Starting /dee2/code/volunteer_pipeline.sh SRR7171917 current disk space = 3110153211904 free memory = 1284644620 SRR7171917 SRAfilesize c6ed416b001cb8fa1ac3423ed6588013 SRR7171917.sra SRR7171917.sra file validated SRR7171917 is paired end SRR7171917 is conventional basespace SRR7171917 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171917_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.2725 33.0 32.0 33.0 32.0 33.0 2 26.7395 28.0 18.0 32.0 18.0 33.0 3 30.25925 31.0 29.0 33.0 27.0 33.0 4 32.092 33.0 32.0 33.0 32.0 33.0 5 32.09625 33.0 32.0 33.0 31.0 33.0 6 36.04625 38.0 36.0 38.0 33.0 38.0 7 37.0475 38.0 38.0 38.0 36.0 38.0 8 37.20025 38.0 38.0 38.0 36.0 38.0 9 37.52225 38.0 38.0 38.0 37.0 38.0 10-14 37.4895 38.0 38.0 38.0 37.2 38.0 15-19 37.53009999999999 38.0 38.0 38.0 38.0 38.0 20-24 37.488 38.0 38.0 38.0 37.6 38.0 25-29 37.5286 38.0 38.0 38.0 38.0 38.0 30-34 37.472300000000004 38.0 38.0 38.0 37.2 38.0 35-39 37.4099 38.0 38.0 38.0 37.2 38.0 40-44 37.434450000000005 38.0 38.0 38.0 37.0 38.0 45-49 37.3735 38.0 38.0 38.0 37.0 38.0 50-54 37.39725 38.0 38.0 38.0 37.0 38.0 55-59 37.3506 38.0 38.0 38.0 37.0 38.0 60-64 37.291149999999995 38.0 38.0 38.0 37.0 38.0 65-69 37.25319999999999 38.0 38.0 38.0 37.0 38.0 70-74 37.1967 38.0 38.0 38.0 36.6 38.0 75-79 37.153549999999996 38.0 38.0 38.0 36.4 38.0 80-84 37.06905 38.0 38.0 38.0 36.0 38.0 85-89 37.13275 38.0 38.0 38.0 36.2 38.0 90-94 36.9929 38.0 38.0 38.0 36.0 38.0 95-99 36.9193 38.0 38.0 38.0 35.8 38.0 100-104 36.8922 38.0 38.0 38.0 35.2 38.0 105-109 36.75715 38.0 38.0 38.0 35.0 38.0 110-114 36.623749999999994 38.0 38.0 38.0 34.4 38.0 115-119 36.55275 38.0 38.0 38.0 34.0 38.0 120-124 36.443599999999996 38.0 38.0 38.0 34.0 38.0 125-129 36.1641 38.0 37.6 38.0 33.6 38.0 130-134 35.91205 38.0 37.0 38.0 32.8 38.0 135-139 35.84974999999999 38.0 36.6 38.0 32.8 38.0 140-144 35.59665 38.0 36.0 38.0 31.8 38.0 145-149 35.25815 38.0 36.0 38.0 31.0 38.0 150-151 32.42525 36.5 33.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 0.0 15 0.0 16 0.0 17 0.0 18 4.0 19 5.0 20 2.0 21 1.0 22 3.0 23 3.0 24 6.0 25 8.0 26 14.0 27 12.0 28 16.0 29 30.0 30 25.0 31 37.0 32 60.0 33 82.0 34 111.0 35 213.0 36 599.0 37 2766.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.69430051813472 15.207253886010363 10.518134715025907 36.58031088082902 2 19.325 19.375 35.449999999999996 25.85 3 19.1 23.95 24.5 32.45 4 21.775 34.2 20.599999999999998 23.425 5 21.85 35.4 24.425 18.325 6 17.675 36.125 26.1 20.1 7 13.375 22.725 44.975 18.925 8 17.275 22.975 30.55 29.2 9 17.775 24.075 31.65 26.5 10-14 19.52 29.520000000000003 26.93 24.03 15-19 20.27 28.349999999999998 27.975 23.405 20-24 20.01 29.049999999999997 27.465 23.474999999999998 25-29 19.950000000000003 28.79 27.505000000000003 23.755000000000003 30-34 19.655 28.549999999999997 27.900000000000002 23.895 35-39 20.424999999999997 28.525 27.389999999999997 23.66 40-44 19.965 28.525 28.194999999999997 23.315 45-49 20.095 27.815 27.92 24.169999999999998 50-54 19.74 28.175 28.375 23.71 55-59 20.105 28.384999999999998 27.725 23.785 60-64 19.975 28.49 28.02 23.515 65-69 19.895 28.28 27.955000000000002 23.87 70-74 20.335 28.405 27.98 23.28 75-79 19.634999999999998 28.549999999999997 27.865000000000002 23.95 80-84 20.315 27.63 28.015 24.04 85-89 20.325 28.384999999999998 27.61 23.68 90-94 20.77 27.735 28.244999999999997 23.25 95-99 20.48 27.525 28.03 23.965 100-104 20.135 27.455000000000002 28.499999999999996 23.91 105-109 19.965 27.85 28.349999999999998 23.835 110-114 20.86 27.525 27.96 23.655 115-119 20.3 28.205000000000002 27.975 23.52 120-124 20.615 27.500000000000004 27.700000000000003 24.185000000000002 125-129 20.45 27.63 28.025 23.895 130-134 20.61 27.18 28.144999999999996 24.065 135-139 20.669999999999998 27.66 28.050000000000004 23.62 140-144 20.849999999999998 27.58 27.72 23.849999999999998 145-149 20.235 28.205000000000002 27.625 23.935000000000002 150-151 20.1625 28.1125 28.499999999999996 23.225 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 1.0 21 0.5 22 0.5 23 3.5 24 4.5 25 4.0 26 5.0 27 7.5 28 10.0 29 10.5 30 14.5 31 20.5 32 33.0 33 49.5 34 61.0 35 74.5 36 88.0 37 97.5 38 125.0 39 153.5 40 188.5 41 220.0 42 247.5 43 269.0 44 287.5 45 299.0 46 274.0 47 253.0 48 228.0 49 193.5 50 161.0 51 137.5 52 113.0 53 89.0 54 66.5 55 47.0 56 48.0 57 40.0 58 23.5 59 16.0 60 9.0 61 5.0 62 3.0 63 2.5 64 3.0 65 3.0 66 1.5 67 0.5 68 2.0 69 2.0 70 0.5 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.5000000000000004 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.1875 0.0 0.0 0.0 0.0 96-97 0.21250000000000002 0.0 0.0 0.0 0.0 98-99 0.25 0.0 0.0 0.0 0.0 100-101 0.30000000000000004 0.0 0.0 0.0 0.0 102-103 0.4125 0.0 0.0 0.0 0.0 104-105 0.4625 0.0 0.0 0.0 0.0 106-107 0.575 0.0 0.0 0.0 0.0 108-109 0.675 0.0 0.0 0.0 0.0 110-111 0.775 0.0 0.0 0.0 0.0 112-113 0.85 0.0 0.0 0.0 0.0 114-115 1.025 0.0 0.0 0.0 0.0 116-117 1.1875 0.0 0.0 0.0 0.0 118-119 1.275 0.0 0.0 0.0 0.0 120-121 1.3375 0.0 0.0 0.0 0.0 122-123 1.5 0.0 0.0 0.0 0.0 124-125 1.6625 0.0 0.0 0.0 0.0 126-127 1.8250000000000002 0.0 0.0 0.0 0.0 128-129 1.95 0.0 0.0 0.0 0.0 130-131 2.15 0.0 0.0 0.0 0.0 132-133 2.3875 0.0 0.0 0.0 0.0 134-135 2.6125 0.0 0.0 0.0 0.0 136-137 2.825 0.0 0.0 0.0 0.0 138-139 3.0250000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTGCCA 10 0.0068343505 144.975 4 GGATGCA 10 0.0068343505 144.975 4 CAACACA 10 0.0068343505 144.975 9 GTAGGTC 10 0.0068343505 144.975 8 CTGCCAT 10 0.0068343505 144.975 5 >>END_MODULE SRR7171917 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171917_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.871 33.0 33.0 34.0 32.0 34.0 2 32.93425 33.0 33.0 34.0 32.0 34.0 3 32.92275 34.0 33.0 34.0 32.0 34.0 4 32.89625 34.0 33.0 34.0 32.0 34.0 5 32.778 34.0 33.0 34.0 32.0 34.0 6 36.99225 38.0 38.0 38.0 36.0 38.0 7 37.04675 38.0 38.0 38.0 37.0 38.0 8 36.96275 38.0 38.0 38.0 36.0 38.0 9 37.07625 38.0 38.0 38.0 37.0 38.0 10-14 37.026799999999994 38.0 38.0 38.0 37.0 38.0 15-19 36.90985 38.0 38.0 38.0 36.4 38.0 20-24 36.89945 38.0 38.0 38.0 36.0 38.0 25-29 36.8892 38.0 38.0 38.0 36.4 38.0 30-34 36.85680000000001 38.0 38.0 38.0 36.0 38.0 35-39 36.8075 38.0 38.0 38.0 36.0 38.0 40-44 36.81415 38.0 38.0 38.0 36.0 38.0 45-49 36.82445 38.0 38.0 38.0 36.0 38.0 50-54 36.78789999999999 38.0 38.0 38.0 36.0 38.0 55-59 36.76685 38.0 38.0 38.0 36.0 38.0 60-64 36.7046 38.0 38.0 38.0 35.6 38.0 65-69 36.6645 38.0 38.0 38.0 35.2 38.0 70-74 36.588499999999996 38.0 38.0 38.0 35.0 38.0 75-79 36.54235 38.0 38.0 38.0 34.8 38.0 80-84 36.49855 38.0 38.0 38.0 34.8 38.0 85-89 36.3861 38.0 38.0 38.0 34.4 38.0 90-94 36.2436 38.0 38.0 38.0 34.0 38.0 95-99 36.19005 38.0 38.0 38.0 33.8 38.0 100-104 35.963 38.0 37.8 38.0 33.2 38.0 105-109 35.87564999999999 38.0 37.6 38.0 32.8 38.0 110-114 35.77765000000001 38.0 37.2 38.0 32.4 38.0 115-119 35.62055 38.0 37.0 38.0 31.4 38.0 120-124 35.532 38.0 37.0 38.0 31.0 38.0 125-129 35.269 38.0 36.4 38.0 30.0 38.0 130-134 35.01325 38.0 36.0 38.0 28.2 38.0 135-139 34.677800000000005 38.0 35.6 38.0 27.6 38.0 140-144 34.17155 38.0 35.0 38.0 23.4 38.0 145-149 33.7003 38.0 35.0 38.0 20.6 38.0 150-151 30.364124999999998 36.5 29.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 14.0 3 5.0 4 2.0 5 1.0 6 3.0 7 0.0 8 1.0 9 0.0 10 2.0 11 1.0 12 3.0 13 7.0 14 3.0 15 1.0 16 6.0 17 5.0 18 3.0 19 8.0 20 8.0 21 7.0 22 5.0 23 7.0 24 12.0 25 9.0 26 21.0 27 25.0 28 26.0 29 44.0 30 37.0 31 71.0 32 66.0 33 87.0 34 137.0 35 244.0 36 562.0 37 2567.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.01601601601602 17.417417417417415 14.93993993993994 26.626626626626624 2 23.34250688016012 25.894420815611706 33.82536902677008 16.937703277458095 3 21.766324743557668 28.071053289967473 30.397798348761572 19.764823617713283 4 25.11255627813907 33.96698349174587 21.46073036518259 19.459729864932466 5 23.567675756817614 38.07855891918939 21.541155866900176 16.81260945709282 6 19.375 38.4 23.974999999999998 18.25 7 18.7 19.625 41.099999999999994 20.575 8 20.575 23.65 27.6 28.175 9 21.9 25.624999999999996 28.7 23.775 10-14 22.761138056902848 29.35646782339117 26.426321316065803 21.456072803640183 15-19 22.878007302555893 27.97979292752463 28.419946981443506 20.722252788475966 20-24 23.186664664364017 28.738048756069478 27.0310857486109 21.0442008309556 25-29 23.279575277972555 28.61364319342883 27.386557147150153 20.720224381448464 30-34 23.100045087921448 28.615800811582588 28.019638294674614 20.26451580582135 35-39 22.818623765849747 28.411767653986868 27.254047010474615 21.515561569688767 40-44 23.0950353188718 28.761084114022346 27.523671158759583 20.620209408346273 45-49 23.34834834834835 28.588588588588586 27.73773773773774 20.325325325325323 50-54 23.072689979488718 28.450647856320977 27.81529841412777 20.661363750062534 55-59 22.86914765906363 28.16126450580232 27.96618647458984 21.00340136054422 60-64 23.095773943485874 28.207051762940733 28.182045511377847 20.51512878219555 65-69 23.982398239823983 28.08780878087809 27.552755275527552 20.377037703770377 70-74 23.165 28.76 27.415 20.66 75-79 23.14 28.285 28.15 20.424999999999997 80-84 23.635 28.199999999999996 27.73 20.435 85-89 23.36 28.32 27.445000000000004 20.875 90-94 23.835 28.125 26.935 21.105 95-99 23.494999999999997 28.299999999999997 27.55 20.655 100-104 23.625 28.215 27.900000000000002 20.26 105-109 23.585 28.395 27.83 20.19 110-114 23.93 28.199999999999996 27.765 20.105 115-119 23.425 28.015 28.24 20.32 120-124 23.64 28.165000000000003 27.76 20.435 125-129 23.885 28.384999999999998 27.01 20.72 130-134 24.19 27.825 28.035 19.950000000000003 135-139 23.78 27.700000000000003 28.1 20.419999999999998 140-144 23.755000000000003 28.865000000000002 27.33 20.05 145-149 24.9 27.894999999999996 27.185 20.02 150-151 24.3125 28.0875 27.800000000000004 19.8 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.5 13 0.5 14 0.5 15 0.5 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 1.5 22 2.5 23 2.0 24 3.5 25 5.5 26 4.0 27 5.0 28 9.0 29 10.0 30 12.0 31 15.0 32 18.0 33 24.5 34 38.5 35 55.0 36 70.0 37 95.0 38 140.5 39 177.5 40 207.5 41 242.5 42 262.5 43 290.0 44 297.5 45 285.0 46 285.5 47 274.0 48 249.0 49 206.5 50 159.0 51 131.5 52 111.0 53 81.5 54 55.0 55 42.5 56 33.5 57 22.5 58 12.5 59 8.0 60 11.0 61 10.0 62 6.5 63 5.0 64 2.5 65 3.0 66 4.5 67 3.5 68 1.0 69 1.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.075 3 0.075 4 0.05 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.005 15-19 0.034999999999999996 20-24 0.11499999999999999 25-29 0.16999999999999998 30-34 0.19499999999999998 35-39 0.23500000000000001 40-44 0.19499999999999998 45-49 0.1 50-54 0.055 55-59 0.04 60-64 0.025 65-69 0.01 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59829274416269 99.175 2 0.37660055234747675 0.75 3 0.025106703489831784 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.1875 0.0 0.0 0.0 0.0 96-97 0.21250000000000002 0.0 0.0 0.0 0.0 98-99 0.25 0.0 0.0 0.0 0.0 100-101 0.30000000000000004 0.0 0.0 0.0 0.0 102-103 0.4125 0.0 0.0 0.0 0.0 104-105 0.4625 0.0 0.0 0.0 0.0 106-107 0.575 0.0 0.0 0.0 0.0 108-109 0.675 0.0 0.0 0.0 0.0 110-111 0.775 0.0 0.0 0.0 0.0 112-113 0.85 0.0 0.0 0.0 0.0 114-115 1.025 0.0 0.0 0.0 0.0 116-117 1.1625 0.0 0.0 0.0 0.0 118-119 1.225 0.0 0.0 0.0 0.0 120-121 1.2875 0.0 0.0 0.0 0.0 122-123 1.4500000000000002 0.0 0.0 0.0 0.0 124-125 1.6125 0.0 0.0 0.0 0.0 126-127 1.775 0.0 0.0 0.0 0.0 128-129 1.8875000000000002 0.0 0.0 0.0 0.0 130-131 2.075 0.0 0.0 0.0 0.0 132-133 2.3125 0.0 0.0 0.0 0.0 134-135 2.5375 0.0 0.0 0.0 0.0 136-137 2.75 0.0 0.0 0.0 0.0 138-139 2.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 697510 spots for SRR7171917.sra Written 697510 spots for SRR7171917.sra Read 697510 spots for SRR7171917.sra Written 697510 spots for SRR7171917.sra Read 697510 spots for SRR7171917.sra Written 697510 spots for SRR7171917.sra Read 697510 spots for SRR7171917.sra Written 697510 spots for SRR7171917.sra Read 697510 spots for SRR7171917.sra Written 697510 spots for SRR7171917.sra Read 697521 spots for SRR7171917.sra Written 697521 spots for SRR7171917.sra Read 697510 spots for SRR7171917.sra Written 697510 spots for SRR7171917.sra Read 697510 spots for SRR7171917.sra Written 697510 spots for SRR7171917.sra Read 697510 spots for SRR7171917.sra Written 697510 spots for SRR7171917.sra Read 697510 spots for SRR7171917.sra Written 697510 spots for SRR7171917.sra Read 697510 spots for SRR7171917.sra Written 697510 spots for SRR7171917.sra Read 697510 spots for SRR7171917.sra Written 697510 spots for SRR7171917.sra Read 697510 spots for SRR7171917.sra Written 697510 spots for SRR7171917.sra Read 697510 spots for SRR7171917.sra Written 697510 spots for SRR7171917.sra Read 697510 spots for SRR7171917.sra Written 697510 spots for SRR7171917.sra Read 697510 spots for SRR7171917.sra Written 697510 spots for SRR7171917.sra Read 697510 spots for SRR7171917.sra Written 697510 spots for SRR7171917.sra Read 697510 spots for SRR7171917.sra Written 697510 spots for SRR7171917.sra Read 697510 spots for SRR7171917.sra Written 697510 spots for SRR7171917.sra Read 697510 spots for SRR7171917.sra Written 697510 spots for SRR7171917.sra SRR ids: ['SRR7171917.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_p7wgpjq_ SRR7171917.sra spots: 13950211 blocks: [[1, 697510], [697511, 1395020], [1395021, 2092530], [2092531, 2790040], [2790041, 3487550], [3487551, 4185060], [4185061, 4882570], [4882571, 5580080], [5580081, 6277590], [6277591, 6975100], [6975101, 7672610], [7672611, 8370120], [8370121, 9067630], [9067631, 9765140], [9765141, 10462650], [10462651, 11160160], [11160161, 11857670], [11857671, 12555180], [12555181, 13252690], [13252691, 13950211]] SRR7171917 file size 4705568 SRR7171917 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171917 SRR7171917_1.fastq SRR7171917_2.fastq Input file: SRR7171917_1.fastq Paired file: SRR7171917_2.fastq trimmed: SRR7171917-trimmed-pair1.fastq, SRR7171917-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 13:37:26 2025 >> started Fri Feb 14 13:37:43 2025 >> done (16.979s) 13950211 read pairs processed; of these: 19679 ( 0.14%) short read pairs filtered out after trimming by size control 15297 ( 0.11%) empty read pairs filtered out after trimming by size control 13915235 (99.75%) read pairs available; of these: 4771415 (34.29%) trimmed read pairs available after processing 9143820 (65.71%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 3 0.00% 21 4 0.00% 22 3 0.00% 23 3 0.00% 24 2 0.00% 25 2 0.00% 26 7 0.00% 27 4 0.00% 28 5 0.00% 29 6 0.00% 30 3 0.00% 31 1 0.00% 32 6 0.00% 33 2 0.00% 34 4 0.00% 35 9 0.00% 36 5 0.00% 37 3 0.00% 38 4 0.00% 39 8 0.00% 40 12 0.00% 41 8 0.00% 42 10 0.00% 43 39 0.00% 44 17 0.00% 45 23 0.00% 46 16 0.00% 47 64 0.00% 48 115 0.00% 49 19 0.00% 50 24 0.00% 51 26 0.00% 52 93 0.00% 53 99 0.00% 54 90 0.00% 55 51 0.00% 56 68 0.00% 57 86 0.00% 58 128 0.00% 59 66 0.00% 60 60 0.00% 61 103 0.00% 62 80 0.00% 63 74 0.00% 64 89 0.00% 65 98 0.00% 66 110 0.00% 67 129 0.00% 68 147 0.00% 69 182 0.00% 70 172 0.00% 71 216 0.00% 72 244 0.00% 73 292 0.00% 74 375 0.00% 75 370 0.00% 76 510 0.00% 77 588 0.00% 78 601 0.00% 79 671 0.00% 80 660 0.00% 81 778 0.01% 82 924 0.01% 83 1026 0.01% 84 1842 0.01% 85 2634 0.02% 86 2766 0.02% 87 2873 0.02% 88 3065 0.02% 89 3131 0.02% 90 3219 0.02% 91 3427 0.02% 92 3692 0.03% 93 3832 0.03% 94 3968 0.03% 95 4241 0.03% 96 4319 0.03% 97 4624 0.03% 98 4771 0.03% 99 5036 0.04% 100 5447 0.04% 101 5765 0.04% 102 6141 0.04% 103 6668 0.05% 104 6976 0.05% 105 7448 0.05% 106 7907 0.06% 107 8093 0.06% 108 8625 0.06% 109 9272 0.07% 110 9708 0.07% 111 10165 0.07% 112 10384 0.07% 113 11203 0.08% 114 12045 0.09% 115 12868 0.09% 116 13345 0.10% 117 13844 0.10% 118 14386 0.10% 119 15620 0.11% 120 16871 0.12% 121 16899 0.12% 122 16960 0.12% 123 18062 0.13% 124 19175 0.14% 125 20113 0.14% 126 20695 0.15% 127 21681 0.16% 128 22693 0.16% 129 23688 0.17% 130 24649 0.18% 131 26606 0.19% 132 28591 0.21% 133 29747 0.21% 134 32047 0.23% 135 34276 0.25% 136 36167 0.26% 137 38701 0.28% 138 41796 0.30% 139 44249 0.32% 140 47690 0.34% 141 52380 0.38% 142 58477 0.42% 143 65776 0.47% 144 76795 0.55% 145 91070 0.65% 146 112455 0.81% 147 150707 1.08% 148 227947 1.64% 149 451229 3.24% 150 2640233 18.97% 151 9143820 65.71% 13915235 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=5.05 fanout-score-rank=26 prefix-density=0.33 prefix-fanout=3.1 sequence=TCCTTGTCCTGGATCTTGGCCTTCAC criterion=fanout-score sequence-density=0.09 sequence-density-rank=22 fanout-score=69.01 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=16.8 sequence=CATCACCAACAG criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=2.64 fanout-score-rank=33 prefix-density=0.34 prefix-fanout=2.4 sequence=AGGAGGTTTCCT criterion=fanout-score sequence-density=0.07 sequence-density-rank=33 fanout-score=106.81 fanout-score-rank=1 prefix-density=0.45 prefix-fanout=16.9 sequence=AGAGAGAAAGAAACAACATGTCGTCGACGACAAAACCAAAGGCAGTGAAGCACACTCTATTCGTCAAGTTCAAAGATGACGTTACCAGAGAGCAAATTGAGAAAATCATAAACGACTTCACTCATCTGGTCAATCAAGTTGAACCCTTGAAGAGCTTACACTGGGGCACTAATCTGGGTATTCACGACCTCAATTTCGGATATACTCATGCTTTTGAAACTACCTTTGATGATCTGGAGGGCTTGCAGGAGTATCTTGATTCTTCGGTTGTTGCTAAATTCGCAGAAGGATTCTTGCCAACCATGTCGCAGCAATTTGTGATGGACTATGAACTCTACTAAATCTTTACTGGGCAATGAAGACT SRR7171917 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 13:38:47 Started mapping on | Feb 14 13:38:48 Finished on | Feb 14 13:40:56 Mapping speed, Million of reads per hour | 391.37 Number of input reads | 13915235 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 12848774 Uniquely mapped reads % | 92.34% Average mapped length | 296.87 Number of splices: Total | 12463401 Number of splices: Annotated (sjdb) | 12207648 Number of splices: GT/AG | 12257958 Number of splices: GC/AG | 161529 Number of splices: AT/AC | 9354 Number of splices: Non-canonical | 34560 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.55 Insertion rate per base | 0.02% Insertion average length | 2.61 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 347093 % of reads mapped to multiple loci | 2.49% Number of reads mapped to too many loci | 41216 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.80% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 737705 737705 737705 N_multimapping 347093 347093 347093 N_noFeature 344851 12721380 413769 N_ambiguous 131936 807 72898 UnstrandedReadsAssigned:12371987 PositiveStrandReadsAssigned:126587 NegativeStrandReadsAssigned:12362107 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171917 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171917-trimmed-pair1.fastq SRR7171917-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,915,235 reads, 12,275,977 reads pseudoaligned [quant] estimated average fragment length: 266.411 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,160 rounds 52401 SRR7171917.ke.tsv 34699 SRR7171917.se.tsv 87100 total ==> SRR7171917.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1752.59 996 46.7211 Potri.005G024800.1.v4.1 1035 769.589 407 43.478 Potri.004G059700.1.v4.1 961 695.626 13 1.53639 Potri.007G009000.2.v4.1 1416 1150.59 0 0 Potri.003G141000.2.v4.1 2943 2677.59 415.169 12.7472 Potri.016G087400.1.v4.1 270 68.8852 730 871.227 Potri.015G069301.1.v4.1 564 305.217 0 0 Potri.010G195200.1.v4.1 1773 1507.59 361.862 19.733 Potri.012G127500.1.v4.1 977 711.595 8300 958.914 ==> SRR7171917.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 147 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 247 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 290 SRR7171917 completed mapping pipeline successfully