% 125 23676 0.13% 126 24789 0.14% 127 26340 0.15% 128 28220 0.16% 129 29756 0.17% 130 31056 0.17% 131 32934 0.19% 132 35472 0.20% 133 38327 0.22% 134 40502 0.23% 135 43810 0.25% 136 47365 0.27% 137 50892 0.29% 138 55249 0.31% 139 60682 0.34% 140 66448 0.37% 141 75014 0.42% 142 85262 0.48% 143 98785 0.55% 144 119270 0.67% 145 148019 0.83% 146 192901 1.08% 147 271006 1.52% 148 434785 2.44% 149 903363 5.07% 150 4339779 24.38% 151 10116354 56.83% 17801199 reads passed initial QC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=2.80 fanout-score-rank=33 prefix-density=0.38 prefix-fanout=2.0 sequence=CACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.09 sequence-density-rank=18 fanout-score=360.42 fanout-score-rank=1 prefix-density=0.96 prefix-fanout=33.5 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=2.21 fanout-score-rank=34 prefix-density=0.39 prefix-fanout=2.1 sequence=ATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.09 sequence-density-rank=19 fanout-score=116.13 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=22.9 sequence=GAAGAAGAGAGG SRR7171916 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 14:06:36 Started mapping on | Feb 14 14:06:36 Finished on | Feb 14 14:08:34 Mapping speed, Million of reads per hour | 543.09 Number of input reads | 17801199 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 16601446 Uniquely mapped reads % | 93.26% Average mapped length | 296.97 Number of splices: Total | 16502723 Number of splices: Annotated (sjdb) | 16233148 Number of splices: GT/AG | 16251447 Number of splices: GC/AG | 201695 Number of splices: AT/AC | 11786 Number of splices: Non-canonical | 37795 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.85 Insertion rate per base | 0.02% Insertion average length | 2.62 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 439088 % of reads mapped to multiple loci | 2.47% Number of reads mapped to too many loci | 49910 % of reads mapped to too many loci | 0.28% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.92% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 780946 780946 780946 N_multimapping 439088 439088 439088 N_noFeature 344990 16430069 432295 N_ambiguous 177186 1324 92099 UnstrandedReadsAssigned:16079270 PositiveStrandReadsAssigned:170053 NegativeStrandReadsAssigned:16077052 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7171916 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171916-trimmed-pair1.fastq SRR7171916-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,801,199 reads, 15,906,047 reads pseudoaligned [quant] estimated average fragment length: 267.809 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,091 rounds 52401 SRR7171916.ke.tsv 34699 SRR7171916.se.tsv 87100 total ==> SRR7171916.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1751.19 1061 33.4328 Potri.005G024800.1.v4.1 1035 768.191 114 8.18891 Potri.004G059700.1.v4.1 961 694.226 58 4.61017 Potri.007G009000.2.v4.1 1416 1149.19 0 0 Potri.003G141000.2.v4.1 2943 2676.19 388.341 8.0073 Potri.016G087400.1.v4.1 270 65.8132 1624 1361.64 Potri.015G069301.1.v4.1 564 303.407 0 0 Potri.010G195200.1.v4.1 1773 1506.19 223.73 8.1966 Potri.012G127500.1.v4.1 977 710.215 3811 296.101 ==> SRR7171916.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 33 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 337 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 4 Potri.001G452600.v4.1 265 SRR7171916 completed mapping pipeline successfully